ID: 1118692695

View in Genome Browser
Species Human (GRCh38)
Location 14:68354969-68354991
Sequence CTCGGATAGTACCCTAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118692695_1118692698 -4 Left 1118692695 14:68354969-68354991 CCAGTATTAGGGTACTATCCGAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1118692698 14:68354988-68355010 CGAGTACCTTCAGGCTTTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 180
1118692695_1118692700 23 Left 1118692695 14:68354969-68354991 CCAGTATTAGGGTACTATCCGAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118692695 Original CRISPR CTCGGATAGTACCCTAATAC TGG (reversed) Intronic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
918928925 1:190827327-190827349 CTAGGATAGGACCCTGAAACAGG + Intergenic
1074982491 10:118630881-118630903 CTCTAAGAGAACCCTAATACAGG - Intergenic
1086264381 11:84980387-84980409 TTCAGAAAGTACCCTCATACAGG - Intronic
1106986998 13:35364960-35364982 CCCTGATAGAACTCTAATACAGG + Intronic
1111350850 13:87029161-87029183 CTGGGATAGTAGCTTCATACAGG - Intergenic
1113394948 13:109938663-109938685 CTCGGCTAGTATCGAAATACAGG + Intergenic
1114251585 14:20966411-20966433 CTAGGATATTAGCCTGATACTGG + Intergenic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1121201976 14:92125217-92125239 CACTGCCAGTACCCTAATACAGG - Intronic
1137853977 16:51774809-51774831 CTCGAAGAGAACCCTAATGCAGG - Intergenic
1157636913 18:49167046-49167068 CTCTGATAGTGCACTAATAGGGG - Intronic
1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG + Intronic
928995440 2:37285397-37285419 CTGGGTTAGTATCCAAATACGGG + Intronic
932675712 2:73779236-73779258 TTCTGTCAGTACCCTAATACAGG - Intronic
942658636 2:178240888-178240910 CTCAGATAGTATCCTAATTTTGG + Intronic
1174972883 20:55297039-55297061 CTCAGTTAGTAGGCTAATACAGG - Intergenic
1179068548 21:38050094-38050116 CTGGGATAGTTTCCTAATACTGG - Intronic
1181741338 22:24924120-24924142 CTGGAATTGTACCCTAAGACTGG + Intronic
1010569453 6:77460602-77460624 CTCTGAGAGCTCCCTAATACAGG - Intergenic
1019297409 7:285425-285447 CTCGGACAGTACCCTAAGCTAGG + Intergenic
1033807560 7:144972258-144972280 CTTGGATAGTACAATAATAGAGG - Intergenic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic