ID: 1118692695

View in Genome Browser
Species Human (GRCh38)
Location 14:68354969-68354991
Sequence CTCGGATAGTACCCTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118692695_1118692698 -4 Left 1118692695 14:68354969-68354991 CCAGTATTAGGGTACTATCCGAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1118692698 14:68354988-68355010 CGAGTACCTTCAGGCTTTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 180
1118692695_1118692700 23 Left 1118692695 14:68354969-68354991 CCAGTATTAGGGTACTATCCGAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118692695 Original CRISPR CTCGGATAGTACCCTAATAC TGG (reversed) Intronic