ID: 1118693071

View in Genome Browser
Species Human (GRCh38)
Location 14:68359024-68359046
Sequence GTGGCAGCTGCTCCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118693071_1118693081 14 Left 1118693071 14:68359024-68359046 CCCCACAGAGGAGCAGCTGCCAC 0: 1
1: 0
2: 1
3: 30
4: 315
Right 1118693081 14:68359061-68359083 CACCTGCTTGGAGGTGCCATAGG 0: 1
1: 0
2: 1
3: 20
4: 134
1118693071_1118693077 5 Left 1118693071 14:68359024-68359046 CCCCACAGAGGAGCAGCTGCCAC 0: 1
1: 0
2: 1
3: 30
4: 315
Right 1118693077 14:68359052-68359074 AGCACACCCCACCTGCTTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 134
1118693071_1118693076 2 Left 1118693071 14:68359024-68359046 CCCCACAGAGGAGCAGCTGCCAC 0: 1
1: 0
2: 1
3: 30
4: 315
Right 1118693076 14:68359049-68359071 TGGAGCACACCCCACCTGCTTGG 0: 1
1: 0
2: 2
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118693071 Original CRISPR GTGGCAGCTGCTCCTCTGTG GGG (reversed) Intronic
900096219 1:941167-941189 GTGGCGGCTGCAGCTCTGAGGGG + Exonic
900482150 1:2904604-2904626 GAGACTGCTGCCCCTCTGTGTGG - Intergenic
900522542 1:3112711-3112733 CGGGCAGCTGCTCCCCGGTGAGG + Intronic
900597909 1:3490804-3490826 GGTGCAGCTGCTGCCCTGTGGGG + Intronic
900646138 1:3709541-3709563 GTGGCAGCTGCACCTGCCTGTGG + Intronic
900679944 1:3911250-3911272 GTGGCAGCTGCTTCCCGCTGGGG + Intergenic
901089756 1:6633401-6633423 GTGGGAGATGCTCCTCAGGGAGG + Exonic
902923806 1:19682801-19682823 GGGGCAGCTGCTCCCTGGTGGGG + Exonic
902979384 1:20112342-20112364 GGGGCAGCTGTGCCTGTGTGGGG - Exonic
904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG + Intergenic
904409424 1:30316198-30316220 GAGGTAGGTGCTCCACTGTGTGG - Intergenic
904443588 1:30550256-30550278 ATGGCAGCAGCTGCTCTGGGTGG - Intergenic
904625669 1:31800548-31800570 GTGGCAGCTGCCCCCCTGCCTGG + Exonic
905257348 1:36693376-36693398 CTGACAGCTGATCCTCTGGGAGG - Intergenic
907410715 1:54281511-54281533 GGGGCAGCTGCTGCACTCTGTGG + Exonic
911464383 1:98233461-98233483 ATGGCAGCTGCTCCTCCTTATGG - Intergenic
912588295 1:110787572-110787594 GTGGCAGCTCCTTCTCTGGGGGG - Intergenic
912709620 1:111941116-111941138 GTGGCAGCTGCTGCTATGTCAGG + Intronic
912812639 1:112805543-112805565 GTGGCAGATGCTGCTGTGTGCGG - Intergenic
913301267 1:117371897-117371919 GTAGCAGCTGCTCCCTTGGGAGG + Intronic
915367336 1:155323559-155323581 GCAGCAGCTGCTCCTCTGGGGGG - Intronic
915625888 1:157113859-157113881 GTTGCAGGTGCTCACCTGTGAGG - Intergenic
916460105 1:165014967-165014989 GAGGCACCTGTTCCTCTGGGCGG - Intergenic
917964469 1:180169688-180169710 GTGGCTGCTGCTGGACTGTGTGG + Intronic
920038187 1:203079110-203079132 GTTGCAGTTCCTCCTCAGTGTGG + Intergenic
920146156 1:203862693-203862715 GTGGCAGCTGCTTTCCTTTGAGG + Intronic
920402699 1:205686588-205686610 ATGGCAGGTGTTCCCCTGTGTGG + Intergenic
921379105 1:214505474-214505496 CTGGCAGCTCCACCACTGTGTGG - Intronic
922299785 1:224287927-224287949 CTTGCATCTGCTCCTCTGAGAGG + Exonic
922798675 1:228353904-228353926 GTGGCAGCTGCAGCTCTGCCAGG - Intronic
924851249 1:247833483-247833505 GTGCAGGCTGCTCTTCTGTGAGG + Intergenic
1063221690 10:3975025-3975047 CTGCCAGCCGCCCCTCTGTGGGG + Intergenic
1063294694 10:4792985-4793007 GTGGTAGCTGTTGCTCTGTGAGG + Intronic
1065102008 10:22340727-22340749 GGGGCAGCCGCTCCTCCGGGAGG + Intergenic
1065966397 10:30774521-30774543 GTGGCAGCTGATGCTCCCTGGGG - Intergenic
1068442033 10:57069212-57069234 CTGGCAGTTGTTCCTCTGGGGGG + Intergenic
1068927918 10:62559175-62559197 GTGCCATCTCCTCCTCTTTGTGG + Intronic
1069951038 10:72018229-72018251 GTGGGGCATGCTCCTCTGTGGGG + Intergenic
1070279973 10:75041465-75041487 GTGGCAGGTGCCCCTCTGAAGGG + Intronic
1070288643 10:75100689-75100711 GAGGCAGCTGCTCTGCTGAGCGG - Intronic
1070801461 10:79246719-79246741 GAGGCAGCTGCTGCTCTGCCAGG - Intronic
1070981175 10:80649471-80649493 GTGTCAGCTGCTCTTCTGAAGGG + Intergenic
1071991656 10:91105548-91105570 TGGGCTGCTGCTCCTCTGAGTGG - Intergenic
1073037318 10:100573133-100573155 GTGGCAGCTCAGCCTCTGGGTGG + Intergenic
1074108858 10:110408570-110408592 GTGGAAGCTGCTCCTCGTGGAGG - Intergenic
1075077514 10:119360886-119360908 GTGGCCGCTGCTTCTCTGGTGGG + Intronic
1075266774 10:121007321-121007343 GTGTCAGCAGCTTCTGTGTGTGG + Intergenic
1075584685 10:123649000-123649022 GAGCCAGTTGCTCCTCTGTAAGG + Intergenic
1076161544 10:128247678-128247700 GTGGCGGGAGCTCCTCTCTGTGG - Intergenic
1076688443 10:132208615-132208637 GTGGCAGCTGCTGCTATTTCTGG + Intronic
1076822333 10:132945659-132945681 GTGGCATCGGCTCCACTTTGGGG + Intergenic
1076825444 10:132964950-132964972 GTGGCAGCCGCGTCTTTGTGAGG - Intergenic
1077137042 11:1005413-1005435 GTGGCAGCAGCTGCACAGTGTGG + Intronic
1077177507 11:1197405-1197427 GTGGCTGCTGCACCCCTGGGTGG + Intronic
1077863651 11:6205232-6205254 GCTGCAGATGCTTCTCTGTGAGG - Intergenic
1077888637 11:6403659-6403681 TTGGGGGCTGCTCCCCTGTGAGG + Exonic
1079444237 11:20545372-20545394 CAGGCAGCTGGGCCTCTGTGTGG + Intergenic
1080878245 11:36296136-36296158 GTTACAGCGGCTGCTCTGTGTGG - Intergenic
1081485924 11:43528854-43528876 GAGGCAGCAACTCCTCTGGGAGG + Intergenic
1090472764 11:126995181-126995203 GTGGGAGCAGCTGCTCTGGGGGG - Intronic
1091170844 11:133518624-133518646 GTGGCAGGTGCTGGTGTGTGTGG + Intronic
1091170853 11:133518663-133518685 GTGGCAGGTGCTGGTGTGTGTGG + Intronic
1091170862 11:133518702-133518724 GTGGCAGGTGCTGGTGTGTGTGG + Intronic
1091361488 11:134981512-134981534 GTGGCAGTGGCTCTCCTGTGTGG - Intergenic
1092061958 12:5558215-5558237 GTGCCAGTTGCTCTTCTGAGTGG - Intronic
1092601393 12:10070128-10070150 TTTGTAGCTGCTCCTTTGTGAGG - Exonic
1093399334 12:18725462-18725484 CTTCCAGCTGCTCCTCTGGGTGG - Intronic
1094142031 12:27191294-27191316 CTGGCTGCTGCTCTGCTGTGTGG + Intergenic
1095114878 12:38341269-38341291 ATGGCAGATGCTGTTCTGTGAGG + Intergenic
1095632882 12:44398612-44398634 GAGCCAGCTCCTCCTGTGTGGGG - Intergenic
1099699202 12:86062138-86062160 CTGGCAGGAGCCCCTCTGTGAGG + Intronic
1101045484 12:100801267-100801289 TTGGCAGCTTCTGCTCTATGTGG + Intronic
1102517967 12:113463031-113463053 CTGGCAGCTGCTCCTCGGCTGGG - Exonic
1102589560 12:113947098-113947120 GTGGCACCTACACCTCTGTCTGG - Intronic
1105265592 13:18811153-18811175 GCGGCAGCTGTTCTTCTGTTGGG + Intergenic
1105591358 13:21795626-21795648 CTGGCCCCTGCTCCTCAGTGAGG - Intergenic
1105889118 13:24669380-24669402 CTGGCACCTTCTTCTCTGTGAGG + Intergenic
1106036462 13:26049786-26049808 GGGGCGGCTCCTCCTCTTTGTGG - Intronic
1106350454 13:28924595-28924617 GCTGCTGCTGCCCCTCTGTGTGG + Intronic
1108457439 13:50630431-50630453 CTTGCTGCTGGTCCTCTGTGTGG - Intronic
1109366686 13:61364978-61365000 CTGGCAGGTGCCCCTCTGGGAGG + Intergenic
1109790318 13:67238993-67239015 GTGGTGGCTGGGCCTCTGTGGGG + Intergenic
1110290361 13:73798705-73798727 GTGGGAGATGCTCCTCATTGTGG - Intronic
1111325452 13:86689618-86689640 GTGGCAGCTGTGTCTCTGAGGGG - Intergenic
1112032565 13:95471081-95471103 GTGGCTTCTAATCCTCTGTGAGG - Intronic
1113338917 13:109403115-109403137 AAGGCTGCTGCTTCTCTGTGTGG + Intergenic
1113969672 13:114179281-114179303 GCCCCAGCTGCTCCTCTGTCTGG + Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1118741382 14:68741928-68741950 GTGGGTGCTGTACCTCTGTGGGG - Intergenic
1118922976 14:70166940-70166962 CTGGCTGCTCCTCCTCTATGCGG + Exonic
1119067927 14:71549371-71549393 GGGACAGCTCCTTCTCTGTGAGG - Intronic
1120305492 14:82764421-82764443 GTGGATGCTGTTCCTCTGTTTGG + Intergenic
1121426735 14:93857626-93857648 GTGGCCTCTGCTCCGCTGCGTGG + Intergenic
1121727893 14:96166351-96166373 GTGGCAGCTCCACCTCTCTGGGG - Intergenic
1122338726 14:101010471-101010493 CTGACAGCTGCTTCTCTGAGCGG + Intergenic
1122839665 14:104451107-104451129 GTGGCTGCTGCTTCTCTGCCGGG - Intergenic
1123476070 15:20593210-20593232 GTGTCAGCTCCTCCTGAGTGCGG - Intergenic
1123641942 15:22407154-22407176 GTGTCAGCTCCTCCTGAGTGCGG + Intergenic
1124494818 15:30179941-30179963 TTGGCAGCTACTTCTCTCTGAGG - Intergenic
1124748751 15:32358704-32358726 TTGGCAGCTACTTCTCTCTGAGG + Intergenic
1128330462 15:66752232-66752254 CTGGCAGCTTTGCCTCTGTGGGG + Intronic
1129688581 15:77700357-77700379 GTGGCAGCTTTTCAACTGTGTGG + Intronic
1130256846 15:82329776-82329798 GTGGCAGAGGTTCCTCAGTGTGG + Intergenic
1130297041 15:82654709-82654731 GTGGCAGATGCTTCTCTTTGGGG - Intergenic
1130598103 15:85260212-85260234 GTGGCAGAGGTTCCTCAGTGTGG - Intergenic
1132012688 15:98290084-98290106 GTGGCAGCATCCCCTCTCTGAGG - Intergenic
1132149865 15:99451803-99451825 CTGGGAGCAGCCCCTCTGTGAGG - Intergenic
1132529905 16:441636-441658 GTGCCAGCTGCTCCTCTGGCTGG + Intronic
1133071487 16:3249526-3249548 GGTCCAGCTGCTCTTCTGTGAGG - Exonic
1135049476 16:19180966-19180988 ATGGCAGCTGCCGCTCTGTCTGG + Intronic
1138961560 16:62035478-62035500 GTGGCAGCTCCAGCTCTGGGAGG - Intronic
1139397309 16:66650471-66650493 TTTGGAGCTGCTCCTCTGTAAGG - Intronic
1139745790 16:69073438-69073460 GTGGCAGCTACAGCCCTGTGGGG - Intronic
1141661753 16:85445218-85445240 GTGGCAGCTGCTCCCGGGAGAGG - Intergenic
1142254082 16:89005707-89005729 GTGGCACCTGCTCCTATGTGTGG - Intergenic
1142382245 16:89739521-89739543 GGGGCGGCTCCTCCTCCGTGTGG - Exonic
1142884274 17:2903167-2903189 ATGACAGCTGCTCCCCTGTAAGG - Intronic
1143435761 17:6923632-6923654 GTGGCAGATACTCCTTTGGGCGG - Intronic
1143636144 17:8164584-8164606 GACGCGGCTGCTCCTCTGAGGGG - Intergenic
1146009037 17:29179770-29179792 CTAGCAGCTGCTCCTTTGAGAGG + Intronic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1147258401 17:39195435-39195457 TTGGCAGTTCCTCCTCTCTGGGG - Intronic
1148083542 17:44980595-44980617 GTGACAGCTTCTCATCTGGGTGG - Intergenic
1148326582 17:46786545-46786567 TTGGGAGCTGCTCCCCTCTGTGG - Intronic
1148503306 17:48107867-48107889 GTGGGTGCTGCTCTCCTGTGAGG + Intronic
1148816789 17:50333678-50333700 GAGGAAGCTGCCTCTCTGTGGGG + Intergenic
1151239408 17:72746124-72746146 GTGGGAGCTACTCCTCAGTCAGG + Intronic
1151874239 17:76857434-76857456 GTGGCACCTGCATCTCTGGGAGG + Intergenic
1152031406 17:77845695-77845717 GTGGGGGCAGCTCCTCTCTGGGG + Intergenic
1152318200 17:79593088-79593110 GTGGCAGCTGCTCCAGGGAGGGG + Intergenic
1152511250 17:80790551-80790573 GTGGCAGTGACTCCTCTATGGGG - Intronic
1152760583 17:82105251-82105273 GTGGCCTCCGCTGCTCTGTGTGG + Intronic
1152844940 17:82593881-82593903 GCGGCAGCTGCTGCTCTGCCTGG - Intronic
1152892391 17:82890027-82890049 GAGCCAGCTCCTGCTCTGTGTGG - Intronic
1153160125 18:2195162-2195184 GAGGTAGCTCCACCTCTGTGAGG - Intergenic
1153216516 18:2825827-2825849 GCCCAAGCTGCTCCTCTGTGTGG - Intergenic
1153798544 18:8647490-8647512 CTGGCAGGTGCCCCTCTGGGAGG + Intergenic
1154422805 18:14250375-14250397 GCGGCAGCTGTTCTTCTGTTGGG - Intergenic
1155205791 18:23556813-23556835 GTGTCGGCATCTCCTCTGTGGGG - Intronic
1155491635 18:26406415-26406437 CAGGCAGCTGCTCCTCTGCCGGG - Intergenic
1156269171 18:35515288-35515310 TTGGCAGCCTCTCCTCTCTGGGG + Intergenic
1156415063 18:36879399-36879421 CTGGCAGGTGCCCCTCTGTGAGG - Intronic
1156913863 18:42442562-42442584 GAGGTAGCTGTTCCTCTGAGAGG + Intergenic
1159042051 18:63333562-63333584 GTGGCAGCTGCTCCTGAGGGAGG - Intronic
1159233309 18:65636855-65636877 GTACCAGCTGATCCACTGTGTGG - Intergenic
1159949274 18:74468632-74468654 GTGTTTCCTGCTCCTCTGTGTGG + Intergenic
1160030829 18:75258071-75258093 CCGGCTGCTGCTCCTCTGTCTGG + Intronic
1160535849 18:79590974-79590996 GTCCCAGCTGCTCCTCAGCGTGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161706444 19:5824333-5824355 GTGTAAGCTCCTCCTCTGTGTGG + Exonic
1162043499 19:7984401-7984423 TTGGCACCTGCTCTTCTGTCTGG - Intronic
1162493692 19:11010805-11010827 GTGGCCCCGTCTCCTCTGTGAGG - Intronic
1162585163 19:11553888-11553910 GTGGCACCTGTTCCTCTGGACGG + Intronic
1162931455 19:13959775-13959797 GTGTGAGCTGCTCCACTGTCAGG - Exonic
1163124473 19:15237503-15237525 GTGGCAGCCGCTGCTCAATGAGG + Exonic
1163397302 19:17071251-17071273 GTTGCAGCTGCTACCCTGAGAGG + Intronic
1163633493 19:18428360-18428382 GTCACTGCTGCTCCTCTGAGCGG + Intronic
1165411619 19:35665784-35665806 CAGGTGGCTGCTCCTCTGTGAGG - Intergenic
1165488748 19:36111163-36111185 GTGGAAGCAGCCCCTGTGTGTGG + Intergenic
1166072709 19:40396215-40396237 TGGGCAGCTGCACCTCTGGGAGG + Exonic
1166910808 19:46155035-46155057 GTGGTAGCTGCTCCTCTTCTCGG + Intronic
1167051239 19:47080018-47080040 GTGGCAGGGGCACCCCTGTGAGG - Intronic
1167071828 19:47226463-47226485 GCGGCAGCTGCTGCCCTGCGCGG - Intronic
1167562605 19:50234747-50234769 CTGGCAGCTGCCCTGCTGTGTGG + Intronic
1167723508 19:51195403-51195425 GTGGCTTCTGGTCTTCTGTGAGG - Intergenic
925740242 2:6999338-6999360 GTGGCGCCTTCCCCTCTGTGTGG + Intronic
926296627 2:11573647-11573669 GACCCAGCTGCTCTTCTGTGAGG - Intronic
926395709 2:12440288-12440310 GATGCAGCCTCTCCTCTGTGTGG - Intergenic
927940073 2:27097940-27097962 GTGGAAGCATCTCCTCTCTGGGG + Intronic
928200427 2:29244449-29244471 GAGGCAGGTGCTTCTCAGTGGGG + Intronic
928249778 2:29665281-29665303 CTGGCCTCTGCTCCTCTTTGAGG + Intronic
928671848 2:33610710-33610732 GTGGCAGCTGCTCCCAAGTTGGG + Intergenic
928691241 2:33801407-33801429 ATGGCAGCTGCTTCTCTCAGAGG + Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
932451813 2:71815474-71815496 GTGGCTGCTCCTCCTAAGTGGGG - Intergenic
932795044 2:74687156-74687178 GTGGCTGTTGCTCCTGAGTGAGG - Intergenic
935745107 2:106183600-106183622 GTGGGAACTTCTCCTCTGAGGGG - Intronic
936516996 2:113187242-113187264 GTGGCAGGTGCATCCCTGTGAGG + Intronic
936517560 2:113192083-113192105 GTGGCAGGTGCATCCCTGTGAGG - Intronic
936937620 2:117853420-117853442 GGGACATCTGCTCCTCAGTGGGG + Intergenic
937667210 2:124500872-124500894 GTGGCAGTTGCTGCCCTGGGTGG + Intronic
937842427 2:126537013-126537035 TTGGCTGCTGCTTCACTGTGAGG - Intergenic
940186012 2:150985619-150985641 GTGTCAGCTCCTTCTCTGAGGGG - Intergenic
943719010 2:191183248-191183270 GTTGAAGCTTCTCCTCTGTGGGG + Intergenic
943960990 2:194263739-194263761 GTGGCTCCTCCTCCTCTTTGAGG + Intergenic
944601510 2:201308324-201308346 GGGGGAGCTGCTCCTGTCTGGGG - Intronic
944809891 2:203317606-203317628 CTGGGAGCAGCTCCTCTGGGTGG - Intergenic
945421946 2:209648862-209648884 GTGGCAGATGCTCAGCTGTTTGG + Intronic
945447691 2:209957655-209957677 GTCACACCTGCTCATCTGTGGGG - Exonic
945940349 2:215943442-215943464 CTGGCAGCTGCACCTGTGGGGGG - Exonic
948294363 2:236849660-236849682 ATGGCAGATCCTGCTCTGTGAGG + Intergenic
948335624 2:237204847-237204869 GTGGAAGGTGCTGCTCCGTGAGG + Intergenic
948977664 2:241473354-241473376 GTGGCAGATGCTATTCTGTGGGG + Intronic
1168876279 20:1174349-1174371 GTGGCAGCTGCTGCTCTCCTGGG - Intronic
1169468756 20:5864615-5864637 CTGGCAGATGCTCCGCTCTGCGG + Intergenic
1171886434 20:30655115-30655137 GTGGCAGCAGTTCTTCTGTTGGG + Intergenic
1172218269 20:33251974-33251996 GTGGTACCAGCTCCTCTGAGGGG - Intergenic
1172882858 20:38213102-38213124 GGGGCAGCTTCTCCTCAGAGGGG - Exonic
1174169583 20:48607625-48607647 GTGGCAGCTGTTCCCTTTTGGGG - Intergenic
1174480999 20:50831441-50831463 GTGGCTGCTGCTCCTCAGAAGGG + Intronic
1175349133 20:58306122-58306144 TTAACAGCTGCTACTCTGTGAGG - Intergenic
1175689290 20:61054089-61054111 GTGGAAGCTGCCCCGCTGTCTGG + Intergenic
1175973153 20:62697275-62697297 GTGTCAGCTGCACCTCTGGAGGG + Intergenic
1176030231 20:63008052-63008074 GTGGGAGCTGCACGTGTGTGGGG + Intergenic
1179613455 21:42566777-42566799 GTGGCAGCTGCTGCCCTTCGAGG + Intronic
1180863882 22:19104787-19104809 CTGGCAGCTGCTTCCCAGTGGGG + Intronic
1180971561 22:19818818-19818840 GTGACATCTGCCCCTGTGTGGGG - Intronic
1181633167 22:24161972-24161994 GTGGCTACTGCCCCTCTGTGGGG + Intronic
1181990138 22:26831057-26831079 GTGGCAGCTCCTTCTCTGGCAGG - Intergenic
1182509064 22:30806220-30806242 GTGTCATCAGCTCATCTGTGAGG - Intronic
1183167213 22:36156736-36156758 GGGGCAGCTCTACCTCTGTGTGG + Intronic
1183662862 22:39231630-39231652 GTCGCAGCTGCACCTGGGTGGGG + Exonic
1184288962 22:43488073-43488095 GTGGCAGCTGCCTCTCTTGGGGG + Intronic
1184715440 22:46279318-46279340 GTGACAGCTGCTCCTGTGCCCGG + Intronic
1185048589 22:48541579-48541601 GTGGCACCTGTTGCCCTGTGTGG - Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185237711 22:49724542-49724564 GTTGCAGAAGCTGCTCTGTGGGG - Intergenic
950184967 3:10939303-10939325 ATGGCAGGGGCTCCTCTGTCTGG + Exonic
950958218 3:17077870-17077892 GAGGTAGCTGCTCCTCTCTGTGG + Intronic
952238267 3:31502773-31502795 GTGGCAGCTGTTCTTAGGTGTGG + Intergenic
952696057 3:36266257-36266279 GGGGCAGCTGCTGGTCTGTAGGG - Intergenic
953610572 3:44444283-44444305 ATGGAAGCTGCACCTCTGAGAGG + Exonic
954238989 3:49278553-49278575 GTGGAAGGGTCTCCTCTGTGTGG - Intronic
954760545 3:52870675-52870697 GTGGCAGGTGCTCCTCAGGCTGG + Intronic
955339859 3:58116917-58116939 GTAGAAGCTGTTACTCTGTGAGG - Intronic
956062270 3:65359576-65359598 TTGGAACCTGCTTCTCTGTGAGG - Intronic
956220171 3:66893791-66893813 CTGGCAGGTGCCCCTCTGGGAGG + Intergenic
956558047 3:70543084-70543106 ATGGCAGCTAGACCTCTGTGAGG + Intergenic
961324729 3:126103391-126103413 GTCGCAGCTTCTGCTCTTTGGGG + Intergenic
962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG + Intergenic
964988626 3:162776652-162776674 GTGGCAGCTGCATATCAGTGTGG + Intergenic
965371270 3:167864619-167864641 CTGGCAGCTCTTGCTCTGTGGGG - Intergenic
967838204 3:193981818-193981840 CTTCCAGCTGCTCCCCTGTGGGG - Intergenic
968045304 3:195620637-195620659 CTGCCTGCTGCTCCTCTGTGTGG - Intergenic
968061159 3:195726980-195727002 CTGCCTGCTGCTCCTCTGTGTGG - Intronic
968149737 3:196327612-196327634 GTCGCAGCAGCTCTGCTGTGGGG + Intronic
969838250 4:9860873-9860895 GTACCAGCTGCTCCTCTGCCTGG + Intronic
970595680 4:17597842-17597864 GTGGCAGCAGGTCCTCTGGGTGG + Intronic
970727264 4:19060904-19060926 CTGGCAGGTGCCCCTCTGGGAGG + Intergenic
971374780 4:26048099-26048121 AGGTCAGCTGCGCCTCTGTGTGG - Intergenic
973370014 4:49237112-49237134 GTGGCAGCGGTTCTTCTGTTGGG + Intergenic
973391012 4:49558299-49558321 GTGGCAGCAGTTCTTCTGTTGGG - Intergenic
976299742 4:83506635-83506657 GTGGCAGCTGCTCTCCTTTTAGG - Intronic
978028391 4:103907206-103907228 GTGTCAGCTGCTCATGTATGAGG - Intergenic
979058023 4:116018894-116018916 GTGCCAGCTGATCCTATGAGGGG + Intergenic
980579575 4:134732371-134732393 ATGGCAGCTGCTCCTATTTCAGG + Intergenic
984257321 4:177404198-177404220 GTGTCAGCTGATCCACTGAGGGG + Intergenic
984652062 4:182281009-182281031 TTGTCAGCTGCTCATCTGTCGGG + Intronic
985719311 5:1481071-1481093 CTGGCTGCAGCGCCTCTGTGGGG - Intronic
985843279 5:2325714-2325736 GGAGCAGCTGCACATCTGTGTGG - Intergenic
986016423 5:3761437-3761459 GTGGCCTTTGCGCCTCTGTGTGG + Intergenic
986269278 5:6217299-6217321 CTGCCTGCTGCTCCCCTGTGGGG + Intergenic
986738906 5:10688889-10688911 GTGGCAGCTACTACACAGTGGGG - Intronic
987750913 5:22038073-22038095 GTGTCAGCTTCTTCTCTGAGAGG - Intronic
989604961 5:43235467-43235489 GTGGGAGCTACCCATCTGTGGGG - Intronic
991124392 5:63053099-63053121 GTGGCAGCTGCCTCCCAGTGAGG + Intergenic
992624972 5:78628521-78628543 GGGGCTGCTGCTCCTTTGAGCGG - Intronic
994749996 5:103725827-103725849 GTGACAAATGCTACTCTGTGAGG - Intergenic
995913438 5:117215060-117215082 GTGGCACCTGCTTCTTGGTGTGG - Intergenic
997579652 5:135009235-135009257 GTGGCGGCTGGCCCTGTGTGGGG + Intronic
997833908 5:137177142-137177164 GGGGGAGATGCTGCTCTGTGAGG - Intronic
997878031 5:137566272-137566294 GGGGGATCTGCCCCTCTGTGTGG - Intronic
998107017 5:139475200-139475222 GTGACACCTGCTCCTTTGAGTGG + Intergenic
998353734 5:141517512-141517534 GTGGCTGCTGTTCCTCTTTGCGG - Intronic
999243092 5:150138757-150138779 GGGGCAGATGGGCCTCTGTGGGG - Intronic
1001433266 5:171680302-171680324 GTGGCCCCTGCTCCTTTCTGTGG - Intergenic
1001669093 5:173459217-173459239 GTGTCAGCAGCATCTCTGTGGGG + Intergenic
1002552145 5:180002511-180002533 GTGTCAGCTCCTTCTCTGTGGGG + Intronic
1002759987 6:193941-193963 GTGCGAGGTGCTCCTCTGAGTGG - Intergenic
1003637154 6:7842728-7842750 GTGGTAGCTGGTCTTCTGAGAGG - Intronic
1006507041 6:34496038-34496060 CTGCCTGCTGCTCCCCTGTGTGG + Intronic
1007064618 6:38977324-38977346 GTAGCTGCTACTGCTCTGTGTGG - Intronic
1007809561 6:44476337-44476359 TTGTCAGTTGCTCCTCTGAGTGG + Intergenic
1013916678 6:115347645-115347667 GCTCCAGCTGCTCCTATGTGGGG - Intergenic
1014880116 6:126713255-126713277 TTGTCAGCTGTACCTCTGTGAGG - Intergenic
1018062092 6:160098143-160098165 ATGGCAGCTGGTCTTCTGTGTGG + Intronic
1018687991 6:166318447-166318469 ACGGCAGCTGCACCTCTGTATGG + Intergenic
1018785162 6:167102580-167102602 GTGGGGGCTGCTCCTTTGTGAGG + Intergenic
1019409571 7:900690-900712 GGGGAAGCGGCCCCTCTGTGGGG - Intronic
1019447620 7:1079646-1079668 GGGGCAGCAGCTCCTCTGAGGGG + Intronic
1019710009 7:2513880-2513902 CTGGCAGCTGCGCCTCTTTCTGG - Intronic
1019760455 7:2808550-2808572 CAGGCCGCTGCTGCTCTGTGGGG - Intronic
1020652426 7:10891562-10891584 GTGGCATCTGGTCCTCATTGTGG - Intergenic
1022279474 7:28891501-28891523 GTGTCAGCTCCTACTCTGAGTGG - Intergenic
1022892453 7:34715110-34715132 GTGGCAGGTTCTGCTCTGTCTGG + Intronic
1023080411 7:36521276-36521298 TTGAAAGCTGCTCCTCTATGGGG - Intronic
1023570406 7:41565766-41565788 CTGGCAGCTGCGTCTGTGTGGGG + Intergenic
1025004621 7:55344400-55344422 GTGGCAGCAACTCCTCGTTGCGG - Intergenic
1025070544 7:55894100-55894122 GTGGTAGCTCCTCCTCTGAAAGG - Intronic
1026634430 7:72069083-72069105 CTGGCATCTGCTCCTCTGGATGG - Intronic
1029219118 7:98974061-98974083 GTGGTAGCTGGTCCTCAGTAGGG + Intronic
1029625930 7:101720228-101720250 CTGGCAGCTTCTCCTCTGTTTGG - Intergenic
1029800882 7:102946465-102946487 CTGGTACCTGCTCCTCTTTGGGG - Intronic
1031456512 7:121987245-121987267 GTAGCAGCTGAGACTCTGTGAGG - Intronic
1031993136 7:128210840-128210862 CTGGCAGCTGCTCCTCGCTGTGG - Intergenic
1033276854 7:139978071-139978093 TGGCCAGCTGTTCCTCTGTGGGG + Intronic
1034164351 7:149014193-149014215 GTGGCACCTTCTGCACTGTGGGG - Intronic
1034192735 7:149224118-149224140 GTGGCAGCTGCTGCCCTGGCGGG + Exonic
1034277780 7:149831127-149831149 AGGGCGACTGCTCCTCTGTGGGG - Intergenic
1034474264 7:151273773-151273795 GTGCCTGCTGCTGCCCTGTGTGG + Intronic
1034634076 7:152553655-152553677 ATGGCAGGTGCTCCTCCCTGTGG + Intergenic
1035289678 7:157829920-157829942 GTGGCAGCTCCACCTGTCTGTGG + Intronic
1039837030 8:41264905-41264927 GTGGCTGCTGCTCCACATTGCGG + Exonic
1040977883 8:53214548-53214570 ATGGCAGTTGCTGCTCAGTGTGG + Intergenic
1041553276 8:59123911-59123933 GTTGCAGCTGCTCCTATTTAAGG - Intergenic
1042182702 8:66107839-66107861 CTGGCAGCTGCTACTCTGGGAGG - Intergenic
1046017011 8:108617407-108617429 ATAGCAGCTGCTTCTGTGTGAGG - Intronic
1046814519 8:118569642-118569664 GTGTCTGTTTCTCCTCTGTGTGG - Intronic
1048888175 8:138925267-138925289 GTGGTCGCAGCTCCACTGTGGGG - Intergenic
1048960551 8:139573375-139573397 GTGGCTGCTGCTCCTGTTTGGGG - Intergenic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049354579 8:142181372-142181394 GTGCCAGCTGCTGCACTGGGGGG + Intergenic
1049377155 8:142294736-142294758 GCAGCAGCAGCTCCTCTGTAGGG - Intronic
1049657005 8:143803445-143803467 GGTGCAGCTGCTCCGCAGTGTGG - Exonic
1049671398 8:143871702-143871724 CTGGGAGCTGCTCTTCTCTGAGG - Exonic
1049741070 8:144241163-144241185 GTGGCACCTGCTGTTCTCTGAGG + Intronic
1051585334 9:18721276-18721298 GTAGCAGCCTCTCTTCTGTGGGG + Intronic
1052752826 9:32509363-32509385 CTGGCAGGTGCCCCTCTGGGAGG + Intronic
1053014703 9:34655210-34655232 GCAGCTGCTGCTCATCTGTGGGG - Exonic
1056569414 9:87802685-87802707 GCGGCAGCTGCTCCACTTAGAGG - Intergenic
1057040774 9:91845969-91845991 CTGCCAGCTGCTTCTCAGTGGGG - Intronic
1058012999 9:99999020-99999042 GGCGCAGCTGCTCCTTGGTGAGG + Intronic
1059342002 9:113602544-113602566 GGGGCAGATGGTGCTCTGTGGGG + Intergenic
1059344698 9:113620297-113620319 GTGGCATCAGAGCCTCTGTGTGG + Intergenic
1060523249 9:124306218-124306240 GTGGCAGCTGGAACTCTTTGTGG + Intronic
1061594391 9:131619508-131619530 CTTGGAGCTGCTCCTCTGTGGGG + Intronic
1061685681 9:132275889-132275911 ATGGCAGCTGCTCGGTTGTGTGG - Intronic
1061855602 9:133440450-133440472 GGGGCAGCCGGTCCTCGGTGAGG - Exonic
1061885919 9:133591100-133591122 GAGGCAGCTGCTCATGAGTGGGG - Intergenic
1062150636 9:135017051-135017073 CTGGCACCTCCTGCTCTGTGAGG - Intergenic
1062177820 9:135174030-135174052 GTGTCTTCTGCTCCTCTGTAAGG + Intergenic
1062690080 9:137837130-137837152 GTACCAGCTGCTCCTCTGGCAGG - Intronic
1187507433 X:19888267-19888289 GTGCCACCGCCTCCTCTGTGCGG - Intergenic
1188934231 X:36153743-36153765 GTGGTAGCTGCCCCTCTGATGGG - Intergenic
1189284292 X:39840556-39840578 CTGGCAGCTGCCCCTGTGTTTGG + Intergenic
1191716955 X:64200316-64200338 GACCCAGCTGCTCCTCTGTAGGG - Intronic
1192147806 X:68693677-68693699 GCGGCAGCTGCTCTTCTGGCTGG + Intronic
1192313688 X:70036007-70036029 GGGGCTGCTGCTCCTCTCTTGGG + Exonic
1196874950 X:120148388-120148410 GGGGCTTCTGGTCCTCTGTGGGG - Intergenic
1197039668 X:121921372-121921394 GTGGAAGCAGTTGCTCTGTGTGG + Intergenic
1198286240 X:135194607-135194629 GTGGGCGCTGCTGCTCTGTGGGG + Intergenic
1200168045 X:154050807-154050829 GTGGCTCCTGCTTCTCTTTGTGG - Intronic
1202170425 Y:22037925-22037947 GTTGCAGCTGCTGCTCTCAGCGG - Intergenic
1202220939 Y:22548448-22548470 GTTGCAGCTGCTGCTCTCAGCGG + Intergenic
1202322173 Y:23647215-23647237 GTTGCAGCTGCTGCTCTCAGCGG - Intergenic
1202548595 Y:26022841-26022863 GTTGCAGCTGCTGCTCTCAGCGG + Intergenic