ID: 1118692448

View in Genome Browser
Species Human (GRCh38)
Location 14:68352953-68352975
Sequence CTCTATAGGCTAAACATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118692448 Original CRISPR CTCTATAGGCTAAACATGGG AGG (reversed) Intronic
901384716 1:8900134-8900156 CTATATAGTCTAAAAAGGGGAGG - Intergenic
901495656 1:9620002-9620024 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
913659939 1:120997858-120997880 CTCTTTAGCATAAACATGGGGGG - Intergenic
914011296 1:143781009-143781031 CTCTTTAGCATAAACATGGGGGG - Intergenic
914166538 1:145180127-145180149 CTCTTTAGCATAAACATGGGGGG + Intergenic
914442561 1:147720152-147720174 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
914649920 1:149689648-149689670 CTCTTTAGCATAAACATGGCGGG - Intergenic
917071776 1:171159372-171159394 CTATATAGTCTAAAAAGGGGAGG + Intronic
922600802 1:226851220-226851242 CTATATGGTCTAAAAATGGGAGG + Intergenic
923090860 1:230740102-230740124 CTCTATAGTCTAAAAAGGAGAGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064250861 10:13705485-13705507 CTCCATAGGATAAAAATGAGGGG - Intronic
1064329209 10:14378022-14378044 CTATATAGTCTAAAAAGGGGAGG + Intronic
1065029827 10:21574682-21574704 CTATATAGTCTAAAAAGGGGAGG - Intronic
1067328376 10:45291616-45291638 CTATATGGTCTAAAAATGGGAGG - Intergenic
1068495985 10:57786056-57786078 CTATATAGTCTAAAAGTGGGAGG + Intergenic
1068935087 10:62627976-62627998 CTCTATGGCCTGTACATGGGTGG + Intronic
1071013488 10:80967006-80967028 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1071392589 10:85190502-85190524 CTGTATGGTCTAAAAATGGGAGG - Intergenic
1074233812 10:111564457-111564479 CTCTAGAGGCTGAACATGCCAGG + Intergenic
1074592781 10:114829291-114829313 CTATATAGTCTAAAAAGGGGAGG - Intronic
1074614267 10:115050868-115050890 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1080157361 11:29127322-29127344 ACGTATGGGCTAAACATGGGGGG - Intergenic
1080344857 11:31312867-31312889 GTATATAGGCTGGACATGGGTGG + Intronic
1081970372 11:47194264-47194286 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1082695587 11:56360346-56360368 CTCTATGGGCTGACCATGGCAGG + Exonic
1084367319 11:68710707-68710729 CTCCATGGGCTAATCCTGGGTGG - Intronic
1086572856 11:88305137-88305159 CTCTATGGTCTAAAAAGGGGAGG + Intronic
1088085819 11:105978884-105978906 CTCTATAACCTCAATATGGGAGG + Intronic
1088317109 11:108518953-108518975 CTATATGGGCTAAAAAGGGGAGG + Intronic
1097456456 12:59804352-59804374 CTATATGGTCTAAAAATGGGAGG - Intergenic
1098569564 12:71973486-71973508 CTATATAGCCTAAAAAGGGGAGG + Intronic
1098909632 12:76195795-76195817 CTATATAGTTTAAAAATGGGAGG - Intergenic
1099075000 12:78095834-78095856 CTCTATTGTGCAAACATGGGTGG - Intronic
1099382917 12:81977064-81977086 ATGTATAGGCTGCACATGGGAGG - Intergenic
1099854316 12:88143925-88143947 CTATATAGTCTAAAAAGGGGAGG - Intronic
1100476704 12:94941770-94941792 CTCAAGAGGCTAAAAATAGGAGG - Intronic
1102122405 12:110451850-110451872 CTCTAGAAGCTAAACCAGGGAGG + Intergenic
1102410730 12:112715964-112715986 CTATACAGTCTAAAAATGGGAGG - Intronic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1103523054 12:121549095-121549117 CTCAATAGTCCCAACATGGGAGG + Intronic
1104372824 12:128238319-128238341 CTATATGGTCTAAAAATGGGAGG + Intergenic
1104448226 12:128849946-128849968 CTATATGGTCTAAACAGGGGAGG - Intergenic
1104808536 12:131605265-131605287 GACTATATGCTAAACAAGGGTGG + Intergenic
1113519067 13:110925459-110925481 CTATATGGTCTAAAAATGGGAGG + Intergenic
1115482409 14:33874313-33874335 CTTGATACGCTAAACAAGGGTGG - Intergenic
1116329972 14:43583305-43583327 CTATATGGTCTAAACAGGGGAGG + Intergenic
1116556774 14:46321157-46321179 CTATATGGTCTAAAAATGGGAGG + Intergenic
1118692448 14:68352953-68352975 CTCTATAGGCTAAACATGGGAGG - Intronic
1119317693 14:73709271-73709293 TTCTACAGTTTAAACATGGGGGG - Intergenic
1119580832 14:75779048-75779070 CTCTGTGGGCTACATATGGGTGG + Intronic
1119735694 14:76980414-76980436 CTATATGGTCTAAACAGGGGAGG + Intergenic
1120089050 14:80309976-80309998 CTTTGTAGGCTAATCATGAGAGG + Intronic
1121149439 14:91618115-91618137 CTATATAGTCTAAAAAGGGGAGG - Intronic
1121773411 14:96573148-96573170 CTATATTGGTTTAACATGGGGGG + Intergenic
1124211013 15:27765038-27765060 CTATACAGTCTAAAAATGGGAGG - Intronic
1127028398 15:54833873-54833895 CTCAAGAGCCTAAACATGGTGGG + Intergenic
1128277429 15:66365391-66365413 CTATATAGTCTAAAAAGGGGAGG + Intronic
1130440094 15:83944752-83944774 CTCTAAAGCCTAAATCTGGGTGG + Intronic
1135959723 16:26985567-26985589 CTATATGGTCTAAACAGGGGAGG + Intergenic
1135980391 16:27142552-27142574 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1139854024 16:69966546-69966568 CTATATGGTCTAAAAATGGGAGG + Intergenic
1140518203 16:75559799-75559821 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1140641417 16:76977756-76977778 CTATATGGTCTAAACAGGGGAGG + Intergenic
1141407426 16:83806919-83806941 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1146876357 17:36415445-36415467 CTATATAGTCTAAAAAGGGGAGG - Intronic
1147063026 17:37897428-37897450 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1148652797 17:49261682-49261704 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1149749709 17:59133805-59133827 CTTTATAGCCAAAACTTGGGGGG + Intronic
1152208274 17:78988369-78988391 CTCTATGGTCTAAAAACGGGAGG + Intergenic
1155017902 18:21863619-21863641 CTTTAAAGGCACAACATGGGAGG + Intronic
1156561423 18:38129976-38129998 CTATATGGGCTAAAAAGGGGTGG - Intergenic
1164687504 19:30177506-30177528 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1164843398 19:31411760-31411782 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1164942254 19:32260023-32260045 CTATATAGTCTAAAAAAGGGAGG - Intergenic
1164942774 19:32264416-32264438 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1164947456 19:32308574-32308596 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1165131769 19:33637032-33637054 CTCTATGGTCTAAAAAGGGGAGG - Intronic
1166900634 19:46058931-46058953 CTATATAGTCTAAAAAGGGGAGG - Intronic
1168266373 19:55225879-55225901 CTCTAAATGCTAACCATGGATGG + Intergenic
1168382736 19:55938094-55938116 CTATATGGTCTAAAAATGGGAGG + Intergenic
1168606978 19:57767972-57767994 CTATATAGTCTAAAAAGGGGAGG - Intergenic
927321368 2:21749724-21749746 CTCTATAGTCGAAAAGTGGGAGG + Intergenic
927408753 2:22801120-22801142 CTATATAGTCTAAAAAGGGGAGG - Intergenic
928146082 2:28777031-28777053 CTCTAGATCTTAAACATGGGAGG - Intronic
929700398 2:44157610-44157632 CTTTTTATGCTAAACATGGTAGG - Intergenic
931423770 2:62152194-62152216 ACCTACATGCTAAACATGGGCGG - Intergenic
935156277 2:100486363-100486385 CTCCATAGGATAATCTTGGGAGG - Intergenic
935248090 2:101236754-101236776 CTATATAGTCTAAAAAGGGGAGG + Intronic
941286977 2:163626967-163626989 CTATATAGTCTAAAAAGGGGAGG + Intronic
946114430 2:217448961-217448983 CTATATGGTCTAAAAATGGGAGG - Intronic
947097259 2:226580274-226580296 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
948550226 2:238766026-238766048 CTGTAGAGGCTAGACATGGGAGG - Intergenic
1169286342 20:4310555-4310577 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1169782043 20:9320243-9320265 CTATATAGTCTAAAAAGGGGAGG - Intronic
1173357985 20:42313225-42313247 CTTGATATGCTAAACAAGGGTGG - Intronic
1173752657 20:45489100-45489122 CTATATAGACTAAAAAGGGGAGG - Intergenic
1174102713 20:48139410-48139432 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1174962630 20:55175573-55175595 CTCTCAAGGTTAAACTTGGGTGG - Intergenic
1181158686 22:20942903-20942925 CTCAAAAAGCTAAACATAGGAGG - Intronic
1182521461 22:30887061-30887083 CTCTATGGTCTAAAAAGGGGAGG - Intronic
1183113770 22:35673746-35673768 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1183856891 22:40640754-40640776 CTCTCTGGTCTAAAAATGGGAGG + Intergenic
949334891 3:2963630-2963652 TTCTTTAGGTTAAACATGGAAGG - Intronic
952894288 3:38066805-38066827 CTCTATATGCTGAACATTAGAGG + Intronic
954145642 3:48633033-48633055 CTATAGAGGCCAAACACGGGGGG + Exonic
955381172 3:58439603-58439625 CTATATAGTCTAAAAAGGGGAGG - Intergenic
956286654 3:67617475-67617497 CTCTTTAGCCTGAACATGGAGGG - Intronic
956656832 3:71560501-71560523 CTCTAAAGGTTAAACATAGAAGG + Intronic
957539179 3:81546682-81546704 CTCTATGGTCTAAAAGTGGGAGG + Intronic
959681013 3:109096541-109096563 CTATATGGTCTAAAAATGGGAGG + Intronic
960807856 3:121601149-121601171 CTCGATAGTCTAATCATGGCTGG - Intronic
962835875 3:139187946-139187968 CTCTATTGGCTGAAGGTGGGAGG + Intronic
962836111 3:139190145-139190167 CTCTATTGGCTGAAGGTGGGAGG + Intronic
965327455 3:167324763-167324785 CTCTATAGGCTGAAGATGACTGG - Intronic
966241510 3:177759430-177759452 CTATATAGTCTAAAAAAGGGAGG + Intergenic
967694699 3:192516473-192516495 TTATATAGGCTAAACATTCGCGG + Intronic
971098645 4:23437052-23437074 TTCTGTAGTGTAAACATGGGTGG - Intergenic
974100185 4:57407595-57407617 CACTTGAGGGTAAACATGGGAGG + Intergenic
978942548 4:114454254-114454276 CTATATGGTCTAAAAATGGGAGG - Intergenic
979516608 4:121616743-121616765 CTCTATAGGCTAGACTTCTGTGG + Intergenic
983401212 4:167268483-167268505 CTATATAGTCTAAAAAGGGGTGG + Intergenic
985656130 5:1132262-1132284 CTCTATGGCCTAAAAAGGGGAGG + Intergenic
987065930 5:14289442-14289464 CTCAAGAGGCTTAAGATGGGAGG + Intronic
988388507 5:30597712-30597734 CTATATAGTCTAAAAAGGGGAGG + Intergenic
991083308 5:62624338-62624360 CTATATAGTCTAAAAAGGGGAGG - Intronic
995091817 5:108187165-108187187 CTTTAGAGGCTAAACATCAGCGG - Intronic
996324282 5:122254688-122254710 CTCTGTAGTTTAATCATGGGAGG + Intergenic
999497572 5:152115073-152115095 GTCTATAGGGAAAACATGGAAGG + Intergenic
999686608 5:154108698-154108720 CACTTTAAGCTAAAAATGGGTGG - Intronic
1001210848 5:169808925-169808947 GTCTATTGGCTAAACCTGGGTGG + Intronic
1001388778 5:171361591-171361613 CTATATGGTCTAAACAGGGGAGG + Intergenic
1001510248 5:172315671-172315693 CTATATGGTCTAAAAATGGGAGG + Intergenic
1002359843 5:178661843-178661865 CTCTATCGCCTAAAAAGGGGAGG - Intergenic
1005449723 6:25961093-25961115 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1013601622 6:111710645-111710667 CTCTCTAGGCTCAACATGTGAGG - Intronic
1015028741 6:128568817-128568839 TTCTATAGGCAAATCATGGCTGG + Intergenic
1016154739 6:140791355-140791377 CTCTCATGGCTAAACATGTGTGG - Intergenic
1016695498 6:146989761-146989783 CTCTGTAGCCTAAATATTGGAGG + Intergenic
1016983285 6:149873336-149873358 CTCAGGAGGCTAAAAATGGGAGG - Intergenic
1021334136 7:19377715-19377737 CTCTCTAGGCTAAACAAGAAGGG - Intergenic
1021386689 7:20039548-20039570 CTATATGGTCTAAACAGGGGAGG - Intergenic
1022478642 7:30728441-30728463 CTATATGGTCTAAAAATGGGAGG + Intronic
1022627080 7:32048198-32048220 CTCTATAGATTAAACAAGGCTGG + Intronic
1027958472 7:84913370-84913392 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1028165377 7:87532582-87532604 CTATATGGTCTAAAAATGGGAGG + Intronic
1032842135 7:135722762-135722784 CTCTAGATGCAAAACATGGTAGG - Intronic
1033824790 7:145176226-145176248 GCCTCTAGGATAAACATGGGAGG + Intergenic
1035872707 8:3153250-3153272 CTCTATGGTCTAAAAAGGGGAGG + Intronic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1043569916 8:81591057-81591079 CTCTAGTGGATAAAGATGGGAGG + Intergenic
1043981156 8:86641203-86641225 CTATATAGTCTAAAAAGGGGAGG + Intronic
1044540199 8:93400017-93400039 CTCTATAGGTAAAACATTGCAGG + Intergenic
1045253169 8:100498063-100498085 CTATATGGTCTAAAAATGGGAGG - Intergenic
1046126657 8:109918440-109918462 CTCCATAGGATCAACGTGGGTGG + Intergenic
1053205371 9:36181839-36181861 CTCTATAGACAACACTTGGGAGG + Intergenic
1053438989 9:38098741-38098763 TTCTATAGGCTAATCATAGCAGG - Intergenic
1055708499 9:79033870-79033892 CTTTATAGGCAAAGGATGGGGGG + Intergenic
1056469885 9:86895001-86895023 CTATATGGTCTAAAAATGGGAGG + Intergenic
1058048706 9:100384738-100384760 CTATATGGTCTAAACATGGGAGG + Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1062099566 9:134721201-134721223 CTCTAGAGGGTTATCATGGGGGG - Intronic
1203785367 EBV:124592-124614 GTCTGCAGGATAAACATGGGAGG + Intergenic
1187070529 X:15883112-15883134 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1187140254 X:16586414-16586436 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1189953832 X:46258581-46258603 CTTTATGGTCTAAAAATGGGAGG + Intergenic
1191902049 X:66051687-66051709 CTCTGGAGGCTGAACCTGGGAGG + Intergenic
1192888891 X:75366984-75367006 CTATATGGCCTAAAAATGGGAGG + Intergenic
1195133695 X:101881024-101881046 CACTATAGATTAAATATGGGTGG + Intergenic
1197904577 X:131411289-131411311 CTATATGGGCTAAAAAGGGGAGG + Intergenic
1198454779 X:136805745-136805767 CTCTATGGTCTAAAAACGGGAGG + Intergenic
1200584309 Y:4988759-4988781 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1200805972 Y:7434298-7434320 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1201012420 Y:9560674-9560696 CTGGAGAGGCTAAACCTGGGAGG + Intergenic