ID: 1118696922

View in Genome Browser
Species Human (GRCh38)
Location 14:68394702-68394724
Sequence CTCCCCCAGTGGGTTTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118696911_1118696922 12 Left 1118696911 14:68394667-68394689 CCTCTCCCAAGGTATCTACTTTA 0: 1
1: 0
2: 2
3: 11
4: 147
Right 1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 160
1118696913_1118696922 6 Left 1118696913 14:68394673-68394695 CCAAGGTATCTACTTTATCCCAG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 160
1118696910_1118696922 13 Left 1118696910 14:68394666-68394688 CCCTCTCCCAAGGTATCTACTTT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 160
1118696912_1118696922 7 Left 1118696912 14:68394672-68394694 CCCAAGGTATCTACTTTATCCCA 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118696922 Original CRISPR CTCCCCCAGTGGGTTTTGAG GGG Intronic
900371018 1:2332227-2332249 GTCCCCCAGTGGATGCTGAGAGG + Intronic
900960538 1:5916402-5916424 CTCTTACATTGGGTTTTGAGAGG + Intronic
902694095 1:18128711-18128733 CTCCCCTAGTGGGTTTGTGGAGG + Intronic
905755450 1:40505592-40505614 CTCCTCAAATGGGGTTTGAGGGG - Intergenic
908089751 1:60673621-60673643 CTTCACCAGAGGGCTTTGAGTGG + Intergenic
912273096 1:108229851-108229873 CTCCTCCAGTGGGGTTCGGGTGG + Intronic
912295124 1:108464471-108464493 CTCCTCCAGTGGGGTTCGGGTGG - Intronic
913321657 1:117592741-117592763 CTTCCCCAGCTGGTTTTGTGTGG + Intergenic
915242944 1:154536926-154536948 CTCCTCCAGTGGGTTCTAAAGGG - Intronic
917438519 1:175045231-175045253 CTGCCCCCGTGGGCGTTGAGTGG - Intergenic
918286756 1:183063803-183063825 CTTCCCCAGGTGGTTTTGTGAGG + Intronic
919802505 1:201362081-201362103 CACCCCCAGGGGGTTTGGGGAGG - Intronic
920890969 1:209985448-209985470 CTGCCCCTGTGGCTTTTTAGGGG + Intronic
921586440 1:216952121-216952143 CACCCCCACTGGTCTTTGAGTGG + Intronic
923812480 1:237334727-237334749 TTCCCCCACTGGGTTTTCTGTGG + Intronic
924215717 1:241819740-241819762 CTTCCACAGTGGCATTTGAGGGG + Intergenic
1064014650 10:11762825-11762847 TGGCCCCAGTGGGTTCTGAGAGG + Intronic
1065153688 10:22848541-22848563 TTCCACCAATGGGTTTTCAGTGG + Intergenic
1069719162 10:70539031-70539053 GTCCCCCAGTGGGTTTGGGGAGG + Intronic
1070459615 10:76651174-76651196 CTCCCGCAGTAGGGATTGAGAGG - Intergenic
1070572029 10:77647165-77647187 TTTCCCCAGTGGATTTTGCGTGG + Intergenic
1070762853 10:79035555-79035577 CTCCCCAAATGGGTGTTGAGTGG - Intergenic
1074658010 10:115617102-115617124 CTGCCCCAGTGGCTTTGCAGGGG - Intronic
1079292397 11:19200096-19200118 CAAACCCAGTGGGTTTTGGGGGG - Intronic
1079382895 11:19954273-19954295 CTTCCACAGTGGCTTTTTAGGGG + Intronic
1081486836 11:43537492-43537514 CTCGCCCAGTGGGTCTGCAGGGG + Intergenic
1083504330 11:63141510-63141532 ATTCCCCAGTGGGTTTTAATTGG - Intronic
1087411345 11:97793374-97793396 CTCACCCATTGTTTTTTGAGAGG + Intergenic
1087765284 11:102145290-102145312 CTCACCAATTGTGTTTTGAGTGG + Intronic
1090227245 11:125079103-125079125 CTTCCCCAGTGGGGTTTTTGGGG + Exonic
1090664283 11:128904726-128904748 AACACCCAGTGGGTGTTGAGTGG + Intronic
1091584442 12:1808118-1808140 GTGGCCCAGTGGGTTATGAGAGG + Intronic
1092195588 12:6548012-6548034 GTGTCCCAGAGGGTTTTGAGTGG - Intronic
1096759074 12:53824913-53824935 CTCCCCGTGTGTGTTCTGAGGGG - Intergenic
1097333963 12:58361580-58361602 CTCCCCCAGTGGCTTCTAAGGGG - Intergenic
1098366816 12:69712154-69712176 CTCCCCCTGTGGCTTCTGATTGG - Intergenic
1100644126 12:96511068-96511090 CTTCCCCAGTGGATCTTCAGTGG + Intronic
1102210567 12:111123845-111123867 CACCCTCTGTGGGTTTTAAGAGG - Intronic
1108432833 13:50371585-50371607 CTCCCACAGTGTGTTCTGATGGG - Intronic
1110290736 13:73803994-73804016 ACCCACCAGTGGGTTTTAAGTGG - Intronic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1115523121 14:34252773-34252795 GTAGCCCAGTGGGTTCTGAGGGG - Intronic
1116332701 14:43615491-43615513 GGCCCCAAATGGGTTTTGAGGGG - Intergenic
1118639635 14:67780307-67780329 CTCCCCCAGTGTGGTGTGACTGG - Exonic
1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG + Intronic
1118720609 14:68591138-68591160 TTTCCCCAGTGGGTTAAGAGAGG + Intronic
1119124025 14:72107487-72107509 CTCCCCCAGTTCTTTTTGATAGG + Intronic
1121329701 14:93042088-93042110 CTCCTGCAGTGGGTGTTGTGAGG - Intronic
1124713407 15:32033259-32033281 CTGCTTCAGAGGGTTTTGAGAGG + Intronic
1130318763 15:82821556-82821578 CTCCTCCATTGGTTTGTGAGTGG + Intronic
1130894063 15:88157172-88157194 CTCTCCCAGTGGGTGTCAAGAGG + Intronic
1131057341 15:89383519-89383541 CTGCCCCAGTGGAGTTTGAATGG + Intergenic
1131114294 15:89784563-89784585 CTCCCGCAGTGAGTGGTGAGAGG - Intergenic
1131404335 15:92151760-92151782 CTTCCCCAGTGGACTTTAAGTGG + Intronic
1131900807 15:97085832-97085854 CTTCCCCGCTGGGTTTAGAGAGG - Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1134611095 16:15608518-15608540 CTCCCCCCGTGTGTTTTCAAAGG - Exonic
1137063276 16:35811376-35811398 CTGCCCCAGTGGGATCAGAGTGG - Intergenic
1137563997 16:49522008-49522030 CTCCCCCTCTGGGGTTAGAGGGG - Intronic
1137850680 16:51738811-51738833 CTCCCTCAGGGGGCTTTCAGAGG - Intergenic
1138596739 16:58033126-58033148 CTCCCCCACTGGCTGCTGAGAGG - Intronic
1141659773 16:85435603-85435625 CCCCTTGAGTGGGTTTTGAGGGG + Intergenic
1144296769 17:13883570-13883592 CTCCCACAGTGGCTTAAGAGTGG - Intergenic
1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG + Intergenic
1147165998 17:38593752-38593774 CTCCCTCTGTGGGCTTTCAGGGG - Intronic
1147455278 17:40534024-40534046 CTCACCCACTGGATTGTGAGAGG - Intergenic
1150299536 17:64036785-64036807 CCCCCACAGTGGGGGTTGAGGGG - Intergenic
1152390389 17:80000807-80000829 CACCCCCTGCGGGTCTTGAGTGG + Intronic
1156092625 18:33489554-33489576 CTCCCCCAGTGTGTTTTACTAGG - Intergenic
1156159487 18:34342623-34342645 CTCCCACAGTGGATATTGTGTGG - Intergenic
1156540165 18:37901751-37901773 CTCCACCTGTGGTTTTGGAGGGG - Intergenic
1158964540 18:62611479-62611501 CAGGCCCAGTGGGTCTTGAGGGG - Intergenic
1160436145 18:78854322-78854344 CTTCCCCAGTGGGTGATGATGGG - Intergenic
1160436181 18:78854478-78854500 CTTCCCCAGTGGGTGATGATGGG - Intergenic
1160436343 18:78855501-78855523 TTCCCCCAGTGGGTGATGATGGG - Intergenic
1160436354 18:78855550-78855572 TTCCCCCAGTGGGTGATGATGGG - Intergenic
1160436378 18:78855648-78855670 TTCCCCCAGTGGGTGATGATGGG - Intergenic
1160439084 18:78875349-78875371 CTCCCCTACTGGGTCTTGGGAGG + Intergenic
1161653575 19:5499312-5499334 TTCCCCGAATGGGTTTTGAGCGG - Intergenic
1162345379 19:10115360-10115382 GTCCCCCGGCTGGTTTTGAGGGG - Exonic
1162767468 19:12928650-12928672 CTCCCCCAGTGGCTCTTGGCGGG - Exonic
1162840822 19:13355292-13355314 CTCCCCCGGAGGCTTTTGAGGGG + Intronic
1163402559 19:17102958-17102980 TAACCCCAGTGGTTTTTGAGAGG + Intronic
1166497582 19:43315495-43315517 ATCCCACTGTGGGTCTTGAGTGG + Intergenic
1166654668 19:44601891-44601913 CATCACCAGTGTGTTTTGAGAGG - Intergenic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1167749102 19:51369052-51369074 CTCCCCCAGTGGCTGTTTAAAGG + Intergenic
933599923 2:84318717-84318739 CTCCCAGTGTGTGTTTTGAGGGG - Intergenic
936056875 2:109268209-109268231 CTTCCCCAGTGGTTTCTGTGTGG + Intronic
940478025 2:154191714-154191736 CTCTCCCAAGGGGTTTTGAGTGG - Intronic
947097166 2:226579083-226579105 CACCCTCTGTGGGTTATGAGAGG + Intergenic
1169275689 20:4232344-4232366 CTGCTCCACTGGGGTTTGAGGGG + Intronic
1172290432 20:33772245-33772267 CTACCCCCATGGGTTTTGTGAGG - Intronic
1172835091 20:37868269-37868291 CCCTCCCAGTGGTTTTTTAGGGG + Intronic
1174798741 20:53544593-53544615 CTCCAGCAGTGGTTCTTGAGTGG - Intergenic
1175320551 20:58084753-58084775 CTCCCCGGGTGGGACTTGAGTGG + Intergenic
1176271894 20:64239666-64239688 TTCTCCCAGAGGGTTGTGAGAGG + Intronic
1178362094 21:31957219-31957241 CTGCCCTCTTGGGTTTTGAGTGG - Intronic
1180007565 21:45029988-45030010 CACCACCAGTGGGTTTTGTTCGG + Intergenic
1180037148 21:45255870-45255892 CTCACCCACTGCCTTTTGAGTGG + Intergenic
952970414 3:38647406-38647428 CTTCCACACTGGGTTTTGAAGGG - Intronic
954155511 3:48682888-48682910 GTCCTCCAGTGAGTGTTGAGGGG - Exonic
954809016 3:53236529-53236551 TTTCCCCTGTAGGTTTTGAGGGG + Intronic
956250564 3:67230243-67230265 GTCCCCCTGAGGGATTTGAGTGG - Intergenic
956644005 3:71438890-71438912 CTCCACCAGTGGGGTTGGGGAGG - Intronic
956878857 3:73490451-73490473 CTCTTGCAGTGGGTGTTGAGAGG - Intronic
957574389 3:81989437-81989459 TTCCCCCAGTGGGCTTTTATTGG - Intergenic
961641563 3:128367938-128367960 CTCTCCCAGTGGGTGGTGGGAGG - Intronic
961647746 3:128401406-128401428 CTCCCCCAGTGGCCTGTGAGGGG - Intronic
963666696 3:148197169-148197191 AGCCCTCAGTGGGTTTTGAATGG - Intergenic
965330093 3:167362289-167362311 CTCCACCAGTAGGTATTGAAGGG + Intronic
968930368 4:3575698-3575720 CTCCTCCTGGGGGTGTTGAGAGG - Intergenic
969337403 4:6519785-6519807 CTCCCACACTGGTGTTTGAGGGG - Intronic
969457980 4:7311583-7311605 GTCCCCCAGTAGGTGTGGAGTGG + Intronic
969685698 4:8672814-8672836 CTCCCCCAGAGCCTTTGGAGGGG - Intergenic
973595062 4:52479638-52479660 CTCCTCCAGTGGTTTTTAACAGG - Intergenic
977705269 4:100063780-100063802 TTTCCTCAGTGGGTTTTCAGTGG + Intergenic
984052636 4:174884856-174884878 TTTCACCATTGGGTTTTGAGAGG + Intronic
984682304 4:182624290-182624312 TTCCCCCAGAGGGTTTTCATGGG + Intronic
985549979 5:528179-528201 CTCCCCCCGTGGGTTGGGTGGGG + Intergenic
986106107 5:4661212-4661234 CACCTCCAGTGGGTTTGGGGTGG + Intergenic
987226196 5:15844341-15844363 CTCTCACAGTGGGTTTTCACGGG - Intronic
990531654 5:56679913-56679935 CTTCTCCAGTGGGTTTTAGGGGG + Intergenic
993307465 5:86290110-86290132 CTCCTCCAGTGGGGTTCGGGTGG - Intergenic
995248561 5:109963398-109963420 TTCCCACAGTGGGCTGTGAGTGG - Intergenic
997042243 5:130271153-130271175 TTCCCCCAGAGATTTTTGAGAGG - Intergenic
997828339 5:137127531-137127553 CTACCCCAGTGGGTCTGGAAGGG + Intronic
998103602 5:139454699-139454721 GTCCCCAGGTGGGCTTTGAGAGG - Intronic
1001219191 5:169884602-169884624 ATACCCCACTGGGTTTTGTGAGG - Exonic
1003115971 6:3284148-3284170 CCCCTGCAGTGGGTTTTGTGGGG + Intronic
1003709883 6:8577323-8577345 CTCTCCATGGGGGTTTTGAGGGG + Intergenic
1004107721 6:12681447-12681469 CACCCCCATTGGGTTTTGGGGGG - Intergenic
1005017947 6:21391714-21391736 CTGCCTCAGTGGGTTTACAGTGG - Intergenic
1006342123 6:33452641-33452663 CTCCCCCAGTGTGTTGGGTGGGG + Exonic
1008122500 6:47634249-47634271 CTTGCCCAGGGAGTTTTGAGGGG + Intergenic
1010267048 6:73878997-73879019 CTGCCCCTATGGCTTTTGAGGGG + Intergenic
1010619893 6:78061355-78061377 CTCCCCTCCTTGGTTTTGAGTGG + Intergenic
1014062023 6:117082668-117082690 ATCCCCTAGTGTATTTTGAGGGG + Intergenic
1015428890 6:133106530-133106552 CTACCCCATTGGGTTTTGTGAGG + Intergenic
1017806041 6:157946348-157946370 CTCAGACAGTGGGTTTTTAGAGG - Intergenic
1018221826 6:161588716-161588738 CACCCAAAGTGGTTTTTGAGAGG + Intronic
1023535519 7:41204545-41204567 CTCTTCCAGTGAGTGTTGAGTGG - Intergenic
1023557515 7:41438506-41438528 AACTCCTAGTGGGTTTTGAGTGG - Intergenic
1031457984 7:122007982-122008004 CACCCTCACTGGGTTCTGAGAGG + Intronic
1032554070 7:132813152-132813174 CTACCCCAGTGGCTTCTCAGGGG - Intronic
1036616523 8:10392072-10392094 CTCCCCCACTGGCTTCTTAGTGG + Intronic
1046392103 8:113588296-113588318 TTCCCCCATTGGTTTTTGACAGG + Intergenic
1049204335 8:141356584-141356606 CTACCCCTGTGAGTTTTCAGTGG + Exonic
1054459738 9:65456216-65456238 CTCCTCCTGGGGGTGTTGAGTGG + Intergenic
1054926794 9:70597526-70597548 TTCCTCTAGTGAGTTTTGAGAGG + Intronic
1055376464 9:75654021-75654043 CTCCTGCAGTGTGTTTTCAGTGG + Intergenic
1057798259 9:98173336-98173358 CGCCCCCAGATGGTTGTGAGGGG - Intronic
1059767249 9:117395255-117395277 CTGCCCCAGTGGCTTATGAGGGG - Intronic
1059903520 9:118955295-118955317 CTCTACCAGAGAGTTTTGAGTGG - Intergenic
1060044507 9:120328983-120329005 ATCCCCCAGTGGCTGCTGAGGGG + Intergenic
1060102915 9:120856245-120856267 CTCCCACAGTGCCTTTTAAGGGG - Exonic
1187440387 X:19312753-19312775 CTTCCCTAGTAGGTTTTGATAGG + Intergenic
1187590122 X:20708236-20708258 CTCCCTCACAGGGTTTTGTGAGG - Intergenic
1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG + Intergenic
1195697538 X:107678021-107678043 CTTCCCCCTTGGGTTTTCAGTGG + Intergenic
1197713384 X:129688202-129688224 CGCCCCCACTGGTTTTGGAGAGG + Intergenic
1198938817 X:141930858-141930880 CTCACCCAGTGTGTTCTCAGTGG - Intergenic
1200696370 Y:6364631-6364653 CAGCCCCACTGGCTTTTGAGTGG - Intergenic
1200698294 Y:6380557-6380579 GTCCCACAGTGGGTTTTCATAGG - Intergenic
1200915089 Y:8564503-8564525 CTCCCAGAGTGGGTTTTCACTGG + Intergenic
1200915929 Y:8571154-8571176 GTCCCACAGTGGGTTTTCATAGG + Intergenic
1200937257 Y:8749127-8749149 ATCCCGCAGTGGGTTTTCACAGG - Intergenic
1201035820 Y:9784142-9784164 GTCCCACAGTGGGTTTTCATAGG + Intergenic
1201037744 Y:9800069-9800091 CAGCCCCACTGGCTTTTGAGTGG + Intergenic
1202182422 Y:22150897-22150919 ATCCCACAGTGGGTTTTCACAGG - Intergenic
1202208938 Y:22435505-22435527 ATCCCACAGTGGGTTTTCACAGG + Intergenic