ID: 1118692700

View in Genome Browser
Species Human (GRCh38)
Location 14:68355015-68355037
Sequence ACTCTAGTGAGTAAGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118692697_1118692700 5 Left 1118692697 14:68354987-68355009 CCGAGTACCTTCAGGCTTTTTAG 0: 1
1: 0
2: 0
3: 13
4: 194
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119
1118692695_1118692700 23 Left 1118692695 14:68354969-68354991 CCAGTATTAGGGTACTATCCGAG 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119
1118692699_1118692700 -2 Left 1118692699 14:68354994-68355016 CCTTCAGGCTTTTTAGGAAGAAC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119
1118692694_1118692700 24 Left 1118692694 14:68354968-68354990 CCCAGTATTAGGGTACTATCCGA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118692700 Original CRISPR ACTCTAGTGAGTAAGCTCTC TGG Intronic
905512037 1:38529536-38529558 ATTCTGGTGAGCAAGTTCTCAGG - Intergenic
906871559 1:49487489-49487511 AAGCTAGTGAGTGAGTTCTCAGG + Intronic
907755196 1:57304247-57304269 ACAATAGTGAGTGAGTTCTCAGG - Intronic
909452308 1:75811634-75811656 ACTGTAGTGGGTAAGCACTGTGG + Intronic
910111734 1:83690612-83690634 ACGATAGTGAGTGAGTTCTCAGG + Intergenic
910166120 1:84329160-84329182 ACACCTGAGAGTAAGCTCTCTGG - Intronic
910832903 1:91478406-91478428 AGTGTAGTGAGTAATCACTCAGG - Intergenic
918977502 1:191509388-191509410 ACTCTAGATAGCAAGCTCTAAGG + Intergenic
921790457 1:219284047-219284069 ATGATAGTGAGTAAGTTCTCAGG + Intergenic
921833759 1:219757255-219757277 ACTATAGTGAGTGAGTTCTTAGG + Intronic
923430252 1:233913019-233913041 ACTCCAGTAAGTAAGCTTTTAGG - Intronic
1068325085 10:55474925-55474947 ACTCAAGTAAGCAAGCTCTTTGG - Intronic
1068696075 10:59969379-59969401 ACTGGAGTGAGAAAGCTCTGGGG + Intergenic
1076065911 10:127447715-127447737 ACTCCAGTGGGTAAGATCTGTGG + Intronic
1086102066 11:83111027-83111049 ACTGTAGGGACTAAACTCTCCGG - Intergenic
1087145341 11:94805279-94805301 ACTCTAGGAAGAAAGCTGTCTGG + Intronic
1089927377 11:122272657-122272679 AGGCTTTTGAGTAAGCTCTCTGG - Intergenic
1090631362 11:128651997-128652019 ATGATAGTGAGTAAGTTCTCAGG - Intergenic
1091422582 12:355487-355509 ACATTAATGGGTAAGCTCTCTGG - Intronic
1093718888 12:22414841-22414863 ATGATAGTGAGTAAGTTCTCAGG - Intronic
1093778880 12:23110871-23110893 ACCCTAGTGGTTAAGATCTCAGG + Intergenic
1096569420 12:52512672-52512694 ACTCTAGTTAGTAAGCACTCTGG - Intergenic
1099040816 12:77652347-77652369 ACTTTAGGGAGTAGGCTCTATGG - Intergenic
1099553620 12:84080213-84080235 ATTATAGTGAGTGAGTTCTCAGG - Intergenic
1100023684 12:90101664-90101686 ATTCTAGTGAGTAAAACCTCAGG + Intergenic
1100383993 12:94088818-94088840 ACTATAGAATGTAAGCTCTCTGG - Intergenic
1107091960 13:36491385-36491407 AATCTAGTGAGTCAGCTTTGTGG - Intergenic
1107239977 13:38221279-38221301 ACTTTGCTGAGTAAGCTCTCTGG - Intergenic
1116719248 14:48472549-48472571 ACTCCAGTGATTAACCTCTGCGG + Intergenic
1118007130 14:61573548-61573570 ACGCCATTCAGTAAGCTCTCTGG - Intronic
1118692700 14:68355015-68355037 ACTCTAGTGAGTAAGCTCTCTGG + Intronic
1122565666 14:102653664-102653686 ATGATAGTGAGTGAGCTCTCGGG + Intronic
1122832050 14:104403126-104403148 ATGCTAGTGAGTGAGTTCTCAGG + Intergenic
1124093898 15:26630404-26630426 ACTCTCTGGAGTATGCTCTCTGG + Intronic
1126117913 15:45225763-45225785 GCTAGAGTGAGCAAGCTCTCTGG + Intergenic
1132877433 16:2146574-2146596 CCTCTGGAGTGTAAGCTCTCCGG - Intronic
1138961822 16:62036781-62036803 CCTCTAGAGAGAAAGCTCGCAGG - Exonic
1140779418 16:78281209-78281231 ACCATAGTGAGTGAGATCTCTGG - Intronic
1145071366 17:19811392-19811414 CCTCTCGTGATTAAGCTATCAGG - Intronic
1145937569 17:28724074-28724096 ACTCTAGTCACAAAGATCTCTGG - Exonic
1146219304 17:31004498-31004520 TGTCTAGTGAGGGAGCTCTCAGG + Intergenic
1148510324 17:48163432-48163454 ACTCTAGTGTTTAACCTTTCCGG - Intronic
1150971443 17:70032581-70032603 ATGATAGTGAGTAAGTTCTCAGG - Intergenic
1157241224 18:46011050-46011072 ACTCCAGTAAGTAATTTCTCAGG + Intronic
1158619373 18:59018495-59018517 CCTCTAGTGAGTAATCTGGCTGG + Intergenic
1159019886 18:63134681-63134703 TCTCTAGAGTGTAAGCTCTTTGG - Intronic
1159790527 18:72773603-72773625 ACGATAGTGAGTGAGTTCTCAGG + Intronic
1163182181 19:15612313-15612335 ACTCTAGTCACAAAGATCTCTGG - Intergenic
1164271073 19:23672208-23672230 ACTCCAGTTAGTTAGCTCTTGGG + Intronic
1168298593 19:55390191-55390213 TCTCCAGTGAGCAAACTCTCAGG - Intronic
1168467650 19:56617071-56617093 ACTCTGGTGAGTAAGATTACAGG + Intronic
926561615 2:14423849-14423871 ACTCTAGCCTCTAAGCTCTCAGG + Intergenic
927321794 2:21755888-21755910 ACACAAGTGAGGAAGCGCTCAGG + Intergenic
929436530 2:41932705-41932727 ACTCTGGCGAGTTGGCTCTCTGG - Intergenic
930019001 2:46989710-46989732 ACTCTAGCATGTAAGCTCCCAGG - Intronic
939176118 2:138749140-138749162 ACAATAGTGAGTGAGTTCTCAGG + Intronic
941516628 2:166488277-166488299 ATTCTAGTCAGAAAGCTCTAAGG - Intronic
942024976 2:171901356-171901378 ACTGTAGTGAATAAGAACTCTGG - Intronic
945903497 2:215565278-215565300 ACTATTCTGAGTAAGCTCTGTGG + Intergenic
1174819987 20:53718274-53718296 TCTCAAGTGTGTAAACTCTCTGG - Intergenic
1175264935 20:57696761-57696783 ACTCTAGTGAGAATGAGCTCTGG - Intronic
1175456934 20:59122583-59122605 AGTCTAGTGGGTAAGCATTCAGG + Intergenic
1176925745 21:14746620-14746642 ACTATAGTGAGTGAGTTCTCAGG - Intergenic
1180015702 21:45081820-45081842 ACTCTAATAAGCAGGCTCTCTGG - Intronic
1185074920 22:48677968-48677990 GCTCTGGGGAGTGAGCTCTCGGG - Intronic
949242120 3:1885883-1885905 ATACTAGTGAGTGAGTTCTCAGG - Intergenic
949939640 3:9145044-9145066 ACTCTAGCAAGTAAAATCTCAGG + Intronic
952068396 3:29601375-29601397 ACTCTATTTAGTAAGCTGTTAGG + Intronic
956134559 3:66086313-66086335 ACTCTTAACAGTAAGCTCTCAGG + Intergenic
960605141 3:119497475-119497497 ACTCTAGTCAGTCACTTCTCAGG + Intergenic
963018093 3:140844891-140844913 ATGCTAGTGAGTGAGTTCTCAGG - Intergenic
964290701 3:155177287-155177309 ACACTAGGGAGCAAGCTCCCTGG - Intronic
964328265 3:155572194-155572216 ACTCTTGTGAAAGAGCTCTCAGG + Intronic
964937739 3:162112964-162112986 ACTCTATTGTTTAAGGTCTCTGG - Intergenic
966135254 3:176690904-176690926 ACTGTGCTGAGTAAACTCTCTGG - Intergenic
966475984 3:180347422-180347444 ATGCTAGTGAGTGAGTTCTCAGG - Intergenic
969884238 4:10201050-10201072 ACTCATGGGAGTAGGCTCTCGGG + Intergenic
971376429 4:26059463-26059485 TCTCTAGTGAGTGAGCCATCAGG - Intergenic
975948330 4:79736647-79736669 ATGATAGTGAGTAAGTTCTCAGG + Intergenic
985358594 4:189147524-189147546 ACTCTAGTCAGCAAGCACACGGG + Intergenic
986138310 5:5004683-5004705 ATGATAGTGAGTAAGTTCTCAGG + Intergenic
986138569 5:5006746-5006768 ACGATAGTGAGTACGTTCTCAGG + Intergenic
986285981 5:6359470-6359492 TCTGTGCTGAGTAAGCTCTCTGG + Intergenic
987586982 5:19867926-19867948 GTTCTAGTGAGTGAGTTCTCAGG + Intronic
987843170 5:23246880-23246902 ATGATAGTGAGTGAGCTCTCAGG + Intergenic
987851702 5:23363074-23363096 ATGATAGTGAGTAAGTTCTCAGG - Intergenic
991764424 5:69958988-69959010 ACGATAGTGAGTGAGTTCTCAGG + Intergenic
991782900 5:70159159-70159181 ACGATAGTGAGTGAGTTCTCAGG - Intergenic
991843656 5:70834060-70834082 ACGATAGTGAGTGAGTTCTCAGG + Intergenic
991875343 5:71159486-71159508 ACGATAGTGAGTGAGTTCTCAGG - Intergenic
994449035 5:99917286-99917308 ACTATAGCAAGTGAGCTCTCAGG + Intergenic
998618200 5:143764533-143764555 ATTATAGTGAGTGAGTTCTCAGG - Intergenic
1003587738 6:7408440-7408462 GCTCCAGTTAGAAAGCTCTCTGG + Intronic
1009929502 6:70160311-70160333 ATGATAGTGAGTAAGTTCTCAGG - Intronic
1014588245 6:123228548-123228570 ACAATAGTGAGTACGTTCTCAGG - Intronic
1015002857 6:128241208-128241230 TCTCTAGTGACTTACCTCTCAGG + Intronic
1015420080 6:132997359-132997381 ACTCTAGTCACAAAGATCTCTGG + Intergenic
1015463268 6:133517831-133517853 ACTCTTCTGACTAAGCTCTCTGG - Intronic
1015467540 6:133563516-133563538 ACTCCACTGAGAAAGCTCTATGG - Intergenic
1016187827 6:141220378-141220400 ATTATAGTGAGTGAGTTCTCAGG - Intergenic
1021338374 7:19432730-19432752 ATGATAGTGAGTAAGTTCTCAGG + Intergenic
1022228045 7:28383632-28383654 ACAATAGTGAGTGAGTTCTCTGG - Intronic
1024233852 7:47383314-47383336 ACTCCAGTGAGTGAGATGTCCGG + Intronic
1033952517 7:146802538-146802560 ACGATAGTGAGTGAGTTCTCAGG + Intronic
1041094545 8:54336093-54336115 TTTCAAATGAGTAAGCTCTCAGG + Intergenic
1043447777 8:80336055-80336077 ACTCTAGTGAGTAGGCAATCAGG - Intergenic
1043990075 8:86741942-86741964 AGCCTAGTGATTTAGCTCTCAGG + Intronic
1045278236 8:100725746-100725768 GTTCAAGTGAATAAGCTCTCTGG - Intergenic
1045891688 8:107165306-107165328 ACTCTATTCATAAAGCTCTCTGG + Intergenic
1046614133 8:116457289-116457311 CCTCTAGGGAGCAAGCTCTTAGG + Intergenic
1046863066 8:119116786-119116808 ACGATAGTGAGTGAGTTCTCAGG - Intergenic
1047755115 8:127912522-127912544 ACTCAAGTGAGTCAGCTCACAGG - Intergenic
1050729596 9:8693243-8693265 ACTCAACTGAGTAAGGTTTCAGG - Intronic
1050980582 9:12008375-12008397 AATATATTGAGTAAGTTCTCAGG - Intergenic
1051994758 9:23201561-23201583 ATGATAGTGAGTAAGTTCTCAGG - Intergenic
1052540799 9:29809691-29809713 ACAATAGTGAGTGAGTTCTCAGG + Intergenic
1053532926 9:38899506-38899528 CCTCTAGAGAGTTAGCTTTCAGG + Intergenic
1054205153 9:62123935-62123957 CCTCTAGAGAGTTAGCTTTCAGG + Intergenic
1054633207 9:67464435-67464457 CCTCTAGAGAGTTAGCTTTCAGG - Intergenic
1057151287 9:92798399-92798421 CCTCTAGAGAGTTAGCTTTCAGG - Intergenic
1186730808 X:12407361-12407383 ACTCTGGTGCGCAAGCTCTGTGG - Intronic
1188146958 X:26625930-26625952 ACTCTAGTAGGTAAAGTCTCTGG + Intergenic
1188387029 X:29574220-29574242 ATGATAGTGAGTAAGTTCTCAGG - Intronic
1192384815 X:70656890-70656912 GCTCTAGTGGGTAAGCTTTAAGG - Intronic
1196897635 X:120353394-120353416 ACTGTAGTGAGGAAGATCCCTGG - Intergenic
1199330162 X:146550059-146550081 ATGATAGTGAGTAAGTTCTCAGG - Intergenic