ID: 1118696857

View in Genome Browser
Species Human (GRCh38)
Location 14:68394261-68394283
Sequence AGCCCAGCAGCCCCTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 481}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118696857_1118696859 -7 Left 1118696857 14:68394261-68394283 CCATCTGCAGGGGCTGCTGGGCT 0: 1
1: 0
2: 6
3: 70
4: 481
Right 1118696859 14:68394277-68394299 CTGGGCTTTTCCCTCCAGGAAGG 0: 1
1: 0
2: 0
3: 26
4: 259
1118696857_1118696866 17 Left 1118696857 14:68394261-68394283 CCATCTGCAGGGGCTGCTGGGCT 0: 1
1: 0
2: 6
3: 70
4: 481
Right 1118696866 14:68394301-68394323 CGGGCTCGCCAGCTGGCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1118696857_1118696865 10 Left 1118696857 14:68394261-68394283 CCATCTGCAGGGGCTGCTGGGCT 0: 1
1: 0
2: 6
3: 70
4: 481
Right 1118696865 14:68394294-68394316 GGAAGGACGGGCTCGCCAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 117
1118696857_1118696861 -2 Left 1118696857 14:68394261-68394283 CCATCTGCAGGGGCTGCTGGGCT 0: 1
1: 0
2: 6
3: 70
4: 481
Right 1118696861 14:68394282-68394304 CTTTTCCCTCCAGGAAGGACGGG 0: 1
1: 0
2: 4
3: 37
4: 272
1118696857_1118696860 -3 Left 1118696857 14:68394261-68394283 CCATCTGCAGGGGCTGCTGGGCT 0: 1
1: 0
2: 6
3: 70
4: 481
Right 1118696860 14:68394281-68394303 GCTTTTCCCTCCAGGAAGGACGG 0: 1
1: 0
2: 2
3: 25
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118696857 Original CRISPR AGCCCAGCAGCCCCTGCAGA TGG (reversed) Intronic
900002901 1:24760-24782 TGCCCTGCAGTACCTGCAGAAGG - Intergenic
900022621 1:195285-195307 TGCCCTGCAGTACCTGCAGAAGG - Intergenic
900081571 1:862502-862524 AGCCCCTCAGCCACCGCAGAGGG - Intergenic
900158149 1:1211779-1211801 GGCCCAGCAGCCCCAGCACCAGG + Exonic
900389369 1:2427372-2427394 AGCTCAGCCGCCCCTGCTGGTGG + Intronic
900719920 1:4168980-4169002 ATCCCAGCAGCCCCAGGAGGTGG - Intergenic
900811312 1:4803360-4803382 AGCCCAGCATCCCCAGCTGCAGG - Intergenic
900922776 1:5684255-5684277 AGCCCAGAGAACCCTGCAGATGG + Intergenic
900963290 1:5939629-5939651 GGCCCAGCATCCACTGCAGTGGG + Intronic
901082397 1:6591085-6591107 AGCCCAGAACCCACAGCAGAGGG + Exonic
901166419 1:7224863-7224885 AGGGCAGCAGCCCATGCAGGTGG - Intronic
901377436 1:8849327-8849349 AGCTGAGCTGCACCTGCAGAAGG + Intergenic
901654240 1:10760223-10760245 AGCAGAGCAGCCTCTGGAGATGG + Intronic
901882616 1:12203069-12203091 AGGCCAGCAGACCCTGTACAGGG - Intronic
901988107 1:13091880-13091902 CTCCCAGCAGACCCTGCACAGGG - Intergenic
901988249 1:13092477-13092499 CTCCCAGCAGACCCTGCACAGGG - Intergenic
901993563 1:13134290-13134312 CTCCCAGCAGACCCTGCACAGGG + Intergenic
901993705 1:13134887-13134909 CTCCCAGCAGACCCTGCACAGGG + Intergenic
902234292 1:15047829-15047851 CACTCAGCAGCCCCTGCAGCTGG + Intronic
902720675 1:18302120-18302142 GGCCAGGCAGCCCCTGAAGAAGG - Intronic
902872838 1:19324744-19324766 TGACCAGCTGCCCCTGCAGGTGG + Exonic
902875199 1:19336808-19336830 AGCCTAGCAGCCTCTGCTGCAGG + Intergenic
903175061 1:21575767-21575789 AGCCAAGCAGGCCCTGCATGAGG + Exonic
903672285 1:25043486-25043508 ATGGCAGCAGCCCCTCCAGATGG + Intergenic
904330556 1:29755549-29755571 TGCCCTGCAGCCCCTGCTGGGGG - Intergenic
905387054 1:37612353-37612375 ATCCCAGCAGCTTCTCCAGAAGG + Exonic
906699494 1:47847628-47847650 CGCCCTGCAGCCCTTGCACATGG + Intronic
907246190 1:53110564-53110586 AGCCCCGCAGCCCCTGAGTAAGG + Intronic
908128061 1:61050238-61050260 GGCCCGCCAGCCCCTGGAGAGGG - Intronic
908809061 1:67960309-67960331 AGCAGAGCATCCCCAGCAGAGGG - Intergenic
912548068 1:110465533-110465555 CCCCCAGCAGCTCCTGCAGTGGG - Intergenic
915096905 1:153469552-153469574 ATACCTGGAGCCCCTGCAGATGG + Intergenic
916442583 1:164842116-164842138 AGCCCTGCAGCCGCTGCTCAGGG + Intronic
917971007 1:180207709-180207731 TGCCCAGCACCTCCTGCAGCCGG - Intergenic
919804799 1:201375217-201375239 TGCCCAGCTGCCCCTCCAGGTGG + Intronic
919859629 1:201730893-201730915 AGGCCAGCAGGCCAGGCAGAGGG + Intronic
920010277 1:202861944-202861966 AGTTCAGCAACCACTGCAGAAGG + Intergenic
920340358 1:205271794-205271816 AGCCCCTCTGCCCCTGCAGGAGG + Exonic
920436094 1:205948038-205948060 ATGCCAGCTGCCGCTGCAGAGGG + Intergenic
920627249 1:207614105-207614127 AGCCCAGCATCACCTACAGAAGG - Intronic
920637195 1:207715020-207715042 AGCCCAGCATCACCTACAGAAGG - Intronic
920641648 1:207757575-207757597 GGCCAAGCAGTCCCTGCAAATGG + Exonic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
921871599 1:220146401-220146423 ACCCCAGCCTCCCCAGCAGATGG - Intronic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
922613009 1:226943992-226944014 ACCCCAGGAGCCAGTGCAGATGG + Intronic
922774705 1:228209287-228209309 AGCCCCCCAGACCCTGCAGTCGG + Intronic
922965837 1:229690079-229690101 AGCCCAGCAGCAGCAGCAGCAGG - Intergenic
922970461 1:229732141-229732163 AGCCCAACAGCCGCTGGAGGGGG + Intergenic
1062794482 10:333465-333487 AGCTCAGAAGCACCTGCTGAGGG - Intronic
1063663163 10:8047573-8047595 AGCCCAGCAGCCAAAGCAAAAGG - Intergenic
1064444214 10:15379244-15379266 AGCCCAGCACATCCTGCAGCAGG + Intergenic
1066112245 10:32207666-32207688 AGCCCAGCAGCCCCACCTGGTGG + Intergenic
1067297634 10:44983931-44983953 AGACCAGCAGCCCCTGGGGTAGG - Intronic
1067438907 10:46297172-46297194 AGCTCCGGAACCCCTGCAGATGG - Intronic
1067685676 10:48464993-48465015 GGCCCAGAAGCCCCAGCACAGGG - Intronic
1070556771 10:77534010-77534032 AGGCCAGCAGCCCCTGCCAAGGG + Intronic
1070722485 10:78766199-78766221 GACCCAGCAGCCTCTGCCGAGGG + Intergenic
1070779215 10:79127748-79127770 CCCCCAGCAGCTCCTGCAAAGGG - Intronic
1071568613 10:86684425-86684447 AGCCCAGGGCCCCCTGCAGAGGG - Intronic
1071633584 10:87233644-87233666 AGCCGAGCATCCCCAGCAGGGGG - Intronic
1071804542 10:89102721-89102743 AGCCTAGCAGCCACTGGAGGTGG - Intergenic
1072948158 10:99829223-99829245 AGCCTAGCAGCCACTGGAGGGGG - Intronic
1073071000 10:100793241-100793263 TCCCCACCAGCCCCTGCAGCAGG + Intronic
1073183719 10:101602496-101602518 CAGCCAGCAGCCCCTGCAGTGGG + Intronic
1073192146 10:101659177-101659199 GCCCAAGCAGCACCTGCAGAGGG + Intronic
1073453256 10:103621891-103621913 AGCCCAACAGGCTCTGCTGAGGG - Intronic
1073639918 10:105241361-105241383 AGCGCAGCAGCCCCAGGTGAGGG + Intronic
1075583924 10:123643665-123643687 AGCCCTGCAGCCCCTGCCTCAGG + Intergenic
1076046702 10:127300059-127300081 AGCCAAGCAGACCCAGCAAAGGG + Intronic
1076367789 10:129933598-129933620 AGCCCAGCAGCCTCTGCAGGCGG + Intronic
1076462988 10:130659051-130659073 AGGCCCCCAGCCCCTCCAGATGG - Intergenic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076839623 10:133039606-133039628 TGCTCAGCAGCCTCTGCACACGG - Intergenic
1076844355 10:133061709-133061731 AGCCCAGCAGCCACGGCTGTGGG - Intergenic
1077077502 11:708176-708198 AGCCCTGCAGCCCTGGCAGGAGG + Intronic
1077337260 11:2010958-2010980 TGCCCAGCATCCACTGCACATGG + Intergenic
1077354321 11:2108132-2108154 AGTCCAGCAGGACCTTCAGATGG - Intergenic
1078019409 11:7642862-7642884 AGACCTGCATCCCCTGCGGAAGG + Intronic
1078909568 11:15718301-15718323 AGCCCTGCAGCTCCTGGAGCTGG - Intergenic
1079007686 11:16803684-16803706 AGCCCATCACCCCCTGCCCAGGG + Intronic
1079128217 11:17733645-17733667 ACCCCAGCCACCCCTGGAGACGG + Intergenic
1080408743 11:32003501-32003523 AGGCCAACAGCCCCGGAAGAAGG - Intronic
1080774527 11:35373248-35373270 AGGGCAGCTGCTCCTGCAGAAGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081702401 11:45160035-45160057 AGAGCATCAGACCCTGCAGAAGG - Intronic
1083432350 11:62620612-62620634 AGCCGAGCAGCTACGGCAGAAGG - Exonic
1083437076 11:62649859-62649881 AGCACAGCAGCCCGAGCAGGTGG + Exonic
1083733073 11:64663599-64663621 AGCCCAGGAGGTCCTGCAGTGGG - Intronic
1083920495 11:65779610-65779632 AGCCCAGCAGCCACAGGAGCTGG + Exonic
1083949791 11:65947604-65947626 AGCACAGGACTCCCTGCAGAAGG + Exonic
1084089645 11:66871266-66871288 GGCCCCGCAGCTCCTGGAGAGGG - Intronic
1084101827 11:66954980-66955002 AGGCCTCCAGCCCATGCAGAAGG + Intronic
1084287690 11:68142530-68142552 AGGGCAGCAGCCCCAGGAGAGGG - Intergenic
1084463170 11:69307553-69307575 AGCCCCGCAGCCCATGTAGGTGG + Intronic
1084784766 11:71435761-71435783 AGCCCACCAGGCCCAGCAGCAGG + Exonic
1084966208 11:72746019-72746041 GGCTCAGGAGCCTCTGCAGAAGG - Intronic
1086885270 11:92198385-92198407 AGACCTGCAGGTCCTGCAGAAGG - Intergenic
1086887960 11:92225512-92225534 CTCCCAGCCGCCCCTGCAGGTGG + Intergenic
1086970275 11:93073877-93073899 AGCCCAGCAGGCCCCTAAGAGGG - Intergenic
1088971759 11:114780261-114780283 AGCCCAGCAGCTGCTGAAGCTGG - Intergenic
1089190260 11:116648546-116648568 AGGGCAGCTGCCTCTGCAGAGGG - Intergenic
1089933185 11:122335114-122335136 AGCCGAGCAGTACGTGCAGAGGG + Intergenic
1089977904 11:122748402-122748424 ATCCCAGCTGCCCCTATAGACGG + Intronic
1090030348 11:123200924-123200946 AGCCCAGCAGGCCTTCCAGGAGG + Intergenic
1090288093 11:125517470-125517492 AGCCCAGGAGATCCTGCAAAAGG + Intergenic
1090630676 11:128644479-128644501 GTCCCAGCAGTCCATGCAGAAGG + Intergenic
1090873725 11:130770443-130770465 AGGCCAGCGACCCCTGCAGAGGG + Intergenic
1090923529 11:131229920-131229942 AGTCCCACAGCCCCTTCAGAGGG + Intergenic
1202820244 11_KI270721v1_random:66140-66162 TGCCCAGCATCCACTGCACATGG + Intergenic
1091376319 12:26823-26845 TGCCCTGCAGTACCTGCAGAAGG - Intergenic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1092030102 12:5276781-5276803 AAACAAGCAGCCCCTGCAGGTGG - Intergenic
1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG + Exonic
1092727531 12:11500057-11500079 TGCCCGGCAGTGCCTGCAGAAGG + Intronic
1093253358 12:16835777-16835799 ACCCCAGCATCCCCAGCAGCTGG - Intergenic
1094828148 12:34287776-34287798 TTCCCAGGAGCCCCTGCATAGGG + Intergenic
1094828999 12:34291305-34291327 TTTCCAGCAGCCCCTGCACAGGG - Intergenic
1094829477 12:34293458-34293480 TTCCCAGCAGCCACTGCATATGG - Intergenic
1094830202 12:34296674-34296696 TTCCCAGCAGCCCCTGCATGGGG + Intergenic
1094831021 12:34300339-34300361 TTCCCAGCAGCCCCTGCGCAGGG + Intergenic
1094832507 12:34306833-34306855 ATCCCAGCATCCCCTGCGCATGG + Intergenic
1094834245 12:34314796-34314818 ATCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094835308 12:34319413-34319435 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094835456 12:34320033-34320055 TTTCCAGCAGCCCCTGCAAAGGG - Intergenic
1094836048 12:34322558-34322580 CTCCCAGCAGCCCCTGCGCAGGG - Intergenic
1094836609 12:34325064-34325086 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094836701 12:34325483-34325505 TTCCCAGCAACCCCTGCACAGGG - Intergenic
1094836753 12:34325695-34325717 TTCCCAGCAGCCCCTGCATCGGG - Intergenic
1094837679 12:34329763-34329785 ATCCCAGCAGACCCTGCAGGTGG - Intergenic
1094841700 12:34345063-34345085 AGCCCAGCAGCTCCGGCGGCGGG + Intergenic
1095098448 12:38160019-38160041 TTCCCAGCAGCCTCTGCAGTGGG + Intergenic
1095717695 12:45365630-45365652 AGCCTAGCAGCCACTGAAGGGGG - Intronic
1095954266 12:47797477-47797499 AACCCTGGAGCCCCTGGAGACGG - Exonic
1096209467 12:49752982-49753004 AACGCAGCAGCACCTGAAGAAGG + Exonic
1096317762 12:50583472-50583494 AGACAAGCAGCACCTGCAGATGG - Intronic
1096585176 12:52615227-52615249 AGCCCAGCACCCACTGCTGGGGG + Intronic
1097042766 12:56165518-56165540 GGCCCAGCAGCCCCTGTTGGGGG + Exonic
1097103312 12:56604640-56604662 GGCCCAGCCACCCCAGCAGAAGG - Exonic
1097181017 12:57171960-57171982 GGCCCTGCAGGCCGTGCAGAGGG - Intronic
1097269266 12:57764400-57764422 GTCCCAGCTGCCCCTGCTGAAGG - Exonic
1097981585 12:65741965-65741987 ACCCCAGCACCCCACGCAGACGG + Intergenic
1101436666 12:104670123-104670145 AGGCCAGCAGGCCCTGCAGCAGG - Intronic
1101642841 12:106601105-106601127 AACCCAGCAGCCCCTGGGGCAGG + Intronic
1101643217 12:106603547-106603569 AGCCCAGGAGCCTCTGCTCACGG + Intronic
1103321033 12:120093073-120093095 AGCGCTGTGGCCCCTGCAGAGGG - Exonic
1103908133 12:124337778-124337800 GGCACAGCTGCCCCTGCACAGGG + Intronic
1104390538 12:128387867-128387889 AGGCCAGCTGCCCGTGCAGGCGG + Intronic
1104951921 12:132445000-132445022 AGGCCCGGAGCCTCTGCAGAAGG + Intergenic
1106359058 13:29012962-29012984 GGCCAAGTAGCCACTGCAGAAGG + Intronic
1108542587 13:51457307-51457329 AGGGCAGCAGCCACTTCAGACGG + Intergenic
1113294173 13:108939313-108939335 ACCCCAGCAACCCTGGCAGAGGG - Intronic
1113378393 13:109783925-109783947 GGCCCCGCAGGCCCCGCAGAAGG + Exonic
1113568331 13:111334876-111334898 AGCCTGGCAGCCACTGCAGCGGG - Intronic
1113804566 13:113105871-113105893 AGCCCTGAAGCCCAAGCAGAAGG - Exonic
1113836799 13:113333291-113333313 AGCCCAGGTGCCCATGCACATGG + Intronic
1114497544 14:23143412-23143434 GGCCCAGCATGCCCTGCTGAGGG + Intronic
1114542292 14:23470032-23470054 ACTCCAGCACCCCCTACAGAAGG - Exonic
1114621470 14:24098803-24098825 AGAGCAGCAGTCCCAGCAGAGGG + Intronic
1115914068 14:38290216-38290238 ATACCAGTAACCCCTGCAGATGG - Intergenic
1117656753 14:57963423-57963445 AGCCCAGCAGCCCCTGGGGCTGG + Intronic
1118316520 14:64729332-64729354 GGCCCAGCAGCCCCTTGAGGGGG - Intronic
1118323141 14:64764945-64764967 AGCCCACCATGCCCAGCAGAGGG - Intronic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1118808815 14:69259654-69259676 CGCCCAGCCGCCCCTACACAAGG + Intronic
1119935971 14:78592900-78592922 AACAGAGCATCCCCTGCAGATGG - Intronic
1121410535 14:93745687-93745709 AACCCAGCAGACCCAGCACAGGG - Intronic
1121520842 14:94585294-94585316 AACCCAGCAGCCACAGCAGTTGG - Intronic
1122100127 14:99401971-99401993 AGGCCAGGAGCTCCTGCAGCAGG + Intronic
1122151028 14:99726339-99726361 AGCCCAGCAGCCCCAGAGCAGGG - Intronic
1122234932 14:100326086-100326108 AGGCCAGCAGGCCCTGGGGAAGG - Intronic
1122318536 14:100839738-100839760 AGCCCTGCAGACACTGCAGCAGG + Intergenic
1122337970 14:101006306-101006328 GGCCTGGCAGCCCCTGCACATGG + Intergenic
1122632437 14:103113095-103113117 AGCCCAGCTGGCCCTGAAGAGGG - Intergenic
1122724361 14:103740437-103740459 GGCCCCGCCGCCCCCGCAGATGG - Exonic
1122853366 14:104548412-104548434 GCCCCAGGAGCCGCTGCAGAGGG + Intronic
1123009529 14:105341058-105341080 AGACCTGCAGTGCCTGCAGAGGG + Intronic
1123010713 14:105348307-105348329 ACCCCAGCTGTCCCTGCACATGG - Intronic
1202868219 14_GL000225v1_random:136391-136413 AGCCAAGCCGCGCCGGCAGAGGG - Intergenic
1124388105 15:29226575-29226597 AGTCCAGCAGCCCCAGCCTAAGG + Intronic
1124473285 15:30007733-30007755 GGCCCAGCAGGTCCAGCAGATGG + Intergenic
1124666537 15:31597865-31597887 AGCCCAGCAGCCCCTCTATGGGG - Intronic
1125540095 15:40465238-40465260 AGGTCAGCAGGCCCAGCAGAGGG + Intronic
1128061456 15:64738330-64738352 AGCCCTGCAGCCATTCCAGAGGG - Intergenic
1128087722 15:64897429-64897451 GCCTCAGCTGCCCCTGCAGAAGG + Intronic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1128550845 15:68596970-68596992 AGCCCTGCTGGCCCTGCAGGAGG - Intronic
1129267224 15:74400210-74400232 GGCCCTGCAGCCCAAGCAGAGGG + Intergenic
1129325593 15:74798772-74798794 GGCCCACCTCCCCCTGCAGAGGG - Intronic
1129386355 15:75198291-75198313 CCCCCAGCCTCCCCTGCAGAAGG + Intronic
1129461116 15:75700484-75700506 CCCCCGCCAGCCCCTGCAGAAGG - Intronic
1130443576 15:83978422-83978444 AGCCCAGCAGCCCCTTCAGGAGG + Intronic
1131089836 15:89615354-89615376 AGCCCAGCAGCCTCTGGACAGGG - Intronic
1131218762 15:90562931-90562953 TGCCCAGCAGCCACTGCAAGGGG - Intronic
1131459619 15:92609137-92609159 AGCCCAGCAGCAACTGCAGGAGG - Intergenic
1132110428 15:99098743-99098765 AGTACAGCAGCCCGTGCAGCGGG - Intronic
1132232585 15:100194891-100194913 AAAGCAGCAGCCCCTGCACATGG - Intronic
1132450609 15:101966179-101966201 TGCCCTGCAGTACCTGCAGAAGG + Intergenic
1132502323 16:290061-290083 TGGCCAGCAGGCCCTTCAGAGGG + Intronic
1132631792 16:921329-921351 GACCCAGCAGCCCCTCAAGAAGG - Intronic
1132788915 16:1674099-1674121 AGCCCAGCAGCCCCAGAAGATGG + Exonic
1132933599 16:2470558-2470580 AGGCCAGCATCCCCTGCACCAGG - Intergenic
1133221231 16:4319989-4320011 GCCCCAGCAGCCCCTGCTGGGGG + Intronic
1133702488 16:8322031-8322053 GGACCAGCAACCCCTGCAGCAGG - Intergenic
1134046534 16:11104930-11104952 AGCCCAGCAGCCCAGGAACAAGG - Intronic
1134689965 16:16184740-16184762 AGACCAGTATCTCCTGCAGACGG - Intronic
1134847107 16:17449335-17449357 AGAACAGCAGCCCCTGGAGAGGG + Intronic
1135096546 16:19569277-19569299 AACTAAGCATCCCCTGCAGATGG + Intronic
1135929684 16:26726002-26726024 AGCACAGGAGCCCCAGCAGGTGG - Intergenic
1136371599 16:29840273-29840295 GGCCCTGCAGCCCCTGGAGGAGG + Exonic
1137260260 16:46821481-46821503 AGCCCAGAAATCCCTGCAGGAGG - Intronic
1137543022 16:49377688-49377710 AGCCCTGCAGCCACTGCTGTGGG - Intronic
1139286753 16:65822142-65822164 ACCACAGCATTCCCTGCAGAAGG + Intergenic
1139390535 16:66604598-66604620 GGCCCAGCATCCCCCGCAGCCGG + Intronic
1139442853 16:66977469-66977491 ACACCAGCAGGCCCTGGAGAGGG + Intergenic
1139506274 16:67399602-67399624 CACCCCGCAGCGCCTGCAGAGGG - Intronic
1140037868 16:71384873-71384895 AGCCCATCAGCCCGTCCAGAAGG + Intronic
1141435623 16:83998195-83998217 TGCCCGGCAGCACCTGCAGCTGG + Exonic
1141586440 16:85036753-85036775 AGCCCAGCACCCCCTGCCCGGGG + Intronic
1141702073 16:85647135-85647157 ACCCCTGCCGCACCTGCAGATGG + Intronic
1141725773 16:85787374-85787396 AGGACAGCGGCCCCTGCAGGGGG - Intronic
1141943687 16:87295782-87295804 AGCCCAGCAGACCTTGCCCATGG - Intronic
1141984648 16:87571923-87571945 AGCAGAGCAGCCCCAGCAGAGGG + Intergenic
1142051087 16:87958865-87958887 AGCCCAGCAGTGTTTGCAGAGGG + Intronic
1142121366 16:88388172-88388194 AACTCAGCAGCCCCGGCCGAGGG + Intergenic
1142121912 16:88390658-88390680 CCCCAAGCAGCCCCTCCAGAGGG + Intergenic
1142189293 16:88710299-88710321 AGCCCAGCAGCCCGGGCCCACGG - Intronic
1142218827 16:88842864-88842886 AGGCCAGAAGCACCTGCAGAAGG - Intronic
1142222368 16:88861799-88861821 ACCCCAGAAGCCCTTGCAGCAGG + Exonic
1142364069 16:89640491-89640513 GGAGCAGCAGCCCCTGCAGGCGG + Intergenic
1142429045 16:90016566-90016588 GCACCAGCAGCCCCTGCAGGGGG - Intronic
1142890083 17:2937529-2937551 AGGCCAGCAGCACGTGCAGGAGG + Intronic
1142933479 17:3308324-3308346 GGCCCAGCAGCCTCTGCAGAGGG - Intergenic
1143361176 17:6372518-6372540 TGCCCAGGAGTCCCTGCTGAAGG - Intergenic
1144565981 17:16359737-16359759 ACCTCAGCAGCCCCTGTAGCTGG + Intergenic
1144909363 17:18668180-18668202 GACCCACCAGCCCCTGGAGAGGG - Intronic
1144948726 17:18982769-18982791 AGCCCAGGAGCCCCTGGAGTGGG + Intronic
1144998204 17:19285546-19285568 TGCGCAGCAGCCCCTGCAGGAGG - Intronic
1145413585 17:22694670-22694692 GGCCCAGCAGCCCCTGGAGCTGG - Intergenic
1146553758 17:33805247-33805269 TGCCCAGGAACCTCTGCAGATGG + Intronic
1147043440 17:37735414-37735436 AGCCCAACACCACCTGCAGTTGG - Intronic
1147239285 17:39079968-39079990 AGCCCAGAGGCATCTGCAGAAGG - Intronic
1147945524 17:44078169-44078191 ACACCACCACCCCCTGCAGAGGG + Exonic
1148063706 17:44853573-44853595 TGCCCAGGAGCCCCTGCACCGGG - Exonic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1148216622 17:45836993-45837015 AGCCCCGCAGCTCCTGCTGAGGG + Intergenic
1148331869 17:46818282-46818304 AGTCCTCCAGCCCCTGCAGCGGG + Intronic
1148878776 17:50708869-50708891 ATCCCAGCAGCCCCAAGAGACGG - Intergenic
1149042611 17:52207988-52208010 AGCTCTGCAGCCCCAGCAGATGG + Intergenic
1149076722 17:52604314-52604336 AGCTCAGGAGCTTCTGCAGAGGG - Intergenic
1149441186 17:56675479-56675501 AGCTCAGCAGCTCCTGCACTAGG + Intergenic
1150156072 17:62854222-62854244 TGACCAACAGCCTCTGCAGAGGG - Intergenic
1150284952 17:63949333-63949355 AGGCCTGCAGCCCCTGCAAGGGG - Intronic
1150445859 17:65226480-65226502 TTCCCAACAGGCCCTGCAGAGGG + Intronic
1151424427 17:74021527-74021549 AGCCAGGCAGCCCCAGAAGAAGG + Intergenic
1151490726 17:74431166-74431188 AGGCCAGCAGCCCCGGGGGAAGG + Exonic
1151666714 17:75549497-75549519 GACCCAGCAGCCCCTGCGGAGGG + Intronic
1152067935 17:78121699-78121721 CGGCCAGCAGCTCCTGCAGGCGG + Exonic
1152078322 17:78171729-78171751 AGGCCAGCACACCCTGCAGGGGG - Exonic
1152127950 17:78458732-78458754 AGCCCTGCTGCCGCTGCAGGGGG - Intronic
1152202268 17:78954068-78954090 AAGCCAGCAGCCCCAGGAGACGG + Intergenic
1152383427 17:79954452-79954474 AGCCCAGGGGCCCCAGCAGTGGG - Intronic
1152524389 17:80879300-80879322 AGCCCAGCAGGAGCTGCAGCCGG - Intronic
1152566778 17:81103807-81103829 AGTCCAGGGGCCCCTGCTGAGGG + Intronic
1152677167 17:81647566-81647588 AGCTCAGCAGCCTCTGCGGAGGG + Intronic
1203162109 17_GL000205v2_random:62562-62584 TTCCCATCAGCCCCTGCACATGG - Intergenic
1155350077 18:24897571-24897593 AGCTCAGCAGACCCAGCTGAAGG + Intergenic
1156116917 18:33796587-33796609 ATCCCAGGAGGCCCTGCATATGG + Intergenic
1156473240 18:37390477-37390499 AGCCCTGCATGCCCAGCAGAGGG - Intronic
1157709929 18:49843220-49843242 AAGTAAGCAGCCCCTGCAGAAGG - Exonic
1157788389 18:50507325-50507347 AGCCCAGCAGCAGCTGCAGTGGG - Intergenic
1160045065 18:75379108-75379130 GGACCAGCTGCCCCTGCTGAGGG + Intergenic
1160234652 18:77076427-77076449 GGCCCAGCTGCACCTGCAGAGGG + Intronic
1160557702 18:79736654-79736676 AACTCAGCAGCCCCTGGTGATGG + Intronic
1160634652 19:66368-66390 TGCCCTGCAGTACCTGCAGAAGG - Intergenic
1161027815 19:2044760-2044782 TGCCCAGCAGGCACTGCAGATGG + Intronic
1161224389 19:3136361-3136383 AGCCCAGCCGGCCCTGGAGAGGG - Exonic
1161580422 19:5077742-5077764 ACCCCTGCAGCCCCTGCGGAGGG - Intronic
1161975621 19:7606527-7606549 TCTCCAGCAGCCCCTGCAGACGG + Exonic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1163152902 19:15425337-15425359 AGCCAAGCGGCCCCTGCAGGAGG - Exonic
1163987213 19:20964867-20964889 AGCCCACTATGCCCTGCAGATGG + Intergenic
1164472413 19:28547170-28547192 GGGCCAGCAGCCCCTGATGAGGG + Intergenic
1165079063 19:33297502-33297524 AGACCAGCAGCTCCTGGAGGAGG + Intergenic
1166942378 19:46374677-46374699 AGCGCAGCAGCCCCAGAAGGGGG + Intronic
1166943504 19:46383361-46383383 TGGGCAGCAGCCCCTGCAGCCGG + Intronic
1166959712 19:46490079-46490101 GCAGCAGCAGCCCCTGCAGAGGG - Intronic
1167220280 19:48194760-48194782 CGCCCTGCAGCCCCGGCAGCCGG - Exonic
1167254552 19:48419424-48419446 TTCCCAGCAGCCCCTGGAGGGGG + Intronic
925158065 2:1662328-1662350 CTCCCAGCAGCCTCTGCACAGGG + Intronic
925258147 2:2507296-2507318 GGCCCCTCAGCCCCTGCAGGAGG - Intergenic
925388450 2:3479641-3479663 AGCCACGCAGTCCCTGCAGCTGG + Intronic
926234880 2:11033112-11033134 AGCCTAGCAGCCACTGGAAAGGG + Intergenic
927055438 2:19361771-19361793 AGCCCGGAAGCCCGGGCAGACGG - Intergenic
927304870 2:21559533-21559555 AGCCCAGAGGCTCGTGCAGATGG + Intergenic
927499609 2:23573954-23573976 TGCCCAGCAACACCTGCAGATGG - Intronic
928122278 2:28591794-28591816 AGCATAGCAGCCCCTGTGGAGGG - Intronic
928950475 2:36808975-36808997 AGCCCAGCTTACCCTTCAGATGG - Exonic
929444286 2:41990690-41990712 ACCACAGCAGCCTTTGCAGAAGG - Intergenic
930052066 2:47224226-47224248 AGAACAGCAGCCCATGGAGATGG + Intergenic
933574992 2:84057191-84057213 GGCCAAGAAACCCCTGCAGAAGG - Intergenic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
935671771 2:105562183-105562205 AGCCCAGCATCAGCTACAGAGGG + Intergenic
936523318 2:113226137-113226159 AGCCCACCTGCCTCTGCATAGGG + Intronic
936566825 2:113588659-113588681 TGCCCTGCAGTACCTGCAGAAGG + Intergenic
937064500 2:119006925-119006947 AGCACAGCAGTCACTCCAGATGG - Intergenic
937181937 2:120004344-120004366 AGCCTGGCAGCCCCTGGAGGAGG - Intergenic
937879009 2:126851150-126851172 ACCCCAGCAGCAGCTGCCGAGGG - Intergenic
937951006 2:127387944-127387966 AGCCCGGCAGCCACTACACACGG + Intronic
938266345 2:129930867-129930889 AGCCCAGAAGCCCCAGGGGACGG + Intergenic
940247962 2:151640251-151640273 AGCTCACCAGCCCCTGGAGGAGG - Intronic
940431504 2:153596032-153596054 AGCCCAGCTGAGCCTTCAGATGG - Intergenic
941073283 2:160978870-160978892 AGCTTTGCAGCCCCTGGAGATGG - Intergenic
942605883 2:177690202-177690224 AGGTCAGCAGCCCCTGTAGTAGG - Intronic
945470489 2:210223546-210223568 AGCCCCCCAGCCCATTCAGAGGG + Intronic
946024910 2:216665829-216665851 AGCTCAGCAGTCCCTGCATGGGG + Intergenic
946334117 2:219026147-219026169 AGCTCTGCAGGACCTGCAGAGGG + Exonic
946767769 2:223056000-223056022 GGCCCAGCAGCACCTGCTAATGG + Intronic
947451165 2:230210362-230210384 CTCCCAGCAGCCCCTGCTCAAGG + Intronic
947650450 2:231781670-231781692 ATCCCAGCATCCCCTGCACTCGG + Intronic
947744359 2:232499953-232499975 ACCCCAGCACCCCCATCAGATGG - Intergenic
948024821 2:234768634-234768656 ACCCCAGCAGCCACCACAGAAGG + Intergenic
948179663 2:235969806-235969828 AGCCCGCCAGCCTCCGCAGAAGG + Intronic
948564656 2:238876217-238876239 ACCCAGGCAGCCTCTGCAGAGGG + Intronic
948728201 2:239947393-239947415 AGCCCAGCGGGGCGTGCAGAAGG - Intronic
948764795 2:240213753-240213775 AGCCCAGGTGCCCCTGCTGCAGG - Intergenic
949032127 2:241802256-241802278 AGCCCCACAGCCCCTGCCCAAGG + Intronic
1169786842 20:9368592-9368614 GGCCCAGCAGCCCACGAAGAAGG + Intronic
1169972120 20:11279301-11279323 AGCCTGGCAGCCTCTGCAAAGGG - Intergenic
1170857508 20:20070745-20070767 AGCTCAGCAGCCACTGCATGAGG - Intronic
1172947772 20:38702140-38702162 TGTCCACCAGCCCCAGCAGATGG - Intergenic
1173168981 20:40707154-40707176 AGCCCAGCTGCCTCTGCTGTGGG + Intergenic
1173883117 20:46433829-46433851 AACCCAGCAGTTCCAGCAGAAGG + Intergenic
1174164416 20:48574686-48574708 AGCTCAGCCACCCCAGCAGATGG - Intergenic
1174274037 20:49390642-49390664 CGCCCAGCCTCCCCTGCAGCTGG + Intronic
1174303133 20:49596305-49596327 AGGCCAGCAGTGCCTGCAGGGGG + Intergenic
1175391072 20:58627874-58627896 CACCCAGCAGCCCCTGGAGCCGG + Intergenic
1175493594 20:59396111-59396133 TGCCCAGCAGCAGCTGCAGGAGG + Intergenic
1175722990 20:61298540-61298562 GTACCTGCAGCCCCTGCAGACGG - Intronic
1175821219 20:61909951-61909973 AGCCCTGCAGCCACGGCAGAGGG - Intronic
1175826113 20:61937570-61937592 AGCCCTTCAGCCCCAGCAGAAGG + Exonic
1176086639 20:63298228-63298250 TGGCACGCAGCCCCTGCAGAAGG + Intronic
1176110141 20:63407375-63407397 AGCCCAGCAGCCCCTTTTGCAGG - Exonic
1176151302 20:63592475-63592497 AGCCCAGGAGTCTCTGCAGGAGG - Intronic
1176411190 21:6450409-6450431 AGCCATGCAGACCCTGCAGCTGG - Intergenic
1176868970 21:14072065-14072087 TTCCCGGCAGCCCCTGCGGAGGG - Intergenic
1178094873 21:29203859-29203881 AGCCTGGCAGCCACTGGAGAGGG - Intronic
1178417065 21:32412670-32412692 AGCCCAGGCGCCCCAGCAAAGGG - Exonic
1178600175 21:33987903-33987925 AATCCAGCAGCCTCTGCAGAGGG - Intergenic
1179036463 21:37762673-37762695 GGCCCAGCCTCCCCAGCAGAAGG - Intronic
1179130165 21:38629085-38629107 AGTCCTGCAGCCCCTGGACAAGG + Intronic
1179213552 21:39348511-39348533 AACCCACCACCCCCCGCAGAAGG + Intronic
1179686683 21:43058731-43058753 AGCCATGCAGACCCTGCAGCTGG - Intronic
1179788756 21:43743625-43743647 GCACCAGCAGACCCTGCAGAGGG - Intronic
1180061698 21:45388628-45388650 AGCCCAGGAGCCCCTCAGGAAGG + Intergenic
1180137470 21:45871009-45871031 AGCCCAGCACCCGCTGGGGAAGG + Intronic
1180160163 21:45995651-45995673 AGCCCTGGAGGCCCTGCAGCCGG - Intronic
1180514965 22:16132129-16132151 CGCCCAGCACCACCTGCAGGTGG - Intergenic
1181442070 22:22941864-22941886 AGCCCAGCACCTCCAGCAGCAGG + Intergenic
1181509262 22:23381755-23381777 AACCCTGCAGCCCCTGCCGTGGG - Intergenic
1181570628 22:23766239-23766261 TGCCCCCCAGCCCCTGCAGATGG - Exonic
1182619508 22:31611192-31611214 AGCCCAGCAGAGACTGCAGCTGG + Exonic
1183336114 22:37247568-37247590 ATCCCAGGACCACCTGCAGATGG - Intergenic
1183432480 22:37774195-37774217 AGCTCAGAAGCCCAAGCAGAGGG - Exonic
1183499575 22:38170426-38170448 CCCCCACCTGCCCCTGCAGAAGG - Intronic
1183782568 22:40008180-40008202 TGCCCAGCAGGCCCTGCCAACGG - Intronic
1183829355 22:40409681-40409703 GGCGCAGCAGCCCCTGAAGGAGG + Exonic
1183964264 22:41431901-41431923 CGCTCAACAGGCCCTGCAGAGGG + Intergenic
1184046789 22:41976961-41976983 GGCCGAGCGGCCCCTGCAAACGG - Exonic
1184556091 22:45233880-45233902 AGCCCAGCACCGCATGCAGGAGG + Intronic
1184678186 22:46054552-46054574 GGCCCCGCAGCACCTGCAGCAGG + Intronic
1184687042 22:46100931-46100953 ACCTCAGCAGCCTCTGCAGATGG + Intronic
1184709345 22:46239361-46239383 ACCTCAGCAGGCCCTGCAAAAGG + Exonic
1184850068 22:47114986-47115008 TGCCCAGCAGGCCCTGGAGGTGG - Intronic
1185072731 22:48666153-48666175 AGCTGAGCTGACCCTGCAGATGG + Intronic
1185401754 22:50622499-50622521 TGCCCAGCAGCCCCTGATGCTGG - Intergenic
950450329 3:13061623-13061645 AGCCCAGCACCCCCACCGGACGG - Intronic
950698892 3:14726405-14726427 ACCGCAGCATCCACTGCAGAGGG + Intronic
950709499 3:14804484-14804506 AGGCCAGCCGCCCCTGCTGCTGG + Intergenic
952395843 3:32919833-32919855 TTCCCAGCAGCCCCTTCAGCAGG - Intergenic
952977014 3:38705111-38705133 GTCCAAGCAGCACCTGCAGATGG - Intronic
953069215 3:39502807-39502829 CGCGCAGCAGCCCCCTCAGAGGG + Exonic
953389822 3:42527634-42527656 AGGCCAGCTTCCCCTGGAGAAGG + Intronic
953679847 3:45030903-45030925 GGAGCAGCAGGCCCTGCAGACGG + Exonic
954218043 3:49135256-49135278 GGCCCAGGAGCTCCTGAAGAAGG - Intergenic
954292462 3:49656891-49656913 AGCGCAGCAGCGTCTGCAGCTGG + Exonic
954659894 3:52221435-52221457 GGCCCAGCAGCGCCTGCTGGAGG - Exonic
954803198 3:53199315-53199337 AGGCCAGCCGCCCCAGCCGAGGG + Intergenic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
956029705 3:65024313-65024335 AGCCCATCTGCCCATGCAGCAGG - Intergenic
957916758 3:86695927-86695949 CGCTCAGCAACCCCTGCAGGGGG + Intergenic
960736773 3:120789681-120789703 ATCCCAGCATCCCCTACTGATGG - Intergenic
961033889 3:123629099-123629121 TCCCCTGCAGCCCCTGAAGAGGG + Intronic
961346872 3:126268658-126268680 AGCAGGGCAGCCCCTGCAGAGGG + Intergenic
964066626 3:152587665-152587687 TTCCCAGCAGCCCCTGTAGGAGG + Intergenic
967045849 3:185736144-185736166 AGGCCAGCAGCTCCTGCACCTGG + Intronic
967180061 3:186895834-186895856 AGCCCTGGAGTCCCTGCAGCTGG - Intergenic
967479771 3:189959713-189959735 AGACCAGCTGCACCTGCTGATGG - Intronic
967619554 3:191616438-191616460 AGCCAAGCAGCCACTGGAGGTGG + Intergenic
967986167 3:195097024-195097046 CGCCCAGCAGACCCCTCAGACGG + Intronic
968491612 4:893258-893280 AGCCCCAGATCCCCTGCAGAAGG - Intronic
968522664 4:1041087-1041109 AGCTCAGCTGCCCCTGTGGAGGG + Intergenic
968615558 4:1576016-1576038 ATCCCAGCAGCATCTGCAGCTGG + Intergenic
968897940 4:3415723-3415745 AGCCCAGCAGCAGCTGCGCAGGG - Intronic
969315933 4:6381289-6381311 TGCCCTGCAGCCAGTGCAGAGGG - Intronic
973642274 4:52915247-52915269 AGGTCAGCAGCCCCAGCTGATGG - Intronic
974345973 4:60681842-60681864 AAACAAACAGCCCCTGCAGAAGG - Intergenic
975679144 4:76858364-76858386 AGCCTAGCAGCCACTGGAGGGGG + Intergenic
976391501 4:84509383-84509405 AGCCCCGCAGACTCTGAAGAAGG + Intergenic
978879547 4:113685096-113685118 AATCCAGCAGCCTCTCCAGATGG + Intronic
979723942 4:123937788-123937810 AGCCTAGCAGACCCTGCGCATGG - Intergenic
980403610 4:132326329-132326351 AGCACAGCAGCACCTGCAGTTGG - Intergenic
981904179 4:149901974-149901996 ATGCCAGCAGCCCCTGCAAATGG + Intergenic
982078249 4:151760826-151760848 GGCTCAGCAGCCCCTCCACACGG - Exonic
983251037 4:165346784-165346806 AACCCGGCAGCCCCTGCACCTGG - Intergenic
984732224 4:183078723-183078745 ACCCCTGCAGTACCTGCAGATGG + Intergenic
985481428 5:113418-113440 GGCCCTGCAGCACCTGCAGCAGG + Intergenic
985689135 5:1297441-1297463 CTCCCAGCTGCCCCTGCAGTGGG + Intergenic
985699754 5:1363441-1363463 ACCACAGCAGCCCCTGGGGAGGG - Intergenic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
985947188 5:3194970-3194992 TCCCATGCAGCCCCTGCAGAAGG + Intergenic
986136454 5:4984029-4984051 CCCCCAGCAGCCCCAGCAGGGGG + Intergenic
986645015 5:9908254-9908276 AGCACAGCAGCCTCTGCAGAGGG - Intergenic
986922162 5:12698919-12698941 AGCACAGCTGCCGCTGCAGACGG + Intergenic
987086484 5:14474358-14474380 AGGCCAGCAGCTCCGGCAGCTGG - Intronic
987090384 5:14504349-14504371 ACCTCAGCAGCCTCTGCAAATGG + Intronic
987373744 5:17216846-17216868 AGCCCAGACGCGCCTGCAGCTGG + Intronic
988993044 5:36690141-36690163 AGCCCCGCAGCCCCTGCGGCGGG - Intergenic
991669338 5:69032198-69032220 ACAGCAGCACCCCCTGCAGATGG - Intergenic
992636986 5:78734450-78734472 AGCCAAGCCGCCCCTGCATCTGG + Intronic
992657421 5:78923956-78923978 AGCCCAGCACCCCCTGGAAAAGG - Intronic
995353131 5:111205343-111205365 AAACCAGCAGCTCCTCCAGAGGG + Intergenic
995534101 5:113118489-113118511 AGTCCAGCTGCCCCTTCAGTAGG - Intronic
996606290 5:125327531-125327553 CACCCAGCAGCCCCTGCAAGTGG - Intergenic
997626372 5:135333930-135333952 GACCCAGCAGCCTCGGCAGAGGG + Exonic
997782874 5:136677610-136677632 ATCACATCAGCCTCTGCAGAAGG + Intergenic
998430594 5:142066478-142066500 AGCCCAGCAGGACTTGCTGAGGG + Intergenic
998530571 5:142880688-142880710 TGCCCAAAAGCCCCTGCAGGTGG - Intronic
999227814 5:150041813-150041835 TGCACAGCAGCTCCTGCAGCTGG - Exonic
1000091229 5:157931310-157931332 GGCTCTGCAGCCCCTGCAGCTGG - Intergenic
1000551324 5:162668603-162668625 TGCCCAGCAGCCCCCTTAGAGGG + Intergenic
1001597443 5:172907171-172907193 TGCACAGCAGCCCCTCCAGTGGG + Intronic
1002077477 5:176717563-176717585 AGCCCATCACCCCTTGTAGAAGG + Intergenic
1002480581 5:179498227-179498249 GGCCCAGATGCCCCTGCTGATGG - Intergenic
1002563462 5:180097639-180097661 TACCCAGCAGGGCCTGCAGAGGG + Intergenic
1004427171 6:15514249-15514271 CGCCCAGCTGGCACTGCAGATGG + Intronic
1006456434 6:34134615-34134637 AACCCAGCAGCCCCTGCATGAGG + Intronic
1007108996 6:39302202-39302224 TGCCCAGCGGCCACTGCAGTTGG - Intronic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1007325827 6:41058903-41058925 AGTCCAGAAGGCCCTGCTGAGGG + Intronic
1007941082 6:45782235-45782257 TGCCCAGCAGCTCCTCCACAAGG - Intergenic
1013286009 6:108682492-108682514 GACCCACCAGCCCCTGGAGAGGG + Exonic
1013429227 6:110040995-110041017 AGCCCAGCAGGCCCCTAAGATGG - Intergenic
1013856617 6:114580982-114581004 AGCACAGAAGCCACAGCAGAAGG + Intergenic
1014724165 6:124955589-124955611 AGCCCAGTCACCCCAGCAGAAGG + Intergenic
1015732280 6:136361079-136361101 AGCCGAGCAGGCCCGGGAGAAGG - Exonic
1016939647 6:149473680-149473702 TCCCCAGCAACCCCAGCAGAGGG + Intronic
1017493314 6:154962863-154962885 ATCCCAACAGCCCCTGCCAATGG - Intronic
1017562490 6:155643609-155643631 AGCCCAACAGCCCCTGGATAGGG - Intergenic
1017873779 6:158506818-158506840 AGCCCGGCAGGCCCAGGAGAGGG + Exonic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1018095011 6:160377792-160377814 TGCTTAGCAGCCTCTGCAGAGGG - Intronic
1018624182 6:165761427-165761449 AGTCCAGCAGCCCCTCCATGCGG + Intronic
1019258096 7:64426-64448 AACCCAGCTGCCCCAGCAGAGGG + Intergenic
1019538544 7:1541172-1541194 AGCGCAGAAGCCCCTGCCCACGG + Exonic
1019599696 7:1875011-1875033 TGCCCAGCCTGCCCTGCAGAGGG - Intronic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019657460 7:2203577-2203599 ACTCCAGCAGCCCCTGTTGATGG - Intronic
1019735349 7:2647531-2647553 AGCCCAGCAGCGTCTCCAGCAGG - Exonic
1020082725 7:5295521-5295543 TGGCCTCCAGCCCCTGCAGAGGG + Intronic
1021971416 7:25968954-25968976 TGGGCAGCAGCCCCTGCTGATGG - Intergenic
1022510254 7:30930772-30930794 AGTCCAGAAGACCCTGCAGCTGG - Intergenic
1023255887 7:38311661-38311683 TGCCCCCCAGCCCCTGCAGATGG + Intergenic
1023670478 7:42571039-42571061 ATCCCAGGAGGCCCTGCAGTGGG - Intergenic
1024004679 7:45216733-45216755 TGCCCTGCATCCCCTGCAGTGGG - Intergenic
1024782249 7:52864999-52865021 AGCCCACCACCCCCAGCAGAGGG + Intergenic
1025994710 7:66520594-66520616 AGCCCAGCTGATCCAGCAGATGG - Intergenic
1026598282 7:71752501-71752523 AGCCCAGCTCACCTTGCAGACGG - Intergenic
1027219848 7:76206840-76206862 GGCACAGCAGCCTCTGCAGTGGG - Intronic
1027238843 7:76314271-76314293 AGCCCACTACCCCCTGCTGAGGG - Intergenic
1027418276 7:77995271-77995293 AGCCCAGCAGTGCAGGCAGAGGG - Intergenic
1029574656 7:101395521-101395543 TTCCCAGGAACCCCTGCAGACGG - Intronic
1030886438 7:114944244-114944266 TCCCCAGCAGCCCTTTCAGAGGG - Intronic
1032127965 7:129208523-129208545 GGCCCAGCTGCCCCTGAAGAAGG - Intronic
1032512723 7:132484745-132484767 AGCACAGAAAGCCCTGCAGATGG - Intronic
1033018996 7:137702679-137702701 AGCCTAGCAGCCACTGGAAAGGG + Intronic
1034276727 7:149827109-149827131 GACCCAGCACCCCCTGCCGAGGG + Intergenic
1034534644 7:151719352-151719374 AGCCCAGCTCCCCCAGCAGGAGG - Intronic
1035523696 8:295048-295070 AGCCCCTCAGCCACCGCAGAGGG + Intergenic
1035609247 8:949076-949098 ACCCCAGCATCCCCTCAAGACGG - Intergenic
1035851978 8:2929483-2929505 AGTCCCAGAGCCCCTGCAGATGG + Intergenic
1036077420 8:5516921-5516943 AGCTCAGCAGCCCCAGGGGAAGG - Intergenic
1036618091 8:10404249-10404271 AGCCCAGATGCCCCTGGGGAAGG - Intronic
1037459579 8:19095446-19095468 GGTCCAGCAGCTCCTGCAGATGG + Intergenic
1037772973 8:21813726-21813748 ATGCCAGCTGCCCCTGCTGATGG + Intergenic
1037994967 8:23345404-23345426 AGCCCAGCACCCCATGTCGAGGG + Intronic
1039031753 8:33317012-33317034 GGCCCAGCAGGCCCTTAAGAAGG - Intergenic
1040015515 8:42696129-42696151 AGACCACCAGCTCCTGCAGGAGG - Intergenic
1040275429 8:46011375-46011397 TTCCCAGCACCCCCTGCAGTGGG - Intergenic
1040276702 8:46017531-46017553 ATCCCAGCAGCACCTGCACAGGG - Intergenic
1040277782 8:46022729-46022751 TACCCAGCAGCCCTTGCAAAGGG - Intergenic
1040905153 8:52461422-52461444 ACTCCGGCAGCCCCTGCAGAAGG - Intergenic
1041713271 8:60911819-60911841 GAGCCAGCAGCCCCTGCAGATGG + Intergenic
1043608728 8:82035139-82035161 AGCCCAGCACCACCAGCAAAGGG - Intergenic
1044496999 8:92898308-92898330 AGCGTAGCAGCCACTGGAGAAGG - Intronic
1046766383 8:118074431-118074453 AGCTCAGCAGCCCGGACAGACGG - Intronic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1048906272 8:139092631-139092653 GCCCCAGCTGCCCCAGCAGAGGG + Intergenic
1049176436 8:141195436-141195458 AGCCCTGCAGTGCCTCCAGATGG + Exonic
1049259149 8:141629514-141629536 AGTCCAGCAGGCCCTGCAGAGGG - Intergenic
1049374083 8:142280860-142280882 AGCCCAGCAGGCCCTGTATGGGG + Intronic
1049658855 8:143810804-143810826 TGCCCAGCATCCTCTGCAGCAGG + Exonic
1049769664 8:144374022-144374044 AGCCCAGCAGGCCCTGCGGGAGG - Intronic
1049885706 9:24873-24895 TGCCCTGCAGTACCTGCAGAAGG - Intergenic
1051752652 9:20359383-20359405 AGCACAGCTGGCCCTGAAGATGG + Intronic
1051867376 9:21696708-21696730 GGCCCAGCAGCCCCAGCAGCCGG + Intergenic
1053503187 9:38620002-38620024 AGCCCGGCAGCCCCTGGGGCGGG - Intergenic
1054730035 9:68692351-68692373 AGCCCAGCACACACTGTAGATGG - Intergenic
1055667066 9:78563506-78563528 AGCCCATCATGCCCTGGAGATGG + Intergenic
1057268746 9:93635475-93635497 AGCCAAGCAGCCCCCGAGGAGGG + Intronic
1057294561 9:93827696-93827718 GGCCCAGCAGCCGGTGCAGTGGG - Intergenic
1057432298 9:95005148-95005170 TCCCCCGCAGCCGCTGCAGAGGG + Exonic
1057584560 9:96317505-96317527 AGCCCAGCAGCCCTAGGAGCTGG - Intergenic
1057978896 9:99638045-99638067 AGCCCAGCAGCCTCTGCTATGGG - Intergenic
1059182789 9:112234852-112234874 AATCCAGCAGCCCCTGCATATGG + Exonic
1059246768 9:112855846-112855868 AGCCCAACAGGCCCAGGAGAAGG - Intronic
1060157048 9:121327224-121327246 AGCCCAGGAGACCCCGCAGCAGG - Intronic
1060377304 9:123128213-123128235 AGCACAGCTGCCCCTGCCTATGG - Exonic
1061507280 9:131038529-131038551 AGCCAAGCTGCCACTCCAGAAGG + Intronic
1061509563 9:131052336-131052358 TGCACAGCAGACCCTGCAGGGGG - Intronic
1061910439 9:133719528-133719550 AGCGCATCACCCCCTGAAGAGGG - Intronic
1061954440 9:133954277-133954299 CGCCCACCAGCACCTGCTGAGGG + Intronic
1062084234 9:134640812-134640834 AGCCCTGCAGCCCTTGGGGAAGG + Intergenic
1062109307 9:134773290-134773312 AGCCCAGCAGGCCCCGCAGGAGG - Intronic
1062278783 9:135742901-135742923 AACCCAGCATCCCCTGCAGCTGG + Intronic
1062503973 9:136863436-136863458 TGGCCAGCAGCCCCTGGAGTCGG + Exonic
1203736556 Un_GL000216v2:143877-143899 AGCCAAGCCGCGCCGGCAGAGGG + Intergenic
1187988990 X:24849266-24849288 TGCCCAGCAGCGCTTGAAGAAGG + Intronic
1188597203 X:31916093-31916115 AGCCCAGGAGCGCTTGCCGAAGG + Intronic
1189955343 X:46271942-46271964 AGCCTAGCATCCACTGAAGAGGG + Intergenic
1191250553 X:58258149-58258171 TACCCAGCAGCCCCTGCGCAGGG + Intergenic
1191251626 X:58262723-58262745 ATCCCAGCAGCCCCTGCGCCGGG + Intergenic
1191251672 X:58262916-58262938 ATCCCAGCAGCCCCTGCTCCAGG + Intergenic
1191252200 X:58265073-58265095 TTCCCAGCAGCCCCTGCACCAGG + Intergenic
1191252401 X:58265825-58265847 TTCCCAGCAGCCCCTGCGCAGGG - Intergenic
1191815106 X:65235515-65235537 AGCCCAGCAGGCCCTGAGGGAGG - Intergenic
1191841131 X:65514209-65514231 AACCAAGCAGCCCTTGCTGAGGG - Intronic
1191841870 X:65519077-65519099 AGCCCCGCAGTGCCTGCAGTAGG - Intronic
1191859753 X:65656690-65656712 AGCCCCGCAGTGCCTGCAGTAGG - Intronic
1192111497 X:68369351-68369373 ACCCCAGCAACTCCTGGAGAAGG + Intronic
1192331118 X:70175925-70175947 AGCCCAGTACTCCCAGCAGAAGG - Intergenic
1194848346 X:98839383-98839405 AGCCCAGTGGCTCCTGAAGAAGG - Intergenic
1195065882 X:101237715-101237737 AGCTCAGCTGCCCCTACAGGGGG + Exonic
1196443902 X:115735597-115735619 AGCCCAGGGGTCCCTGCCGAAGG - Intergenic
1199134141 X:144231329-144231351 AGCACAGGAGCCCATGGAGAAGG + Intergenic
1200281323 X:154779326-154779348 AGCCCTGCAGCAGCTGCAGAAGG - Exonic
1201763828 Y:17562508-17562530 TGCCCAGCAGCCCCTGCACCGGG - Intergenic
1201837725 Y:18343482-18343504 TGCCCAGCAGCCCCTGCACCGGG + Intergenic