ID: 1118695754

View in Genome Browser
Species Human (GRCh38)
Location 14:68383469-68383491
Sequence AACACAGATGTACACACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118695752_1118695754 -10 Left 1118695752 14:68383456-68383478 CCATGTGGTATATAACACAGATG 0: 1
1: 0
2: 2
3: 11
4: 140
Right 1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 209
1118695748_1118695754 21 Left 1118695748 14:68383425-68383447 CCCAAAGTGACAGGGTGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 175
Right 1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 209
1118695750_1118695754 20 Left 1118695750 14:68383426-68383448 CCAAAGTGACAGGGTGCTGAGGT 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 209
1118695747_1118695754 25 Left 1118695747 14:68383421-68383443 CCAGCCCAAAGTGACAGGGTGCT 0: 1
1: 0
2: 2
3: 8
4: 150
Right 1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG 0: 1
1: 0
2: 1
3: 22
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118695754 Original CRISPR AACACAGATGTACACACTGG AGG Intronic
901466741 1:9426562-9426584 AAAACAGTTGTGCACACAGGCGG - Intergenic
903192532 1:21664824-21664846 AACACAGAGAGACACACTGAAGG - Intronic
903348812 1:22705388-22705410 AGCACAGATATAGACACTGACGG - Intergenic
904581643 1:31548315-31548337 ACCACAGAGGTACACACTGAGGG - Intergenic
905910356 1:41649261-41649283 AACACATGTGGAAACACTGGAGG + Intronic
906822769 1:48946732-48946754 AACACAGACTTACAAACTGACGG + Intronic
907398234 1:54207376-54207398 AACACAGGTGTTCTAACTGGTGG + Intronic
911503345 1:98716402-98716424 AAGACTAATGTCCACACTGGTGG - Intronic
911929086 1:103878196-103878218 AAAACAGATGTATAAACTGATGG + Intergenic
914725922 1:150327647-150327669 AAAGCAAATGTACACACCGGTGG - Intronic
916507379 1:165440276-165440298 TATACAGATGTAAAAACTGGGGG - Intronic
923966353 1:239144051-239144073 TACACACATGTACATACTGCAGG + Intergenic
924215130 1:241813148-241813170 ATAACAAATGTACACTCTGGTGG - Intergenic
1064287856 10:14008146-14008168 CACACAGCTGTACACCATGGTGG - Intronic
1065462101 10:25979479-25979501 AACACAGAAGTACACTTGGGAGG - Intronic
1066163722 10:32762657-32762679 AAAACAGATGTACAAACTGATGG + Intronic
1066471584 10:35702864-35702886 GACACAGATTTGCACACTGATGG - Intergenic
1067733343 10:48829957-48829979 AACACAGAGGTACATACTTTGGG + Intronic
1069277415 10:66610050-66610072 AACACAGATGGACACATAGAGGG + Intronic
1072234406 10:93440607-93440629 GACACAGCTCTAGACACTGGGGG - Intronic
1076596945 10:131629263-131629285 AACACACAAGCACACCCTGGGGG + Intergenic
1076753523 10:132555598-132555620 AACTCAAATGCACACACTTGGGG + Intronic
1077798123 11:5512354-5512376 AACACAGATGTAGCCACTGCTGG + Intronic
1078503436 11:11908142-11908164 CACGCACATGTACACACTGATGG + Intronic
1079980352 11:27144642-27144664 AACACAAATGAACATAATGGAGG + Intergenic
1080184814 11:29469689-29469711 AACACAGACACACAGACTGGTGG + Intergenic
1083957756 11:65995261-65995283 CACAAAGATGGACACACAGGTGG + Intergenic
1085413274 11:76304285-76304307 AACACAGATGTAACCAGTGGGGG - Intergenic
1086130721 11:83399548-83399570 AACACAGATTTAGTCACTAGTGG + Intergenic
1087241294 11:95784239-95784261 AAAACACATGGACACACTGAGGG + Intronic
1087523227 11:99271011-99271033 AACACAGCTCTACACTCTGAAGG - Intronic
1088771146 11:113037063-113037085 AACTCAGATATAAAGACTGGAGG - Intronic
1088852588 11:113717223-113717245 AAAACAGATATACAGACTGATGG + Intergenic
1089198731 11:116710719-116710741 CATACAAATGTGCACACTGGAGG + Intergenic
1089664600 11:120010178-120010200 GACATATCTGTACACACTGGAGG + Intergenic
1089779034 11:120860169-120860191 CACACAGATCCACACCCTGGGGG - Intronic
1090486465 11:127116830-127116852 CACACACATGCACACACGGGTGG + Intergenic
1091269198 11:134293701-134293723 AGGACAGATGTACTCCCTGGAGG - Intronic
1091650437 12:2305135-2305157 CACACAGATGCACACACTGCAGG + Intronic
1092076718 12:5680088-5680110 AGAACACATGGACACACTGGGGG + Intronic
1092979129 12:13776227-13776249 AGAACACATGGACACACTGGGGG + Intronic
1095914654 12:47465130-47465152 AAAACAGATATACAAACTGATGG - Intergenic
1099291321 12:80779823-80779845 AACACAGATGAACACAATGTGGG + Intergenic
1099428402 12:82552625-82552647 AACAGAGATTTACAAACTGCTGG - Intergenic
1099513541 12:83567838-83567860 AACACAGTACTACAAACTGGTGG - Intergenic
1100208904 12:92380879-92380901 AATACAGATGGAGACACTTGGGG - Intergenic
1103559872 12:121788035-121788057 AACACAGTGGTACACACCTGCGG - Intronic
1103687445 12:122743224-122743246 AACACAGAGGCAGATACTGGAGG - Intergenic
1106074361 13:26444805-26444827 AACACAGATTTACTGACTGATGG - Intergenic
1106782358 13:33071487-33071509 AGAACACATGGACACACTGGGGG - Intergenic
1107399379 13:40054308-40054330 CACACACATGTACACACTTTGGG + Intergenic
1113592209 13:111508925-111508947 ACCACAGATAGACACACTGAAGG - Intergenic
1113734167 13:112665233-112665255 AACTCAGCAGTAGACACTGGAGG - Intronic
1113935285 13:113990687-113990709 ACCACACATGTACACACTCATGG - Intronic
1116162229 14:41282884-41282906 AACACACATACACACACTGGGGG + Intergenic
1118695754 14:68383469-68383491 AACACAGATGTACACACTGGAGG + Intronic
1120247358 14:82022897-82022919 TACACAGAAGTATACACTAGAGG + Intergenic
1121489970 14:94350909-94350931 AAGGCAGATGAACAAACTGGAGG - Intergenic
1122116653 14:99530971-99530993 AACAGAGTTGCACAGACTGGGGG - Intronic
1122244276 14:100390726-100390748 GGCACAGATCTGCACACTGGTGG - Intronic
1126213925 15:46132534-46132556 AACACACATGCACACATAGGCGG - Intergenic
1128239567 15:66092735-66092757 AACACAGTTGCACTCACTGGTGG + Intronic
1128438136 15:67676117-67676139 AACACTCATCCACACACTGGGGG - Intronic
1128914716 15:71549340-71549362 CACACACATGCACACACTAGGGG - Intronic
1129432121 15:75506947-75506969 AACACAGAGATACACATAGGAGG - Intronic
1130433727 15:83875026-83875048 GACCCAGATGAACACAGTGGTGG - Intronic
1131207851 15:90466608-90466630 AACACAGCTGTCCACAAGGGGGG - Intronic
1131937973 15:97528151-97528173 AACACAGTTGAACAAAGTGGCGG + Intergenic
1132042155 15:98534551-98534573 AGCACAGATGAACATACAGGTGG + Intergenic
1133004340 16:2869991-2870013 GACTGTGATGTACACACTGGGGG + Intergenic
1136459139 16:30398929-30398951 AACACAGGCGTACACACACGGGG + Exonic
1137440299 16:48492995-48493017 CACCCAGATGTTCACAATGGTGG + Intergenic
1140537756 16:75726316-75726338 AACACAGAGGTACAGATTGTTGG - Intronic
1141126534 16:81404560-81404582 AACACACACGTACACCCTGATGG + Intergenic
1142128530 16:88421936-88421958 AACACAAATGTAAAGACTTGTGG + Intergenic
1144304204 17:13952497-13952519 AACACAGCTCAATACACTGGGGG - Intergenic
1146685424 17:34838307-34838329 AACAAAGACCTACAGACTGGGGG - Intergenic
1146806366 17:35868203-35868225 AAGATAGATGTAGACACAGGTGG + Intronic
1151231945 17:72691134-72691156 AACACAGATGCTGACTCTGGAGG + Intronic
1152317414 17:79589162-79589184 AACACAGGACTGCACACTGGCGG + Intergenic
1152747353 17:82047503-82047525 CACACAGACGCACACACGGGTGG + Intergenic
1152890714 17:82880305-82880327 AACACAGTGGTACACACCAGCGG - Intronic
1155062796 18:22243436-22243458 CACAGAGATGTAGCCACTGGTGG - Intergenic
1155305428 18:24473514-24473536 ACAACAGATGTAAAGACTGGAGG - Intronic
1155640163 18:28004156-28004178 AACAAGGAAGTACACACTGAAGG - Intronic
1159319451 18:66828431-66828453 AAAACAGATACACAGACTGGTGG - Intergenic
1160097334 18:75886895-75886917 AACACAGATGTACAAGCAGCTGG - Intergenic
1160686951 19:441350-441372 GCCACAGATGCACACACTGCTGG + Intronic
1161773923 19:6247176-6247198 AACACAGATGTAAAGGGTGGGGG + Intronic
1164683079 19:30149019-30149041 CACACACATGTGCACACAGGCGG + Intergenic
1165750321 19:38255706-38255728 GACACAGATGTGCACAGTGAAGG - Intronic
1166126922 19:40720507-40720529 GGAACAGATCTACACACTGGAGG - Intronic
1167643420 19:50694124-50694146 CACACAGATGGACACAGTTGGGG + Intronic
925045555 2:770803-770825 AGCACAGATGTACACTGTGCAGG - Intergenic
925135660 2:1523870-1523892 AAGCAAGTTGTACACACTGGGGG - Intronic
927989765 2:27439702-27439724 TATAAAGATGAACACACTGGGGG + Intronic
928473862 2:31603845-31603867 AGAACACATGGACACACTGGAGG + Intergenic
929214197 2:39393231-39393253 CACAAAAATGTACAAACTGGTGG + Intronic
929282786 2:40100604-40100626 AATGAAGATGTACACAATGGTGG + Intronic
929823064 2:45289081-45289103 AATCCAGATGTTCACACTGCTGG - Intergenic
930475906 2:51881764-51881786 AACACACATGAACTCAGTGGAGG - Intergenic
930682899 2:54276385-54276407 AACACTTATTTACACACTGGGGG + Intronic
932145557 2:69313001-69313023 ACCACAGAGGTAGAAACTGGAGG - Intergenic
932195685 2:69781089-69781111 CACACAGATGCACACACAGAGGG + Intronic
933207418 2:79523003-79523025 AACTCAGATATACTCACGGGGGG - Intronic
934084375 2:88497761-88497783 AACACAGAAGTGCATCCTGGAGG + Intergenic
935185425 2:100727498-100727520 AGAACACAGGTACACACTGGGGG - Intergenic
936651842 2:114436683-114436705 CACACAGAAATAAACACTGGAGG - Intergenic
937038174 2:118799548-118799570 AACACCGCTGAACAAACTGGTGG - Intergenic
937069770 2:119054157-119054179 CAGACAGATGCACTCACTGGTGG - Intergenic
938758029 2:134398394-134398416 CTCACAGATGTTCACCCTGGAGG + Intronic
938951832 2:136261775-136261797 AAAACAGATATACAGACTGATGG - Intergenic
939614551 2:144347931-144347953 CACACAGAAACACACACTGGTGG - Intergenic
939779000 2:146421806-146421828 AACACAGAAGTTCACTCTTGTGG + Intergenic
940164323 2:150752544-150752566 AACACAGATGGAAAAACTGTAGG - Intergenic
940262177 2:151792528-151792550 AGCATAGATGGACACATTGGTGG + Intronic
941676057 2:168344618-168344640 AACACAAATGCACAAATTGGTGG + Intergenic
943606629 2:189984266-189984288 AAGACACAGGTACACCCTGGGGG + Intronic
944346720 2:198675348-198675370 AAGACACATGTACTCACTGTTGG - Intergenic
946467189 2:219922418-219922440 AACACAGCTGAACACACCTGGGG - Intergenic
948318954 2:237053680-237053702 CACACACATACACACACTGGAGG + Intergenic
948914752 2:241028632-241028654 AAGACAGATATACAGACTGATGG - Intronic
1168967641 20:1908595-1908617 CACACACATGTACACATGGGTGG - Intronic
1169675883 20:8154345-8154367 AATACAGAAGTTCTCACTGGTGG + Intronic
1169718514 20:8646373-8646395 AACACAGATGTGCAGCTTGGAGG - Intronic
1170062299 20:12271967-12271989 AGAACACATGGACACACTGGGGG - Intergenic
1170284601 20:14692392-14692414 AACACAGATGTCATCACTAGTGG - Intronic
1170420961 20:16192874-16192896 AAGACAGAGGTAAACAGTGGCGG + Intergenic
1170789989 20:19499900-19499922 CACACAAATGCACAAACTGGAGG - Intronic
1171055446 20:21902361-21902383 CACACAGAAATAAACACTGGAGG - Intergenic
1172217012 20:33242834-33242856 CACACACATGCACACATTGGTGG + Intronic
1173016490 20:39230499-39230521 ACTACAGATGAACACTCTGGTGG - Intergenic
1178927834 21:36790907-36790929 AACACAGATGGACAAAATGGTGG - Intronic
1181666964 22:24405070-24405092 AAAACAAATCCACACACTGGTGG + Intronic
1182417622 22:30231574-30231596 AACACACTTGCACACACTCGCGG - Intergenic
1183358665 22:37372299-37372321 ATCACAGCTGCACACTCTGGGGG + Exonic
1184116524 22:42425890-42425912 ATCACAGATGAACACCTTGGGGG + Intronic
1184896169 22:47408124-47408146 AGCACAGCTGTCCACACTGCAGG - Intergenic
1185147422 22:49146925-49146947 AACACAGATGTTAGCACTGTGGG - Intergenic
1185413682 22:50698452-50698474 CACACAGATGGACACACTCGGGG - Intergenic
949739424 3:7213557-7213579 GACACAGATGTATATACAGGAGG + Intronic
949948702 3:9211466-9211488 AACACTGAGGTTAACACTGGGGG - Intronic
950129124 3:10529839-10529861 GACACAGAGGCACTCACTGGGGG + Intronic
950650364 3:14403217-14403239 AACACACATGTGCACGCTGCTGG - Intronic
951697305 3:25459004-25459026 AACACAGATGTATACAATGCAGG + Intronic
952001967 3:28796440-28796462 AATACAGATGTACACTCAGAAGG + Intergenic
956906327 3:73769509-73769531 AAAACACATGGACACACTGAGGG - Intergenic
958975603 3:100665034-100665056 AACACAGAAGTTCACATTAGTGG + Intronic
959047945 3:101495701-101495723 AGAACAGATGGACACAATGGGGG + Intronic
959272481 3:104230634-104230656 AAGATAGATGAACACACTTGTGG - Intergenic
961131680 3:124474053-124474075 GGCACAGATATCCACACTGGTGG + Intronic
961383239 3:126509407-126509429 GACACGGATGCAAACACTGGGGG + Intronic
963965138 3:151359812-151359834 ACCACAGCTGTAAACACTTGTGG - Intronic
965973078 3:174587289-174587311 AACATACATGTGCACACTGATGG + Intronic
968192643 3:196681381-196681403 GACACAGATGTACACCCCTGTGG - Intronic
970133752 4:12899280-12899302 AACACACATGTACATACAGTCGG + Intergenic
970545123 4:17121631-17121653 ATAACAAATGTACACTCTGGTGG + Intergenic
973159599 4:46999177-46999199 CACAAAGATGTAAATACTGGAGG + Intronic
975842114 4:78486107-78486129 GCCACAGATGCACACACAGGAGG - Intronic
976085419 4:81402811-81402833 ACCACAGAGTTACACACTGGTGG - Intergenic
976455616 4:85243972-85243994 AGAACAGAGGTACACACTGTTGG - Intergenic
976879012 4:89895440-89895462 AACACAGTTGGAGGCACTGGAGG + Exonic
980176444 4:129351520-129351542 CACACAGATGGAAACACTGGCGG - Intergenic
983287612 4:165759998-165760020 ATCACAGAGGTACAGACTGCAGG + Intergenic
985691918 5:1318166-1318188 AAGACAGATGTTCACACGTGGGG + Exonic
987223303 5:15813219-15813241 AAAACAGATATACAGACTGATGG + Intronic
990767408 5:59201986-59202008 TACACAGATATACAAACAGGTGG - Intronic
994849073 5:105030276-105030298 CACACACATGTGCACACAGGTGG - Intergenic
995957400 5:117794606-117794628 AAGCCAGATGTACACACAGAGGG + Intergenic
996327495 5:122291954-122291976 AGCACAGATGTATCAACTGGTGG - Intergenic
997935016 5:138102892-138102914 AACACAGAAGTAAACAGAGGTGG - Intergenic
1001346455 5:170903947-170903969 AACACCTCTATACACACTGGCGG + Intronic
1001938392 5:175723532-175723554 AACACAGATATGCAAACTGCAGG + Intergenic
1002445306 5:179286875-179286897 AGGACAGAAGTACACACAGGGGG - Intronic
1003023688 6:2534415-2534437 CACAGAGATGTGCACACAGGAGG - Intergenic
1003128525 6:3375645-3375667 AACACAGATATACACATTAGAGG - Intronic
1004163672 6:13236604-13236626 AACACAGAGATACACACAGAGGG - Intronic
1004256041 6:14065500-14065522 CACACAGATATACACACAGAGGG - Intergenic
1004458012 6:15809773-15809795 AACACAGAGATACTCACTGGAGG + Intergenic
1004648523 6:17586092-17586114 AGCACAGGTGCACACATTGGGGG + Intergenic
1005777381 6:29149928-29149950 AACAAACATGTATACACTGTTGG - Intergenic
1005968946 6:30746072-30746094 AACACACATGTACACAGTAAAGG + Intergenic
1008293539 6:49749469-49749491 AACACACATGTACAGTTTGGAGG - Intergenic
1012506686 6:99954764-99954786 ACCACAGATGTCCACATGGGTGG + Intronic
1013177594 6:107690681-107690703 CACAGAGATGTTCTCACTGGGGG + Intergenic
1013819357 6:114136019-114136041 AACACAGACGGACACACAGTGGG + Intronic
1015233908 6:130949243-130949265 AACACAAATGCACACACTTTTGG + Intronic
1018952298 6:168387166-168387188 AACACACATGTATACACACGTGG - Intergenic
1024412871 7:49067053-49067075 AAAACAGAGGCACACACGGGTGG - Intergenic
1025933200 7:66012837-66012859 CACAAAGATGAACACAGTGGAGG - Intergenic
1026649948 7:72208317-72208339 TACACAAATTTTCACACTGGTGG + Intronic
1027840616 7:83306179-83306201 AAAACAGATTTGCACACTGTGGG - Intergenic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1033903993 7:146178588-146178610 CACACAGAATTGCACACTGGAGG - Intronic
1034746886 7:153530638-153530660 TACACAGATGGACTCACAGGTGG - Intergenic
1035390320 7:158499829-158499851 CACACACATACACACACTGGAGG - Intronic
1035738688 8:1908703-1908725 AACACATATGTACAGTCTAGTGG - Intronic
1036283255 8:7419153-7419175 AACACAGATGAAGAGACTGGGGG + Intergenic
1036338215 8:7892368-7892390 AACACAAATGGAGAGACTGGGGG - Intergenic
1039851961 8:41376383-41376405 ATCACAGAAGAATACACTGGAGG + Intergenic
1040484442 8:47856643-47856665 CACACACATGTCTACACTGGTGG + Intronic
1040781401 8:51114131-51114153 AACACAGACCTACTCACTGCAGG + Intergenic
1042585818 8:70336904-70336926 AACACAGGTGTCCACTCTGGAGG + Intronic
1043503429 8:80878426-80878448 AACAAATTTGTACCCACTGGTGG + Intergenic
1044027116 8:87186558-87186580 AAGACAGTTGTATACACTGCTGG + Intronic
1044043863 8:87404651-87404673 AACACAGATGTATACACTGTGGG - Intronic
1046036019 8:108842698-108842720 AACACAGATGGACCAACTGGTGG - Intergenic
1047854958 8:128899303-128899325 TACACACATGTACACACTTGGGG + Intergenic
1051046020 9:12874570-12874592 AAGACAGATGTACACACCAATGG + Intergenic
1051603839 9:18900725-18900747 AGAACACATGGACACACTGGGGG + Intronic
1052369892 9:27652085-27652107 ATCACTGATGTACCTACTGGTGG - Intergenic
1054880954 9:70144176-70144198 AACACACATACACACACTAGTGG + Intronic
1056117011 9:83450492-83450514 AAAACAGATGTAAAAACTGAGGG - Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057583326 9:96307095-96307117 AACTCAGATGCTCACAGTGGTGG + Intergenic
1058289692 9:103223754-103223776 AACACACATGGACACACAGAGGG + Intergenic
1060415917 9:123430624-123430646 AGAACACATGGACACACTGGGGG + Intronic
1185847092 X:3447815-3447837 CACACAGGTGTACACACTCAGGG - Intergenic
1186380907 X:9057913-9057935 AACACACATGCACACTCTGGAGG - Intronic
1186468976 X:9806646-9806668 CACACATATATATACACTGGAGG - Intronic
1186918687 X:14252499-14252521 CACACACACGTACACACTGGAGG + Intergenic
1187689653 X:21852461-21852483 TACACAGATGTGCACAATAGTGG + Intronic
1188219379 X:27522325-27522347 CATACAAAAGTACACACTGGGGG - Intergenic
1188398346 X:29714195-29714217 AATACAGATGAAAACAGTGGGGG - Intronic
1188571361 X:31588945-31588967 AGCCCAGTTGAACACACTGGTGG - Intronic
1190910955 X:54772299-54772321 AACACACATGTACACAAAGAAGG + Intronic
1191712112 X:64161026-64161048 AACATAGATGTATTCCCTGGTGG - Intergenic
1192470623 X:71395751-71395773 AACATAGATGACCACATTGGTGG - Intronic
1194622899 X:96195566-96195588 AATACTGATGGAAACACTGGTGG - Intergenic
1196561991 X:117160515-117160537 CACACACATATACACACAGGTGG + Intergenic
1196561994 X:117160564-117160586 CACACACATATACACACAGGTGG + Intergenic
1198799292 X:140432807-140432829 AACACACAGGTGCACATTGGTGG + Intergenic
1199068212 X:143445121-143445143 AAAACACATGTACACATGGGGGG - Intergenic