ID: 1118694018

View in Genome Browser
Species Human (GRCh38)
Location 14:68366536-68366558
Sequence CTGGACTAAAGCAGCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118694018 Original CRISPR CTGGACTAAAGCAGCCTTGA AGG Intronic
902326630 1:15705024-15705046 CTGGTCTAACGCAGCCCTGGCGG + Intronic
907271435 1:53293756-53293778 CTAGACTAAAGCACGCTGGAGGG + Intronic
913475336 1:119231514-119231536 AAGGAATAAAGCTGCCTTGAAGG + Intergenic
1063587403 10:7364930-7364952 GTGAAGTAAATCAGCCTTGATGG - Intronic
1069778458 10:70940442-70940464 CTGGAGCACAGCAGCCTTCAAGG - Intergenic
1071259597 10:83908135-83908157 CTGGACTCCACCAGCCTTGGGGG + Intergenic
1072237998 10:93469613-93469635 CTGGACAAAGCCAGCCCTGAGGG - Intronic
1072425068 10:95323247-95323269 CTGAAATACAGCAGACTTGATGG - Intronic
1073714888 10:106092922-106092944 CTGGAGTAGAGCAGCCTAAATGG + Intergenic
1074204565 10:111271721-111271743 CTTCACTCAACCAGCCTTGAGGG - Intergenic
1075172804 10:120131630-120131652 CTGGAGCCAAGCAGACTTGAAGG - Intergenic
1076817781 10:132923186-132923208 CTGGCCTCAAGCAGCCATGTGGG + Intronic
1076880050 10:133235687-133235709 CTGGGCTAGAGCAGCCTCGGCGG + Intergenic
1080262942 11:30369519-30369541 ATGGACTAATACAGCATTGATGG + Intergenic
1082607645 11:55261553-55261575 ATGTACTAAAGCAGCATTTAAGG + Intergenic
1083591289 11:63896695-63896717 CTGAACTGAAGAACCCTTGAAGG - Intronic
1086695586 11:89841422-89841444 ATGTACTAAAGCAGCATTTAGGG + Intergenic
1086702975 11:89921037-89921059 ATGTACTAAAGCAGCATTTAAGG - Intronic
1086710567 11:90003061-90003083 ATGTACTAAAGCAGCATTTAGGG - Intergenic
1087747550 11:101966959-101966981 CTGGACTAAAGAAGCCCAGTAGG - Intronic
1089580372 11:119477901-119477923 CTGGACTAGAGGACCCTGGAAGG - Intergenic
1090313368 11:125763447-125763469 CTGGCCTCAGACAGCCTTGAAGG + Intergenic
1093342556 12:17996911-17996933 CAGTAATAAAGCAGCATTGATGG + Intergenic
1100770377 12:97914855-97914877 CTTGACTAAAGCAGTATTGGTGG - Intergenic
1101284236 12:103293620-103293642 CTGAACTCAACCAGCCTGGAGGG - Intronic
1103157763 12:118701463-118701485 CTGGACTATGGTGGCCTTGAAGG + Intergenic
1103370046 12:120412341-120412363 CTGGACTCCACCAACCTTGATGG + Intergenic
1104619772 12:130302244-130302266 CTGGACTCAACCAGGCTTGCAGG + Intergenic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1108108399 13:47039254-47039276 CCTGAATAAAACAGCCTTGAGGG + Intergenic
1108557557 13:51609869-51609891 CTGATTTAGAGCAGCCTTGAAGG + Intronic
1108604854 13:52027112-52027134 CTGGGCAAGAGCAGTCTTGAGGG + Intronic
1108756726 13:53511890-53511912 CTGGACTAAAGCAGGATCCAAGG - Intergenic
1112046598 13:95603927-95603949 GTGAGCTAAAGCAGCCTGGAAGG - Intronic
1112928249 13:104703984-104704006 CTGGACTAAAGCAAGGTTGAAGG + Intergenic
1114653910 14:24304549-24304571 CTGGAGTGGAGCAGCCTTGAGGG + Exonic
1118694018 14:68366536-68366558 CTGGACTAAAGCAGCCTTGAAGG + Intronic
1120728000 14:87967792-87967814 CTAGATTAAAGGAGACTTGAGGG + Intronic
1126220975 15:46212685-46212707 TTGGACTACATCAGCCTTAAAGG + Intergenic
1129852171 15:78799562-78799584 CTGGAGAAAAGCAGCCTAAAGGG + Intronic
1130244111 15:82227379-82227401 CTGGTCTAGAGCAGCCTGGATGG + Intronic
1130250829 15:82299525-82299547 CTGGAGAAAAGCAGCCTAAAGGG - Intergenic
1131521926 15:93122817-93122839 CTGGACTAAACCAGCTTTTCAGG - Intergenic
1133862285 16:9607366-9607388 TTGGATTGAAGGAGCCTTGAAGG - Intergenic
1134133864 16:11667484-11667506 CTGGGCCACAGAAGCCTTGAGGG + Intergenic
1134343087 16:13363278-13363300 CTGGACTATAGTATCTTTGAAGG + Intergenic
1135821497 16:25690645-25690667 CTGAACTAAAGCTGCAGTGAAGG + Intergenic
1137538858 16:49348336-49348358 CTGGACTAAATAAGGTTTGATGG + Intergenic
1139372848 16:66479428-66479450 CTGGACCCAACCAGCCTTGGGGG - Intronic
1140464270 16:75167060-75167082 CTGGACTTCAGAAGCCTTAAAGG - Intronic
1141136699 16:81470301-81470323 CTGGACCCAAGCTGCCTGGACGG - Intronic
1142180814 16:88668873-88668895 CTGGACTCAAGCAGTCCTGTGGG - Intergenic
1143914043 17:10275798-10275820 CTGGACCACAGCTGCCCTGATGG + Intergenic
1144997765 17:19282371-19282393 GTGGACCAAAGCAGTTTTGAAGG + Intronic
1150906364 17:69342442-69342464 AAGGAATAAAGCAGCCCTGAGGG + Intergenic
1152938075 17:83152210-83152232 CTGGACTCAGGCAGCCCTGCTGG + Intergenic
1153101597 18:1476977-1476999 CTGGATTAAAGCAGCACTGCTGG + Intergenic
1155890545 18:31262919-31262941 TTTGACTATAGCAGCCTTCAGGG + Intergenic
1159672690 18:71241514-71241536 ATGGAGCAAAGCAGCCTTCAGGG - Intergenic
1163499181 19:17665443-17665465 CTTGACAACTGCAGCCTTGATGG + Intronic
1167495247 19:49813770-49813792 CTGGACTCAACCACCCTCGAAGG - Intronic
925440178 2:3878913-3878935 CTAGACTGGAGCAGCCTCGAGGG + Intergenic
926858069 2:17279122-17279144 CTGGACTAGAGTAGACTTCATGG - Intergenic
927484057 2:23476991-23477013 CTGGAATGAAGCAGGCTGGAGGG + Intronic
930994689 2:57702221-57702243 CTGGAGGAAAGCACGCTTGAGGG + Intergenic
931262936 2:60636183-60636205 CTGGACTTGAGCAGCCATGTTGG - Intergenic
932094529 2:68835800-68835822 CTAGACTGATGCAGCCTTGCAGG - Intergenic
934629064 2:95895561-95895583 TCGGAAAAAAGCAGCCTTGAAGG - Intronic
934629478 2:95901177-95901199 TCGGAAAAAAGCAGCCTTGAAGG - Intronic
934629893 2:95906793-95906815 TCGGAAAAAAGCAGCCTTGAAGG - Intronic
938611661 2:132953892-132953914 CTGGACTGTAGGAGCTTTGATGG + Intronic
940656062 2:156489573-156489595 CTGGGCTATAGAATCCTTGAAGG + Intronic
941198058 2:162474711-162474733 CTGGAGGAAACCAGCCTTGCTGG + Intronic
941198077 2:162474916-162474938 CTGGAGGAAATCAGCCTTGCTGG + Intronic
945740012 2:213647845-213647867 CAGGACTAAACGAGACTTGAAGG + Intronic
946965445 2:225032162-225032184 TAGGACTAAAGCATTCTTGAAGG + Intronic
1170883507 20:20318150-20318172 CAGGACTCCAGCAGCCTTGGAGG - Intronic
1170913051 20:20593921-20593943 CTGGCCTAATGCAGCTTTTAAGG + Intronic
1173929525 20:46807107-46807129 ATGGATAAAAGCAGCCTTAAGGG - Intergenic
1175396116 20:58663257-58663279 CTACACTAAATCAGCCTTCAGGG + Intronic
1177042771 21:16133415-16133437 CTAGCCAAAAGAAGCCTTGAGGG - Intergenic
1180060251 21:45381385-45381407 CTGGACTGAAGCAGCCTCCAGGG + Intergenic
1184020232 22:41815976-41815998 CTGGACTCAACCAGCTGTGAAGG + Intronic
952622962 3:35368053-35368075 ATGGACAAAAGCATCCTTGCAGG - Intergenic
958947608 3:100381040-100381062 ATGGAATAAAGCAGGCTAGATGG + Intronic
964829658 3:160869956-160869978 CTGGACAAGAGCAGCAGTGAGGG - Intronic
966557221 3:181276244-181276266 CGGGATTTAAGCAGTCTTGAAGG + Intergenic
967928109 3:194668549-194668571 CTAGAGTAAACCAGACTTGATGG - Intronic
968393587 4:212972-212994 CTGGGCCAGAGCAGCCTTGCGGG - Intergenic
968401874 4:305125-305147 CTGGGCCAAAGCCGCCTTGCGGG + Intronic
968419719 4:473795-473817 CTGGGCCAGAGCAGCCTTGCGGG + Intronic
969849744 4:9946987-9947009 CTAGCCTAAAGCAGGCTTGGAGG - Intronic
971168881 4:24212992-24213014 CAGGACAAAATCAGCCTTGTTGG + Intergenic
978326599 4:107564444-107564466 CTGTGCTAAAACAGCCTTGCTGG + Intergenic
981042160 4:140233286-140233308 CTGGCCTAAAGGACCCTTAATGG - Intergenic
981067822 4:140504124-140504146 GTTAACTAAAGAAGCCTTGATGG - Intergenic
982692491 4:158564658-158564680 CAGGACTAAAACAGCATTCAGGG + Intronic
984162008 4:176264414-176264436 ATGGACTAAAACAGTCCTGAGGG + Intronic
988391809 5:30643922-30643944 CTTGGCTAAGGCAGCTTTGAAGG - Intergenic
988732189 5:33983668-33983690 CTGGACAAAAGCAAACCTGAGGG - Intronic
991680333 5:69133502-69133524 CTCAACTAAAGCAGCGTTCAAGG + Intergenic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
993689645 5:90983866-90983888 CTGTACCAAATTAGCCTTGAGGG - Intronic
997305936 5:132836505-132836527 CTGGACTAAGGCTGCCAGGATGG - Intergenic
997508759 5:134438696-134438718 CTGGGCTCAAGCATCCTCGAAGG + Intergenic
999948866 5:156627036-156627058 TTGGTCCAAAGCAGCCTTAAAGG - Intronic
1000334035 5:160228766-160228788 CTGGAGCAAAGCAAACTTGAAGG - Intronic
1000651255 5:163821732-163821754 CTGGACTCAACCAGTCCTGAGGG - Intergenic
1001241629 5:170075860-170075882 CTTGACTGCAGCTGCCTTGATGG + Intronic
1001283501 5:170405529-170405551 CTGGACTCAGGCATCCTTGCAGG + Intronic
1003731450 6:8829100-8829122 CTGGACTGAGGCAGCAGTGATGG - Intergenic
1005969971 6:30753075-30753097 CTGGAATATTGCAGCCCTGAGGG - Intergenic
1007289012 6:40770235-40770257 CTTGACTATGGCCGCCTTGAGGG + Intergenic
1008113195 6:47516255-47516277 CAAGACTAAAGCAGCCCAGAAGG - Intronic
1011596577 6:89022323-89022345 CTGAACTAAAGCAGCGTACATGG + Intergenic
1016503528 6:144750057-144750079 CCTGACTAAAGAAACCTTGAAGG + Intronic
1018614907 6:165677447-165677469 CTGGATTCAACCAGCCTTGTTGG + Intronic
1018651021 6:165991296-165991318 CTGGATTAGGACAGCCTTGAGGG - Intergenic
1019273190 7:162032-162054 CTGGACTGAGGCTGCCTGGACGG + Intergenic
1020482013 7:8672974-8672996 CTTGACTAAAGCAATCTTGATGG - Intronic
1020806735 7:12799283-12799305 CTCGACTAAAGCTGCCATGAAGG - Intergenic
1020903816 7:14040097-14040119 CTGAACTAAAGCTGCCCTGTTGG + Intergenic
1023167365 7:37356049-37356071 CTGAACTAAAGAAGACTGGAAGG + Intronic
1023189068 7:37559760-37559782 CTAAACTAAAGCACCCATGAAGG - Intergenic
1024112147 7:46158233-46158255 TTGATCTAAAGGAGCCTTGATGG + Intergenic
1024148296 7:46539865-46539887 GTGGGCTAAAGGAGCCTTAAAGG - Intergenic
1024342115 7:48277088-48277110 CTTGACTAAAGCAGACATCATGG - Intronic
1025035039 7:55588645-55588667 CTGGATCACAGCAACCTTGAAGG + Intergenic
1029480681 7:100810809-100810831 TTGGAATAAAGCAGCAGTGAAGG + Intronic
1030308864 7:108048474-108048496 CTTGACTCAAGGAGCCTGGATGG - Intronic
1034410594 7:150939533-150939555 CTGGACTTAAGCAGCCCAGGTGG - Intergenic
1036748571 8:11428389-11428411 CTGGACAAAGGCCGCCTGGATGG + Intronic
1037763409 8:21756930-21756952 CTGGCTGAGAGCAGCCTTGATGG + Intronic
1037864200 8:22430049-22430071 CTGGACTGCAGCAGACATGAGGG + Intronic
1038552469 8:28481879-28481901 CTGCAGTAAGGCAACCTTGAGGG + Intronic
1039464082 8:37771033-37771055 CTGGCCTCAAGAAGCCTTTATGG - Intronic
1039484792 8:37901941-37901963 CTGGCCTCAAGAAGCCTTTATGG - Intergenic
1039840586 8:41290343-41290365 CTGGGCTAACCCAGCCCTGAAGG + Intronic
1041215508 8:55596280-55596302 ATGGACAGAAGCAGCCTTGGAGG + Intergenic
1044539341 8:93392166-93392188 CTGGACTAAATGAGCCTTACAGG - Intergenic
1044695725 8:94920624-94920646 CTGGGCTACAGCAGCCATGATGG - Intronic
1047855279 8:128902628-128902650 CTGTACAAGAGCAGCCTTGCTGG - Intergenic
1052254433 9:26437576-26437598 CTGCAGTAAAGCAACCTTGGTGG + Intergenic
1052391877 9:27888826-27888848 GTGGTCTAATGCAGCTTTGATGG - Intergenic
1055827836 9:80348109-80348131 CTTGTCTAAAGCATCCTAGAGGG - Intergenic
1057346032 9:94251389-94251411 CTGGCCTAAACCATTCTTGAGGG + Intergenic
1057694080 9:97311249-97311271 CTGGACCAAGGCAGCCCTGTAGG - Intronic
1059341012 9:113597571-113597593 CTGGACTAAGGCAGCCTGGGGGG + Exonic
1059654258 9:116343012-116343034 CTGGACTAGAACGTCCTTGAGGG - Intronic
1059998575 9:119937677-119937699 CTGGACTAAAGCAGAAAAGACGG + Intergenic
1061183337 9:129037581-129037603 CTGGAGTGAAGCAGGCTTGGGGG + Intronic
1187981783 X:24765084-24765106 CTGGACTAAAGCAGGGGTGCAGG - Intronic
1190904509 X:54712457-54712479 CTGGACTAAAGCTGCTGTCAAGG - Intergenic
1197315778 X:124964335-124964357 ATGGAATAAAGTATCCTTGAGGG + Intergenic