ID: 1118692695 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:68354969-68354991 |
Sequence | CTCGGATAGTACCCTAATAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 23 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 21} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1118692695_1118692698 | -4 | Left | 1118692695 | 14:68354969-68354991 | CCAGTATTAGGGTACTATCCGAG | 0: 1 1: 0 2: 0 3: 1 4: 21 |
||
Right | 1118692698 | 14:68354988-68355010 | CGAGTACCTTCAGGCTTTTTAGG | 0: 1 1: 0 2: 0 3: 8 4: 180 |
||||
1118692695_1118692700 | 23 | Left | 1118692695 | 14:68354969-68354991 | CCAGTATTAGGGTACTATCCGAG | 0: 1 1: 0 2: 0 3: 1 4: 21 |
||
Right | 1118692700 | 14:68355015-68355037 | ACTCTAGTGAGTAAGCTCTCTGG | 0: 1 1: 0 2: 1 3: 5 4: 119 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1118692695 | Original CRISPR | CTCGGATAGTACCCTAATAC TGG (reversed) | Intronic | ||