ID: 1118692163

View in Genome Browser
Species Human (GRCh38)
Location 14:68350698-68350720
Sequence CTGATTTAGTGGAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118692163 Original CRISPR CTGATTTAGTGGAGGGGAGA TGG Intronic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
901038856 1:6352226-6352248 CTGATTTGGGGAAAGGGAGAAGG - Intronic
901213728 1:7541391-7541413 CTGAGTTAGAGGTTGGGAGAAGG + Intronic
901807524 1:11747875-11747897 CTCTTTTAGGGGAGGGGATATGG + Intronic
903036674 1:20497564-20497586 CTGATCTAGTGGATGGGGGCTGG - Intergenic
904684909 1:32252746-32252768 TTGGTTCAGAGGAGGGGAGAAGG + Intronic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907446772 1:54513189-54513211 CTGATTTAGTAGAAGGGGGGGGG + Intergenic
908843856 1:68304889-68304911 CTAATTCAGGGGAGAGGAGAGGG - Intergenic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
914358984 1:146913734-146913756 CTAATTTAGATGAGGGGAGAAGG + Intergenic
915034341 1:152909826-152909848 CTGACTGAGGGCAGGGGAGAGGG - Exonic
915499503 1:156305469-156305491 CTGCTTTATGGCAGGGGAGATGG + Intergenic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
916477600 1:165185255-165185277 CTGAATTAGTTGAGGGCAGTAGG - Intergenic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
917796274 1:178534900-178534922 CTGATCTCGTGGTGGGGATATGG + Intronic
920695494 1:208178827-208178849 CTGATTTAATGGATCTGAGATGG - Intronic
920708065 1:208269293-208269315 CTGAATTCATGGAGGAGAGAAGG + Intergenic
920735885 1:208532806-208532828 CTGATTCAGTGGTCTGGAGAGGG + Intergenic
921927721 1:220726297-220726319 CTGGTTTTGTAGACGGGAGAGGG - Intergenic
922336972 1:224625655-224625677 AGAATTAAGTGGAGGGGAGATGG + Intronic
924112282 1:240711941-240711963 CTGATTTGGAGGAGGGCAGTGGG - Intergenic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
1063455500 10:6179650-6179672 ATGATCCAGTTGAGGGGAGACGG - Intronic
1065403345 10:25332158-25332180 CTGATTCAGTAGATGGGAGGAGG + Intronic
1065445557 10:25794923-25794945 ATGATTTAGAAGAGGAGAGAAGG - Intergenic
1065488259 10:26255343-26255365 CAGTTTCAGTGGAGGGGTGAGGG + Intronic
1068638936 10:59380153-59380175 CTGATTTACTGAAGGGGATGAGG - Intergenic
1070307386 10:75247848-75247870 CTGATTTCCTGGGGGTGAGAAGG + Intergenic
1071444150 10:85730447-85730469 CTGATTTAGTTGACTTGAGATGG - Intronic
1071806973 10:89133223-89133245 TTGATTTAAGGGAGGGGGGAGGG - Intergenic
1072062273 10:91825106-91825128 TTGTTTTGGTCGAGGGGAGAGGG + Intronic
1073759946 10:106618509-106618531 CTGATTCAGGGCTGGGGAGATGG + Intronic
1074293262 10:112157665-112157687 TAGATTTAGTGTAGAGGAGATGG - Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075376602 10:121983025-121983047 CTGATTCAGTGGATGTGGGATGG + Intergenic
1075492165 10:122880324-122880346 CTGTTTTGGTGGAGAGGAGGTGG - Intergenic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1079487486 11:20950614-20950636 CTGTTTCAGAGAAGGGGAGAAGG - Intronic
1079702110 11:23561256-23561278 CGAATTTAGTGGTGGGGAGGGGG - Intergenic
1082100529 11:48169571-48169593 CGGACATATTGGAGGGGAGAGGG - Intronic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1084529102 11:69716737-69716759 CTCCTTCAGTAGAGGGGAGAAGG + Intergenic
1084783953 11:71430774-71430796 CTCATTCAGTAGAGGGGAGACGG - Intronic
1084905095 11:72339720-72339742 CTGATCCAGTTGAGGGGAGATGG + Intronic
1085274385 11:75288997-75289019 CTGATCTACCGGCGGGGAGAGGG + Intronic
1085997474 11:81937812-81937834 TTGAATTAGCGGAGGGGAGGAGG - Intergenic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1087192278 11:95267691-95267713 CTGATTTAATGGGGTGGAAAAGG + Intergenic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087991360 11:104747878-104747900 CTGAGTTAGTGGGGTGGAAAGGG + Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1090515839 11:127425649-127425671 CTGTTTCAGTGGAGGGTTGAGGG + Intergenic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1094643897 12:32302371-32302393 CTGAATTGGTGGAAGGGACACGG + Intronic
1094709617 12:32948439-32948461 CTGATGTACTGGGGGTGAGATGG + Intergenic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096023985 12:48345543-48345565 CTAAGTTAGTAGAGGAGAGAGGG + Intronic
1098216206 12:68222953-68222975 CTGAATCAGTGGTTGGGAGAGGG - Intronic
1098977028 12:76913388-76913410 ATGATCTTGGGGAGGGGAGAGGG + Intergenic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1102270412 12:111529972-111529994 CTGATTTAGTTGAGAAGAAATGG - Intronic
1102987755 12:117292264-117292286 GTAACTAAGTGGAGGGGAGAAGG + Intronic
1103074790 12:117973337-117973359 ATGATTTGGTGCAGGGAAGAGGG + Intergenic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105826692 13:24129472-24129494 TGGAGTTAGAGGAGGGGAGAGGG + Intronic
1106167260 13:27259170-27259192 CTGCTTTAATGAAGGGAAGAAGG - Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1112759066 13:102672620-102672642 CTGATTTTGTGAAGGAGAAAGGG - Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113381172 13:109807565-109807587 CTGTTTTAGTGTAGTGGATAGGG + Intergenic
1114141829 14:19920921-19920943 CCTTTTTACTGGAGGGGAGATGG + Exonic
1115812057 14:37120451-37120473 CTGATTTATTGGAGGACTGAAGG - Intronic
1118109696 14:62703499-62703521 CTTATTTATTGGCGGGGAAATGG + Exonic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1121656856 14:95603437-95603459 CAGGTTGAGTTGAGGGGAGAAGG + Intergenic
1121762915 14:96460904-96460926 TTGATCTGGTGGAGGGGAGGAGG - Intronic
1124953658 15:34345834-34345856 CTGCTGTGGGGGAGGGGAGAGGG - Intronic
1125211540 15:37221633-37221655 CTGATCTAGTGGAGTAGAGAAGG - Intergenic
1125255302 15:37756663-37756685 CTGTTTCAGTGGTGGGGAAATGG + Intergenic
1125315519 15:38427256-38427278 CTGATCCAGTGGAGGGGATGGGG - Intergenic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1129529116 15:76248273-76248295 GTGCATTAGTGGAGGAGAGAGGG + Intronic
1131083482 15:89556042-89556064 CTGATACAGTAGAGAGGAGAAGG - Intergenic
1131154012 15:90063767-90063789 CTGCTTTAGAGGTGAGGAGAGGG - Intronic
1131345433 15:91643402-91643424 CAGATTTGGGGGAGAGGAGATGG + Intergenic
1132147730 15:99438346-99438368 CTGTTTTGGGGGTGGGGAGAGGG + Intergenic
1133172550 16:3990661-3990683 CTGAGTCAGGGGAGGAGAGAGGG - Intronic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1137805626 16:51302673-51302695 GTGATACAGGGGAGGGGAGAGGG + Intergenic
1138293396 16:55867187-55867209 CAGGTTTAGTGGAAGGGAGCTGG - Intronic
1139237135 16:65351681-65351703 GTGATATAGTGGAGGTGGGAGGG - Intergenic
1140181265 16:72721285-72721307 CTTTTTTATTGGATGGGAGAAGG - Intergenic
1141427644 16:83954045-83954067 CTGTTTTACTGGAGGGGACTTGG + Intronic
1141887897 16:86905260-86905282 CTTGTTGAGTGGAGGGGATAGGG + Intergenic
1144168790 17:12638390-12638412 CCCTTTTATTGGAGGGGAGAAGG - Intergenic
1144582361 17:16466150-16466172 CTGGCTTAGGGGAGGGGGGATGG - Intronic
1146680990 17:34808129-34808151 TTGAATTGGTGGAGGGGAGGTGG - Intergenic
1148026264 17:44589784-44589806 CTGACTTAGAGGCAGGGAGAGGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1153910928 18:9706414-9706436 CAGAACTAGGGGAGGGGAGAAGG + Intergenic
1154302122 18:13203444-13203466 CTGATTGAGAGCAGGGCAGAAGG + Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156009990 18:32486095-32486117 TTAATTTGGTGGAGGGAAGAAGG + Intergenic
1156522124 18:37730759-37730781 CTGATTTTGCTGAGGGGTGATGG - Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1158416936 18:57256946-57256968 GTGGTTGAGAGGAGGGGAGAGGG + Intergenic
1158920761 18:62188080-62188102 CGGAGTTACTGTAGGGGAGAGGG + Intronic
1159275842 18:66220410-66220432 CTGTTTTAGGGGAGGAGAGTGGG + Intergenic
1162488977 19:10980440-10980462 ATGATTTGATGGAAGGGAGAGGG + Intronic
1164604170 19:29584275-29584297 CAGATATAGAGAAGGGGAGAAGG + Intergenic
1164866008 19:31605055-31605077 CTTCTTTAGGGGAGGGGAGGTGG + Intergenic
1165372746 19:35419928-35419950 CTGATTTATTGGTGCAGAGAGGG - Intergenic
1166298037 19:41898130-41898152 CTGCCTTAGTGGATGGGGGAAGG - Intronic
1166647659 19:44544076-44544098 CTGAGTTGGTGGAGAGTAGATGG - Intergenic
925717438 2:6797290-6797312 CTGACTTCGTGTAGGGGTGAAGG + Intergenic
927796466 2:26053371-26053393 CTGATTTACTTGGGGGGAAATGG + Intronic
927854771 2:26521107-26521129 CTGATTCAGTGGGTGGGAGAGGG + Intronic
928038630 2:27851247-27851269 TTGATTTAGTGGAGGAGAGAGGG - Intronic
928100174 2:28432209-28432231 ATGATTTATGGGAGGAGAGAGGG - Intergenic
928747871 2:34435965-34435987 CTGACTAAGTGTAGGCGAGAAGG + Intergenic
929232420 2:39573224-39573246 TAGAAATAGTGGAGGGGAGAGGG + Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
931617196 2:64171790-64171812 ATGATTTAGTGAAGGGAAGAAGG - Intergenic
932112687 2:69014698-69014720 CTGTTACAGTGGTGGGGAGATGG + Intronic
932817362 2:74872646-74872668 CTGTTTCTGTGGAGGGGATAAGG - Intronic
932870948 2:75397162-75397184 ATGATTTAGGGGAGGTGTGATGG - Intergenic
933526237 2:83443608-83443630 ATTTTTTATTGGAGGGGAGATGG - Intergenic
934196491 2:89841264-89841286 CATATTTGCTGGAGGGGAGATGG - Intergenic
934779596 2:96961081-96961103 CTGATTTAGTGGATGGGAGCTGG + Intronic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
936686906 2:114838143-114838165 TGGATTTAGTGGAGGTGATATGG - Intronic
938949183 2:136241517-136241539 CAGACTTGGTGGAGGTGAGAAGG - Intergenic
939251336 2:139684858-139684880 CTGAGTTAGAAGAGGGGAGGGGG - Intergenic
943352067 2:186806929-186806951 CTGCTTTCATGGAGAGGAGAAGG - Intergenic
945005020 2:205395857-205395879 CAGAGTTAGTGGAGGAGAAACGG - Intronic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945298931 2:208198083-208198105 CTGCTTCAGGGGAGGAGAGATGG - Intergenic
946221990 2:218235712-218235734 ATGATTTAGTGGGAGGTAGAAGG - Intronic
946338520 2:219054498-219054520 CTTATTTATTGGAGTGGAGGGGG - Exonic
946526901 2:220530471-220530493 CATATTGAGGGGAGGGGAGAAGG - Intergenic
946724867 2:222652305-222652327 CTGAATCAGTGGAGGTTAGAGGG + Intronic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947349920 2:229232618-229232640 GTGATTTTGTTGAGTGGAGATGG - Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
1168789467 20:566537-566559 CTTATTTCCTGGAGTGGAGAGGG - Intergenic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169723510 20:8703905-8703927 CTAAATTAGAGGAGGGGAGGAGG + Intronic
1170655414 20:18282548-18282570 CAGATATAGCTGAGGGGAGATGG + Intergenic
1171794613 20:29557066-29557088 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1171853840 20:30327198-30327220 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1173947140 20:46960585-46960607 CTGCTCTAGTGCAGGGGAGGAGG + Intronic
1174750730 20:53108956-53108978 CTGAGTTCTTGGAGGGTAGAGGG - Intronic
1174909362 20:54589968-54589990 CTGATTTAGTGAACCAGAGAAGG - Intronic
1176659663 21:9622466-9622488 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1176891614 21:14326399-14326421 TTGATTTACTGTAGGGGAAAGGG - Intergenic
1177384303 21:20389003-20389025 GAGTTTTAGGGGAGGGGAGAAGG - Intergenic
1178359207 21:31933880-31933902 CTTCTTTCATGGAGGGGAGAGGG - Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1178968949 21:37154002-37154024 CTGCTTTAGGGGAGGGCAGGGGG - Intronic
1179035830 21:37758067-37758089 CTGGTTTAGTGGAGGGGGAGAGG + Intronic
1181507968 22:23374467-23374489 CAGGTTTAGTGGAAGGGAGTTGG - Intergenic
1181675088 22:24446084-24446106 CTCATTAAGTGGTTGGGAGAGGG - Intergenic
1182744330 22:32594079-32594101 CAGCTTTAGTGGAGTGGAGGGGG + Intronic
1184502705 22:44883381-44883403 CCTTTGTAGTGGAGGGGAGAGGG - Intronic
1184683061 22:46082698-46082720 CTGATTTTGAGGTGGGGGGAGGG - Intronic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
953048231 3:39314964-39314986 CTGATTCAGGGCAGGGGAGGAGG + Intergenic
954529491 3:51306256-51306278 CAGATATAGTGGAGGCCAGAAGG - Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955450091 3:59057185-59057207 CTGATTTAGGGGAGGGTTTAGGG - Intergenic
957275645 3:78087974-78087996 ATGTTTTAGGGGAGGAGAGAAGG + Intergenic
958013861 3:87914948-87914970 CTGTTTTAGTGGAGGTGGTAGGG - Intergenic
958820067 3:98963276-98963298 CTGATTTGGGGAGGGGGAGAAGG + Intergenic
960371481 3:116846331-116846353 TTGATGTGGAGGAGGGGAGAGGG + Intronic
961000659 3:123371884-123371906 CAGATTTGGGGCAGGGGAGAGGG + Intronic
961250276 3:125497918-125497940 CAGATTTTGTGGAGAGGCGACGG - Exonic
961490851 3:127255933-127255955 AAGAGTTAGTGGTGGGGAGAGGG - Intergenic
962202652 3:133414211-133414233 TGGGTTTTGTGGAGGGGAGAGGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
966684205 3:182676330-182676352 GTAATTTAGAAGAGGGGAGATGG - Intergenic
966954292 3:184857931-184857953 GTGATTTAGTGAAGTGAAGAGGG + Intronic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967289090 3:187901961-187901983 CTAATTTTGTGGAAAGGAGAAGG + Intergenic
967748824 3:193090257-193090279 CTGATTTAGTTGAGTTGGGATGG - Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
969295393 4:6267537-6267559 CACATTTGGTTGAGGGGAGAAGG - Intergenic
970171993 4:13299552-13299574 CTGACTCAGGGGAGAGGAGAGGG - Intergenic
970185673 4:13449808-13449830 CTTAGTTAGTGGAGGGGTGGTGG - Intronic
971043952 4:22784039-22784061 CTGATTTATTCAAGGGGAGCTGG - Intergenic
971103444 4:23495945-23495967 CTGATTTGGTGGCAGGGAGTTGG + Intergenic
973844056 4:54892949-54892971 CTGTTTTAGTGGAGCAGTGAAGG - Intergenic
974182950 4:58406764-58406786 CTGTTTCTGTGGAGGGGAAATGG - Intergenic
975151276 4:71023815-71023837 CTAATTTAGAGGTGGGGAGTGGG - Intronic
975489466 4:74972894-74972916 CTGATACAGTGTAGTGGAGAAGG + Intronic
975644589 4:76533705-76533727 CTGATTTGGTTTAGGAGAGAAGG - Intronic
978776866 4:112514438-112514460 CTGATTTACTGAAGGTGTGATGG - Exonic
981331302 4:143513604-143513626 CTGATTTAGAGAAGGGCGGAGGG - Exonic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
984141567 4:176010541-176010563 CTGCTGTAGTGAAGAGGAGAGGG + Intergenic
985415707 4:189733949-189733971 TGGAGTTGGTGGAGGGGAGATGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
988679983 5:33475524-33475546 CTCATTTACTGGAGGGAAGGAGG - Intergenic
989119927 5:37994705-37994727 CTGATTTAGGGGAGGAGAAGAGG - Intergenic
990479622 5:56196942-56196964 CTGATTTAGTAGATCTGAGATGG - Intronic
990864095 5:60361469-60361491 CTGATTTATTAGAGTGGAGAAGG - Intronic
992668658 5:79036729-79036751 CTGATTTAGTGGTCCGGAGAGGG - Intronic
993327518 5:86560413-86560435 CTGAGTTACTGGAAGAGAGAGGG - Intergenic
995084501 5:108091687-108091709 TTGTTTTAGTGGAGTGTAGAGGG - Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996379245 5:122846601-122846623 AATATTTAGAGGAGGGGAGAGGG - Intronic
996809899 5:127505088-127505110 CTAATGTAGTGGTGGGGTGAAGG + Intergenic
997281548 5:132651150-132651172 CTGGGTAAGTGGAGGGGATATGG + Intergenic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
998530996 5:142884371-142884393 ATGATTCAGTGGTGGGGAGCAGG + Intronic
999874096 5:155783034-155783056 ATGACTCGGTGGAGGGGAGAGGG + Intergenic
1000274114 5:159717574-159717596 CTGTTTTAGAGGTGGGGAAATGG - Intergenic
1000383052 5:160646226-160646248 CTGATTTAGTGTGGGTGAGTGGG - Intronic
1000703394 5:164480975-164480997 GTGATTTAGTGGATGTGAGGTGG - Intergenic
1001153389 5:169251932-169251954 CTGTTTTTGTGGCGGTGAGATGG - Intronic
1001695599 5:173667620-173667642 CTGACCTAGTCCAGGGGAGAAGG + Intergenic
1001973706 5:175979206-175979228 CTCAGTCAGTAGAGGGGAGATGG + Intronic
1002243726 5:177864573-177864595 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1004048704 6:12051455-12051477 GTTACTTACTGGAGGGGAGAAGG - Intronic
1005194215 6:23264142-23264164 CTGCTTTAGTGGAGAGATGAGGG + Intergenic
1005825147 6:29627895-29627917 CTGATTTTGTGGGGAGGAGGGGG + Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1007250677 6:40492800-40492822 CTCATTTAGAGGAGGAGAGGAGG + Intronic
1007556688 6:42772326-42772348 CTGAGTTAGGCGACGGGAGAAGG + Intronic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1012553417 6:100484808-100484830 CTGATTTGTTGGGGTGGAGAAGG - Intergenic
1012768633 6:103400559-103400581 CTTATGTGGTGGAGGGGACAAGG + Intergenic
1013171227 6:107638080-107638102 GTGATTTAGTGGAGGAGAGGTGG - Intronic
1013177756 6:107691682-107691704 GTGATTTAGTGATGGGGGGAGGG - Intergenic
1014009978 6:116464448-116464470 CTGATTTAGATTAGGGGAGAAGG + Intergenic
1014009993 6:116464576-116464598 CTGATTTAGATTAGGGGAGAAGG + Intergenic
1014847545 6:126296980-126297002 CTGTTGTAGGTGAGGGGAGAAGG - Intergenic
1015000392 6:128207280-128207302 TTGATTTTGTAGCGGGGAGAGGG - Intronic
1015549273 6:134395092-134395114 ATGAGTCAGTGGAGGGGAAAAGG + Intergenic
1019933973 7:4242378-4242400 CGGATTGAGTGCAGGCGAGAAGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026540023 7:71271764-71271786 TTTATTTAGTGGTGGGGACAGGG + Intronic
1027943765 7:84719507-84719529 CTGCTTTATTTTAGGGGAGAGGG + Intergenic
1027980401 7:85212263-85212285 ATGATTTATTTCAGGGGAGAAGG + Intergenic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030787881 7:113684792-113684814 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1036646978 8:10617061-10617083 CTGCCCAAGTGGAGGGGAGAGGG + Intronic
1038634030 8:29271140-29271162 CAGTTTTAGTGCAGGGGTGAAGG - Intergenic
1039874607 8:41574957-41574979 TTTTTTTGGTGGAGGGGAGAGGG - Intergenic
1040894831 8:52355192-52355214 TTGATAGAGTGGAAGGGAGAGGG - Intronic
1041358691 8:57027707-57027729 CTGTTTTAGTGATGGGGATATGG + Intergenic
1042017616 8:64332981-64333003 CTGATTTAGTGCAGGAGGGAGGG - Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1045563198 8:103285894-103285916 TTTATTTATTTGAGGGGAGATGG - Intergenic
1045630203 8:104110008-104110030 CTTATTTTCTAGAGGGGAGATGG + Intronic
1046704855 8:117438482-117438504 CAGATGTAGTGAAGGGGGGATGG + Intergenic
1047751217 8:127882156-127882178 CTCATTCAGGGGAGGGGGGATGG - Intergenic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1051790236 9:20793891-20793913 CTTATTTAGTGGAGAGGGAAGGG + Intronic
1052564427 9:30129311-30129333 GAGATTAAGGGGAGGGGAGATGG + Intergenic
1052955200 9:34248808-34248830 TTGTTTTATTGGTGGGGAGAGGG - Intronic
1053316540 9:37056745-37056767 CTTAAAAAGTGGAGGGGAGAGGG + Intergenic
1053791639 9:41690490-41690512 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054180042 9:61902505-61902527 CTGATTTAGTAGAGGGTGAAGGG + Intergenic
1054657551 9:67678636-67678658 CTGATTTAGTAGAGGGTGAAGGG - Intergenic
1054967925 9:71050894-71050916 CTGATTAATGGGAGGGGAGAAGG + Intronic
1055365945 9:75544909-75544931 CTGATTTGTTGGAGGGGATTGGG - Intergenic
1058634630 9:107024389-107024411 CTGATTTATTTGGGGAGAGATGG - Intergenic
1059407819 9:114112771-114112793 CCCATTTGGTGGTGGGGAGAAGG + Intergenic
1059587714 9:115623911-115623933 CTGCTTTAGTGGGGTGGGGATGG - Intergenic
1059675094 9:116530731-116530753 CTAATTTAGTTGAGAGGAAAAGG - Intronic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1061945767 9:133907580-133907602 ATGTTTTAGGGGATGGGAGAAGG + Intronic
1203637222 Un_KI270750v1:124309-124331 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1187920183 X:24194271-24194293 TTGCTTTGGTGGGGGGGAGAAGG - Intronic
1188261975 X:28033558-28033580 AGGATTTAGTAGAGGGCAGAAGG + Intergenic
1188369230 X:29348581-29348603 CTGATTTAGGAGGGGAGAGAGGG + Intronic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1189575998 X:42354199-42354221 CTTATGTGGTGGAGGGGGGATGG + Intergenic
1189587824 X:42478550-42478572 CTGATTTATAAGAGGGGACAGGG - Intergenic
1191778952 X:64846622-64846644 CTGATTTTGGGGAGGAGAGAGGG - Intergenic
1192300645 X:69898132-69898154 CTGATTTGGTGGAGGGGGGTTGG + Intronic
1192939403 X:75897188-75897210 CTAATTTGGTGGAGGGTAGAAGG + Intergenic
1194638359 X:96373204-96373226 ATAAATTAGTGGTGGGGAGAGGG + Intergenic
1195698291 X:107682962-107682984 CTGATTTAGTGGAGCAGACATGG - Intergenic
1199205774 X:145146636-145146658 CAGACTTAGTGGAGGGGTCAAGG - Intergenic
1200354873 X:155538119-155538141 GTGATTGAGGGGAGGGAAGATGG - Intronic