ID: 1118694286

View in Genome Browser
Species Human (GRCh38)
Location 14:68369238-68369260
Sequence TAGCCTAGTGCCAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118694286 Original CRISPR TAGCCTAGTGCCAGTGGGTT TGG Intronic
900466473 1:2827956-2827978 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
902390626 1:16102841-16102863 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
903575619 1:24337888-24337910 TAGCCCATTGCCACAGGGTTGGG + Intronic
904572924 1:31480834-31480856 TCCTCTAGTGCCAGTGAGTTAGG + Intergenic
907041383 1:51263726-51263748 TAGCCTAGGGCCGGGGAGTTTGG + Intronic
908206090 1:61851386-61851408 TAGACAAGTGGCAGTGGGTCAGG + Intronic
909615255 1:77601613-77601635 AAGCCTACTGCCAGTGAATTGGG - Intronic
911283448 1:95959717-95959739 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
914982130 1:152424196-152424218 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
915179715 1:154047803-154047825 TCCTCTAGTGCCACTGGGTTAGG + Intronic
917738108 1:177938656-177938678 GAGCCTCTAGCCAGTGGGTTGGG + Intronic
919282611 1:195510452-195510474 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
920920920 1:210296578-210296600 TGGCCTAGTGGCAGTGGGCTGGG + Intergenic
921225461 1:213015338-213015360 CAGGCTTGTGCCAGTGGCTTTGG - Intronic
923870460 1:237987908-237987930 AAGCCTAATACCAGTGGGTAAGG + Intergenic
924517032 1:244774789-244774811 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1063789212 10:9423085-9423107 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1069056262 10:63847891-63847913 TACTCTAGTGCCACTGGGTTAGG + Intergenic
1073190908 10:101650109-101650131 TAGCCTTGTGCCAGGAGCTTGGG - Intronic
1073272801 10:102280454-102280476 TAGCCTGATCCTAGTGGGTTGGG + Intronic
1073840679 10:107495657-107495679 CGGCCTAGTGACAGTGGCTTCGG - Intergenic
1074884464 10:117683725-117683747 TACCCCAGTGGCAGTGGGCTGGG - Intergenic
1077180497 11:1210467-1210489 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1077893910 11:6439805-6439827 TAGCCAGGTGCCATTGTGTTGGG + Intronic
1078508158 11:11967116-11967138 GAGCCTAGAGCCAGCGGCTTAGG + Intronic
1079603576 11:22340878-22340900 TAGGCTAGTGCCTGTGCGTGAGG - Intronic
1079830666 11:25263725-25263747 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1080944735 11:36958477-36958499 GAGCCTAGAGCCACTGGGGTTGG - Intergenic
1081981525 11:47269967-47269989 TAGCCTAGCGCCCGTGGGCGCGG - Intronic
1084024933 11:66442021-66442043 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1087275868 11:96159900-96159922 TAGAGTAGAGGCAGTGGGTTAGG - Intronic
1091239946 11:134045705-134045727 TTGCCTATTCCCAGAGGGTTGGG - Intergenic
1092150563 12:6245459-6245481 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1092987450 12:13860150-13860172 TTGCTTAATGACAGTGGGTTTGG - Intronic
1094028214 12:25981263-25981285 GAGTCTAGTGGCAGTGGGCTGGG + Intronic
1098812354 12:75110844-75110866 TAGCCTAGTGTCAAGGCGTTAGG - Intronic
1100472531 12:94906181-94906203 TCCTCTAGTGCCACTGGGTTAGG + Intronic
1101501548 12:105308766-105308788 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1104915109 12:132260457-132260479 TAGCCTAGTGCAAGGGGCGTGGG - Intronic
1109250404 13:60012754-60012776 TAGGTTAGGGCCAGAGGGTTTGG - Intronic
1109498767 13:63211147-63211169 CAGGATAGTACCAGTGGGTTTGG - Intergenic
1110919250 13:81063875-81063897 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1111173495 13:84561273-84561295 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1111813003 13:93115481-93115503 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1111819582 13:93196169-93196191 TGGCCCAGTGGCAGTGGGCTGGG + Intergenic
1116219733 14:42067965-42067987 TAGCTTCGTGCCACTGGATTTGG + Intergenic
1117083187 14:52172528-52172550 TTCTCTAGTGCCACTGGGTTAGG + Intergenic
1118453899 14:65928361-65928383 TAGCCCAGAGGCTGTGGGTTAGG + Intergenic
1118694286 14:68369238-68369260 TAGCCTAGTGCCAGTGGGTTTGG + Intronic
1118788748 14:69069228-69069250 CAGCCTACTGCCAGTGGGGGTGG + Intronic
1124067171 15:26355114-26355136 CAGCCTCTTGCCAGTGGGTGCGG - Intergenic
1125538513 15:40456627-40456649 TGGCCTTGGGCCAGTGGGTGGGG - Intronic
1127977423 15:64008000-64008022 TTGCCTAGGGCTAGTGGGTTTGG + Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1133953363 16:10417966-10417988 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1136922269 16:34343259-34343281 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1136982304 16:35068547-35068569 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1137495000 16:48962740-48962762 TGGCCTGGTGCCAGTGGCTCAGG + Intergenic
1141368575 16:83466479-83466501 CAGCCTAGTGGCAGTGGGCTGGG + Intronic
1141784875 16:86192741-86192763 TAGCCTAATGCCACTGGGAACGG + Intergenic
1143430057 17:6875173-6875195 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1144506826 17:15838716-15838738 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1144777390 17:17791669-17791691 TGGCCGAGTCCCAGAGGGTTTGG - Intronic
1144790722 17:17857342-17857364 TAGCCCAGTGCCTGTGAATTTGG - Intronic
1145171008 17:20656648-20656670 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1146101309 17:29985424-29985446 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1146101936 17:29991284-29991306 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1148613161 17:48978471-48978493 CAGCCTATTTCCTGTGGGTTGGG - Intergenic
1149412360 17:56421467-56421489 GAGCCTAGTGCCATTGGTTTGGG - Intronic
1150287641 17:63962945-63962967 TTGCCTTGTGCCAGGGAGTTGGG - Intronic
1153351674 18:4087652-4087674 TCCTCTAGTGCCACTGGGTTAGG + Intronic
1153892205 18:9528101-9528123 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1157900260 18:51508327-51508349 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1159285544 18:66344891-66344913 TAGCCTAGTGCCTGTATGGTAGG - Intergenic
1162527250 19:11213439-11213461 TGGCCAAGTACCACTGGGTTCGG + Intronic
1164060249 19:21666595-21666617 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1164261468 19:23571599-23571621 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1164295336 19:23904815-23904837 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
925851970 2:8090751-8090773 TAGAGTAATGCCAGCGGGTTTGG - Intergenic
927703704 2:25284108-25284130 CAGCCTGGTGCCTGTGGGTGTGG - Intronic
930314838 2:49785236-49785258 TAGTCCAGTGGCAGTGGGCTGGG + Intergenic
930918125 2:56719463-56719485 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
935025279 2:99270708-99270730 TTGTCTAGCGCCACTGGGTTAGG - Intronic
936800098 2:116256090-116256112 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
942314842 2:174688761-174688783 TCTCCTAGTGTCTGTGGGTTAGG + Intergenic
945292292 2:208138219-208138241 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
945300524 2:208212094-208212116 TTGCCAAGTTCCAGTGGCTTAGG - Intergenic
1169707027 20:8517493-8517515 TAGCCCAGTGGCAGTGGGCTGGG + Intronic
1170144515 20:13158230-13158252 TAGCCTATTGCCAATTGCTTTGG + Intronic
1171946382 20:31381948-31381970 AAGCATAGTGACAGTGGGTGGGG + Intronic
1177361793 21:20082678-20082700 TAGCCTTGTGCCATTGGTGTGGG - Intergenic
1177377518 21:20292729-20292751 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1177771389 21:25519760-25519782 TCCCCAAGTGCCAGTGGGTCCGG - Intergenic
951821875 3:26823048-26823070 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
954355685 3:50082550-50082572 TGGCCCAGTGCCAGTGGGCTGGG - Intronic
960015775 3:112885912-112885934 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
960419362 3:117425046-117425068 TATTCTAGTGCCAGTGGGGATGG + Intergenic
961859266 3:129901699-129901721 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
962108835 3:132420553-132420575 TAGCTTGGTGGCAGGGGGTTGGG - Intronic
963415064 3:144984427-144984449 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
963707235 3:148702555-148702577 TAGCCTAATGCTAGTAGGGTGGG + Intronic
966495792 3:180578816-180578838 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
966967755 3:185012783-185012805 TCCTCTAGTGCCACTGGGTTAGG - Intronic
966976070 3:185084526-185084548 TCGCTTAGTGCCAGTGGAATTGG - Intronic
968054364 3:195679949-195679971 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
968101528 3:195969209-195969231 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
969123415 4:4926701-4926723 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
969880357 4:10168106-10168128 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
970772720 4:19634665-19634687 TCCTCTAGTGCCAATGGGTTAGG + Intergenic
972931498 4:44077083-44077105 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
975195487 4:71518719-71518741 GAGCCTAGGGCCACTGGGTTTGG + Intronic
976128455 4:81858202-81858224 TCCTCTAGTGCCACTGGGTTAGG - Intronic
976557527 4:86466506-86466528 TTCTCTAGTGCCACTGGGTTAGG + Intronic
977653080 4:99491808-99491830 TTCTCTAGTGCCACTGGGTTAGG - Intergenic
977677398 4:99763053-99763075 TATCCTAGTGCCAGCTGGTGGGG - Intergenic
977857037 4:101906882-101906904 TCCTCTAGTGCCACTGGGTTAGG - Intronic
983916169 4:173293963-173293985 TAGCCTGCAGTCAGTGGGTTAGG + Intronic
985937415 5:3107497-3107519 TGGCCTAGAGGCAGTGAGTTGGG - Intergenic
986374213 5:7113739-7113761 TAGCCTGGGGACAGTGGGCTTGG + Intergenic
987903808 5:24050297-24050319 GAGCTTAGAGCCAGTGGATTTGG + Intronic
989065170 5:37453190-37453212 TTCTCTAGTGCCACTGGGTTAGG - Intronic
989594494 5:43143484-43143506 TAAACTAGTTCCAGTGGGATAGG - Intronic
990109363 5:52304955-52304977 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
992447307 5:76845663-76845685 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
993405796 5:87510794-87510816 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
994514403 5:100752497-100752519 TATGCCAGTGCCAGTGTGTTGGG + Intergenic
996991164 5:129634120-129634142 TAACCTTGTGCCAGTGTTTTCGG + Intronic
997073391 5:130643224-130643246 TCTTCTAGTGCCACTGGGTTGGG - Intergenic
998531624 5:142890415-142890437 GAGCATGGTGACAGTGGGTTAGG + Intronic
1000240848 5:159406741-159406763 TGGCCAAGTGACAGTGGCTTTGG - Intergenic
1003600713 6:7514581-7514603 TAGCCCAGTGGCAGTGGGTTGGG + Intergenic
1006050449 6:31338783-31338805 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1007717405 6:43865218-43865240 ATGCCTAGAGACAGTGGGTTGGG + Intergenic
1008727970 6:54443830-54443852 CAGCCAAGTGGCAGTGGGCTGGG + Intergenic
1010433699 6:75806937-75806959 TCCTCTAGTGCCACTGGGTTAGG + Intronic
1010554684 6:77264873-77264895 TAACCTACTGGCAGTGGGGTTGG + Intergenic
1011031914 6:82932539-82932561 TAGCCTAGTGACAGTGCCTAAGG - Intronic
1017270907 6:152504228-152504250 TATCCTAGTGAAAGTGGGGTGGG + Intronic
1019233677 6:170590155-170590177 TCCCCTAGTGCCACTGGGTTAGG - Intergenic
1019233899 6:170593108-170593130 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1021951640 7:25780659-25780681 TAGGATAATTCCAGTGGGTTGGG + Intergenic
1023089396 7:36603515-36603537 TGCCCTAGTGCTAGAGGGTTAGG - Intronic
1023476535 7:40585243-40585265 TAACCTTGTGCCAGAGGGGTGGG + Intronic
1023513067 7:40973639-40973661 GTGGCTAGAGCCAGTGGGTTTGG + Intergenic
1023549657 7:41356381-41356403 TAGCTTATTGCTAGTGGTTTTGG - Intergenic
1024176425 7:46845305-46845327 TGGCCCAGTGGCAGTGGGCTGGG - Intergenic
1025743356 7:64220962-64220984 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1030993531 7:116330283-116330305 TAGCTGAGTGCCAGTGAGTCTGG - Intronic
1036821184 8:11941520-11941542 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1038718905 8:30015673-30015695 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1039104617 8:33976694-33976716 CAGCCAAGTGGCAGTGGGCTGGG - Intergenic
1039511485 8:38095531-38095553 TCCTCTAGTGCCACTGGGTTGGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039692209 8:39875957-39875979 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1040528391 8:48244542-48244564 TCTTCTAGTGCCACTGGGTTTGG - Intergenic
1040608856 8:48962751-48962773 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1041069322 8:54111637-54111659 TTGCCTAGGGACAGGGGGTTGGG + Intergenic
1042671270 8:71266106-71266128 TAGCTTAGTCACAGTGGCTTAGG - Intronic
1043201455 8:77374296-77374318 TCCTCTAGTGCCACTGGGTTAGG + Intergenic
1043951675 8:86316383-86316405 TTGTCTAGTGCCACTGGGTTAGG - Intronic
1045950761 8:107849212-107849234 TGGCCTAGTGGCAGTTGGCTGGG - Intergenic
1046001034 8:108421136-108421158 TCCTCTAGTGCCACTGGGTTAGG - Intronic
1047189669 8:122666611-122666633 AAGCCTAGTATCAGTGGGGTGGG - Intergenic
1048686723 8:136912366-136912388 TAATCTAGCGCCACTGGGTTAGG - Intergenic
1050126344 9:2360064-2360086 TGGCCTATTCACAGTGGGTTTGG + Intergenic
1050274865 9:3986121-3986143 TATCTTAGAGCCACTGGGTTTGG + Intronic
1050581417 9:7061478-7061500 AAGCCTGGTGCTGGTGGGTTGGG + Intronic
1050993295 9:12180059-12180081 TTTCTTATTGCCAGTGGGTTAGG - Intergenic
1056915157 9:90739771-90739793 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1057285578 9:93751091-93751113 TTCTCTAGTGCCACTGGGTTAGG - Intergenic
1058760154 9:108122755-108122777 TAGCCCAGTGGCAGTGGGCTGGG + Intergenic
1060326473 9:122620947-122620969 TCCTCTAGTGCCACTGGGTTAGG - Intergenic
1061059775 9:128244646-128244668 GAGCCTGGAGCCAGGGGGTTGGG - Intronic
1062745933 9:138212031-138212053 TGACCTAGAGCCTGTGGGTTTGG + Intergenic
1187554886 X:20342152-20342174 TACTCTACTCCCAGTGGGTTGGG + Intergenic
1187579584 X:20593661-20593683 TGGCCCAGTGGCAGTGGGCTGGG + Intergenic
1187709689 X:22040760-22040782 GACCCAAGTGCCAGTGAGTTTGG + Intronic
1189155260 X:38750259-38750281 TACCCAAGTGCCAGAGGATTGGG + Intergenic
1189729211 X:44001093-44001115 TAGCCAAGTTCCAGCGGGCTTGG - Intergenic
1189803099 X:44709642-44709664 TAGCCTGGTGCCCTTGGCTTGGG - Intergenic
1191949084 X:66569161-66569183 TTCTCTAGTGCCACTGGGTTAGG - Intergenic
1193438666 X:81512303-81512325 GAGCCTAGAGACAGTGGATTGGG + Intergenic
1194890316 X:99371220-99371242 TAGAATAGTGCCAGTGTGTCCGG + Intergenic
1199497680 X:148471377-148471399 AAGCATAGTGCCAGTGAGGTAGG - Intergenic
1201408538 Y:13673689-13673711 TCCTCTAGTGCCAGTGGGTTAGG - Intergenic
1201683616 Y:16677489-16677511 TACTCTAGTGCCACTGGGTTAGG - Intergenic