ID: 1118694331

View in Genome Browser
Species Human (GRCh38)
Location 14:68369612-68369634
Sequence TGGCACCTATTTGAAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118694331_1118694336 28 Left 1118694331 14:68369612-68369634 CCTGTTCTTTCAAATAGGTGCCA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1118694336 14:68369663-68369685 ATATGTTATGCCTGGCTGCTAGG 0: 1
1: 0
2: 0
3: 11
4: 104
1118694331_1118694335 20 Left 1118694331 14:68369612-68369634 CCTGTTCTTTCAAATAGGTGCCA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1118694335 14:68369655-68369677 GATACTTCATATGTTATGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118694331 Original CRISPR TGGCACCTATTTGAAAGAAC AGG (reversed) Intronic
900854256 1:5168067-5168089 TGGTACCAGCTTGAAAGAACTGG + Intergenic
901965487 1:12862915-12862937 TGGCACCTGTTTCAAGGACCTGG + Intronic
901973861 1:12929395-12929417 TGGCACCTAGTTCAATGACCTGG + Intronic
902011317 1:13272373-13272395 TGGCACCTAGTTCAATGACCTGG - Intergenic
903000739 1:20263835-20263857 TGGGACCTGGTTGAAAGCACAGG - Intergenic
905951408 1:41954538-41954560 TGGCAGCTGTTTGCAAGGACAGG + Intronic
912188510 1:107309931-107309953 TGGAACCTAGTTAAAAGAAATGG - Intronic
915769020 1:158398872-158398894 TGACACCCATGTGAAAGAGCTGG - Exonic
917134144 1:171772438-171772460 GGGGACCTATTTAAAAGAATAGG + Intergenic
917756797 1:178109612-178109634 TGCAACCTATTTGTAAGAAATGG - Intronic
917949327 1:180014200-180014222 TGGCGCCTTTTGGAAATAACAGG - Exonic
1065413371 10:25456152-25456174 TGCCCCCTATTTGCAAGAAGAGG - Intronic
1067563015 10:47317098-47317120 TGTCACCTTTTTGGAGGAACGGG + Intergenic
1074690051 10:115996445-115996467 TAGGCCCTATTTGAAAGTACAGG - Intergenic
1075882772 10:125868544-125868566 TGACACCTATCTGAAAGTGCAGG - Intronic
1076053022 10:127350317-127350339 TGGCTCCTGTTTGAGAGACCAGG - Intronic
1076311226 10:129509014-129509036 TGGCAGTTATTTGAAGGAAGCGG + Intronic
1077631315 11:3812878-3812900 TGGGAGCTATTAGAAAGAACTGG + Intronic
1078398650 11:11003686-11003708 TAGAACATATTTGAAAGAGCTGG + Intergenic
1078621629 11:12913997-12914019 TTGCCTCTATTGGAAAGAACTGG + Intronic
1080531827 11:33183901-33183923 TGGCAAGGATTTGAAAGAATTGG - Intergenic
1081285943 11:41270416-41270438 GGTCACATATGTGAAAGAACTGG + Intronic
1082120345 11:48373342-48373364 TGGCACCTACTTGAGGGTACAGG - Intergenic
1082253952 11:50011880-50011902 TGGCACCTAATTGAGAGTACAGG + Intergenic
1085257300 11:75182370-75182392 TTGCACCTATTTTACAGAAGAGG - Intronic
1086329038 11:85734640-85734662 TGGGACCCATTTGAAAGGCCTGG + Exonic
1091115531 11:133009277-133009299 TGGTACATATTTGGAAGAGCTGG + Intronic
1091311035 11:134575500-134575522 TTGCAGCTATTAGAAAGAACTGG + Intergenic
1093221168 12:16422086-16422108 TTGCACCCATTTGTCAGAACTGG + Intronic
1094667678 12:32537536-32537558 TTGCACATCATTGAAAGAACAGG - Intronic
1095123794 12:38450406-38450428 TGGTAACAATCTGAAAGAACTGG - Intergenic
1098179526 12:67831401-67831423 TTGCACCTATTTTACAGAATAGG - Intergenic
1098503684 12:71224413-71224435 TGGCACCTAACTGAAATAACAGG + Intronic
1103074837 12:117973710-117973732 TGTCATCAATTTCAAAGAACGGG + Intergenic
1106095283 13:26637953-26637975 TATCACCTATGTGAAAGAAAAGG + Intronic
1107801058 13:44108409-44108431 ATGCACGTATTTTAAAGAACTGG - Intergenic
1107961306 13:45561911-45561933 TGGCTGCTAATTGAAAAAACAGG + Intronic
1109777497 13:67061154-67061176 TGTTACTTATTTGAAAGAAAAGG - Intronic
1110304076 13:73964674-73964696 TGATACCTTTTTGAAAGAATTGG - Intronic
1114400396 14:22405009-22405031 TGGGACCTAGTTGAAGGCACTGG + Intergenic
1115884993 14:37961290-37961312 TGGTAACTATGTGAAAGAAATGG + Intronic
1116718410 14:48458491-48458513 TGATACTTATTTGAAATAACCGG + Intergenic
1118694331 14:68369612-68369634 TGGCACCTATTTGAAAGAACAGG - Intronic
1120830031 14:88989691-88989713 TGGTACCTATTTGAGAGAAAAGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1125997159 15:44173385-44173407 TGTCATCTATTTGAAAGAGGAGG + Intronic
1128386736 15:67154567-67154589 TGGCACCAAATGAAAAGAACAGG + Intronic
1128901297 15:71424865-71424887 TAGCAGGCATTTGAAAGAACAGG + Intronic
1130434055 15:83878737-83878759 TGGTACCTATGTGAAGGAAAGGG + Intronic
1130577520 15:85105654-85105676 TGGACCCTATTTTACAGAACAGG + Intronic
1131240906 15:90742531-90742553 TGTCACTTATTTCAAAGAAAAGG + Intronic
1132186291 15:99804606-99804628 TGGCACCTGGTTGAAAGAGGGGG - Intergenic
1132429385 15:101748100-101748122 TGGCACCTGGTTGAAAGAGGGGG + Intergenic
1135263435 16:21000696-21000718 TGGCACCTAATTCACAGAGCTGG + Intronic
1140911202 16:79454669-79454691 AGGCAGATGTTTGAAAGAACAGG - Intergenic
1144357383 17:14459123-14459145 TAGCACATATTTTAAAAAACAGG - Intergenic
1150026310 17:61678113-61678135 TGGCACCTAGTTTACAGAAATGG + Intergenic
1203179382 17_KI270729v1_random:44645-44667 TGGAACCGATTTGAATGTACTGG + Intergenic
1156952172 18:42915364-42915386 TGGCACCTTTTTGAAGTGACTGG + Intronic
1159304122 18:66616871-66616893 TGGCACTTATATGTAAGAGCCGG - Intergenic
1160018741 18:75164286-75164308 AGCCAACTCTTTGAAAGAACAGG - Intergenic
1160322475 18:77909048-77909070 TTGAACCTATTTGAGAGAATTGG + Intergenic
1165165218 19:33849340-33849362 TGGCACCGTTTTGAGAGCACAGG + Intergenic
1166884046 19:45948202-45948224 TGTCACTTATTTGAATGAATAGG - Intronic
1167030824 19:46958916-46958938 TATCACCTATTTGACAAAACTGG - Intronic
930914639 2:56672173-56672195 TGGCACTTATGGGTAAGAACTGG + Intergenic
933262730 2:80148433-80148455 AGGCAGCTATTTGCAAGGACTGG - Intronic
933363870 2:81324221-81324243 TGGCACTTATAGGAAAGAACTGG + Intergenic
935498272 2:103807775-103807797 GGGCATATATTTTAAAGAACTGG + Intergenic
935646069 2:105336033-105336055 TGGCACTAACATGAAAGAACTGG + Intergenic
938734155 2:134171229-134171251 AGGAATCTATTTGAAAAAACAGG + Intronic
939180089 2:138794383-138794405 TGGCTCCTTTTTGATAGAGCAGG + Intergenic
939314753 2:140533569-140533591 TGGAAGATATTTCAAAGAACTGG + Intronic
940801061 2:158133014-158133036 TGGTACATATCTGAAGGAACTGG + Intronic
941071182 2:160956297-160956319 TGGCTCCTTTTGGAAGGAACAGG + Intergenic
942813489 2:180023872-180023894 TGGCAGCAAAGTGAAAGAACAGG + Intergenic
943551605 2:189347066-189347088 TGGCAGCTTTTTGAAAGTATTGG - Intergenic
943836300 2:192517941-192517963 TGGGAGCTATTGAAAAGAACTGG + Intergenic
945187794 2:207157355-207157377 TGGCACCCATTTGAAAGTTAAGG + Intronic
945581273 2:211598176-211598198 TTGGCCCTATTTGAAAGGACAGG - Intronic
1170231241 20:14049379-14049401 TGTTACCAGTTTGAAAGAACTGG + Intronic
1177951787 21:27547157-27547179 TGGAACCCATTTCAGAGAACTGG - Intergenic
1181449937 22:23012954-23012976 TGGCACCTCTAAGAAAAAACGGG + Intergenic
1182207486 22:28643674-28643696 TAGTAATTATTTGAAAGAACTGG - Intronic
952495711 3:33914086-33914108 GGGCAAGTTTTTGAAAGAACTGG - Intergenic
952636089 3:35533911-35533933 TTGCACCTTTATGAAAGAAGAGG + Intergenic
953664606 3:44916925-44916947 GGGCACCAATTTGGGAGAACTGG + Intronic
955205998 3:56896474-56896496 TGGCACCTTTTTAAAAAAAGTGG - Intronic
966043886 3:175527007-175527029 TGGCAATTATTTCAAAGAAAAGG - Intronic
966508850 3:180737656-180737678 TAGCACCTAGTTAAAAGAAAGGG - Intronic
970776797 4:19684142-19684164 TGGCAACTATTTAAAACAAAAGG - Intergenic
974745313 4:66065841-66065863 TGGCAGATTTTTGAAAGAAAGGG + Intergenic
978368426 4:108006483-108006505 TGGCACAGATTAGAAACAACTGG - Intronic
981299950 4:143175784-143175806 AGTCACCTAATTGAAAGTACAGG + Intergenic
988362698 5:30255896-30255918 TGCAACCTATTTGATAGAAAAGG - Intergenic
990502038 5:56406368-56406390 TGACACCTATATCAAAGGACAGG + Intergenic
994551908 5:101244944-101244966 TGGCAACTATATGAAAGAAAGGG + Intergenic
995892965 5:116977322-116977344 TGACACCTATTTGAGAAAACTGG + Intergenic
995919963 5:117299911-117299933 TGACACTTATTTGAAGGAAGGGG - Intergenic
998095999 5:139395755-139395777 TGGGACCTATTGGAAGGAGCTGG + Intergenic
1003727722 6:8784472-8784494 AGGAAGCTATTTGAAAGAGCAGG - Intergenic
1005733142 6:28718352-28718374 TGGAACCTATTTGAATGAGAAGG + Intergenic
1007070529 6:39034497-39034519 TGGCAGCTATTTATAAGCACAGG - Intergenic
1007941325 6:45784228-45784250 TTGTATGTATTTGAAAGAACAGG + Intergenic
1008359996 6:50605954-50605976 TTTCACCTAATTGACAGAACTGG + Intergenic
1008741769 6:54616972-54616994 TGGCAGGAATTTGAAGGAACTGG + Intergenic
1008772297 6:54992978-54993000 TGGCACTTACATGTAAGAACTGG - Intergenic
1010688649 6:78881595-78881617 TGTCACTCATTTGTAAGAACTGG - Intronic
1012367144 6:98455519-98455541 TAGCACCTTGTTGAAAGAATAGG + Intergenic
1013059715 6:106621354-106621376 TGGCAAATATCTGAAATAACTGG - Intronic
1013392476 6:109700529-109700551 TGGGAAGTATTTGAAAGAAATGG + Intronic
1013545499 6:111153089-111153111 TGGAACATGTTTGAAAGAGCTGG + Intronic
1015618332 6:135103105-135103127 TGACACCCACTTCAAAGAACAGG - Intergenic
1017344903 6:153369530-153369552 TGGGACCTATTTTAAAAAGCAGG - Intergenic
1023006980 7:35881355-35881377 TGTGACCAATTTGAAAGAAGAGG - Intronic
1024724989 7:52183823-52183845 TGGCATCTTTATCAAAGAACAGG + Intergenic
1024752215 7:52480239-52480261 TGGCATGTATATGAAAGAACAGG - Intergenic
1027876078 7:83770441-83770463 TGGCACATATTTGAAAAATTTGG + Intergenic
1028725231 7:94079234-94079256 TGGCACAATTTTGATAGAACAGG - Intergenic
1034145316 7:148865916-148865938 TGGTACTTCCTTGAAAGAACTGG - Intronic
1043187963 8:77179092-77179114 TAGCACCTATTTTGAAGAAAAGG - Intergenic
1050741730 9:8827845-8827867 TAGGACCTATTGAAAAGAACAGG + Intronic
1051410582 9:16785930-16785952 GTGCACCTATTTAGAAGAACTGG + Intronic
1052744251 9:32424295-32424317 TGCCACCTCTCAGAAAGAACAGG - Intronic
1054255848 9:62811768-62811790 TGGCACCTATTTGAATTGTCAGG - Intergenic
1056466192 9:86857805-86857827 TAGCTTGTATTTGAAAGAACTGG - Intergenic
1057942728 9:99298995-99299017 CGGCTCCTTTTTGAAAGAACAGG + Intergenic
1061110566 9:128566878-128566900 CAGCATCTCTTTGAAAGAACTGG - Exonic
1190989518 X:55531835-55531857 TGGCAAGGATTTGAAGGAACTGG - Intergenic
1192256646 X:69466510-69466532 TGCCAGCTATTTGAATGCACTGG - Intergenic
1194004920 X:88478934-88478956 TGGCACATATTTTACTGAACAGG + Intergenic
1194122726 X:89979731-89979753 TGGCAAATATTTTAAAGATCTGG - Intergenic
1194848756 X:98845992-98846014 TGTCAGCTGTTTGAAATAACTGG - Intergenic
1196029598 X:111082251-111082273 TGACAACTATTAGAAATAACTGG + Intronic
1198964502 X:142213914-142213936 TTACAGATATTTGAAAGAACTGG + Intergenic
1200475584 Y:3637169-3637191 TGGCAAATATTTTAAAGATCTGG - Intergenic