ID: 1118697700

View in Genome Browser
Species Human (GRCh38)
Location 14:68400645-68400667
Sequence ACAGATAGAACACACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118697694_1118697700 18 Left 1118697694 14:68400604-68400626 CCAGGACAGCTGAAAGGTGTGGT 0: 1
1: 0
2: 3
3: 12
4: 127
Right 1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118697700 Original CRISPR ACAGATAGAACACACTGTGG GGG Intronic
903896093 1:26606043-26606065 ACAGAAAGAACTCACTGATGAGG + Intergenic
905864085 1:41367248-41367270 ACAGATAGGACCCCATGTGGTGG - Intronic
907834577 1:58096992-58097014 ACAGAAAGACCACACTGAAGTGG + Intronic
908911905 1:69081128-69081150 ACAGTTGGAACATAGTGTGGGGG + Intergenic
911582370 1:99648638-99648660 ACACATAGACCTCACTTTGGAGG + Intronic
912090294 1:106064941-106064963 ATAAATAGAACACACTGTATTGG + Intergenic
912792038 1:112661851-112661873 ACAGATTGAGCACACTTTTGGGG + Intronic
913248641 1:116892727-116892749 AAAAATGGAACACATTGTGGTGG - Intergenic
915029179 1:152861477-152861499 ACAGAAAGAAAACTCTGTGATGG - Intergenic
915079687 1:153343560-153343582 ACAGGCAGCACACACTTTGGAGG - Intronic
916783797 1:168067335-168067357 ACAGCTAGAACATACTGTAGTGG + Intronic
922983266 1:229846829-229846851 ACAGAGAGAATGCACTGTGCAGG - Intergenic
1063237755 10:4136072-4136094 ACAGAAAAAAGACAATGTGGAGG + Intergenic
1064520176 10:16192625-16192647 CCAAATAGAACAAACGGTGGAGG - Intergenic
1065613587 10:27497827-27497849 ACAAATATAACACTCTGAGGGGG - Intergenic
1066456537 10:35577179-35577201 ACAGGGACAACACGCTGTGGAGG + Intergenic
1067288937 10:44927568-44927590 ACACACAGCACACACTGGGGTGG + Intronic
1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG + Intronic
1070647412 10:78211341-78211363 ACAGATAGAAAAGACTGGGAGGG - Intergenic
1071537760 10:86449813-86449835 AAAGATAGAAAACACGTTGGTGG + Intronic
1073619572 10:105032789-105032811 ACAAATTGAACACAGTGAGGAGG + Intronic
1075261684 10:120968833-120968855 ACAGTTATCACACAATGTGGAGG + Intergenic
1081063693 11:38512300-38512322 ACAGTTACAAAACAGTGTGGTGG - Intergenic
1085745653 11:79112297-79112319 CCAGATAGAATTCAGTGTGGTGG + Intronic
1089013993 11:115152061-115152083 ACAGATGGAAAACAGTGTGAGGG + Intergenic
1089989354 11:122844088-122844110 CCAGATTGACCACACTGTAGAGG - Intronic
1090606197 11:128425067-128425089 ACTGCTGGGACACACTGTGGTGG + Intergenic
1090682491 11:129076781-129076803 ACAGACAGAACAGCATGTGGAGG + Intronic
1093397168 12:18696816-18696838 ACAGATTGAATAAACTTTGGGGG - Intronic
1094719700 12:33051895-33051917 ACAGGCAGTACACACTGTGATGG - Intergenic
1095667357 12:44818129-44818151 ACAGATAAGACAGGCTGTGGAGG + Intronic
1099477338 12:83122785-83122807 ACAGACAGAGCAGCCTGTGGAGG - Intronic
1108800152 13:54084934-54084956 AAAGAGGTAACACACTGTGGTGG + Intergenic
1110434263 13:75461870-75461892 AGAGATAGTACACATTGTTGGGG - Intronic
1111624091 13:90761524-90761546 ACAGATGGAACACACAGCAGGGG - Intergenic
1111955936 13:94758505-94758527 AAAGATAGAACAGACTGGGGAGG - Intergenic
1113096746 13:106673439-106673461 TGAGATAGACAACACTGTGGAGG + Intergenic
1113817708 13:113186129-113186151 ACAAAAAGTACACACTGTGGTGG + Intronic
1114692450 14:24596233-24596255 ACAGACAGAGCAGCCTGTGGAGG - Intergenic
1115404372 14:32998334-32998356 ACAGACAGAACACATATTGGTGG + Intronic
1117112621 14:52474840-52474862 ACAGACAGAACAGCGTGTGGAGG + Intronic
1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG + Intronic
1119121957 14:72088018-72088040 TCAGATAGAGACCACTGTGGAGG + Intronic
1122097338 14:99381460-99381482 ACAGAAACAACCCAGTGTGGGGG + Intergenic
1123539840 15:21277902-21277924 ACAAATAGAACATACAATGGGGG + Intergenic
1124066916 15:26353459-26353481 ACAGGTGGAACAGGCTGTGGAGG + Intergenic
1125995240 15:44153593-44153615 ACAGATGAAAAAGACTGTGGAGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127059909 15:55171592-55171614 ACAGATTGAGTAAACTGTGGAGG - Intergenic
1130373618 15:83308659-83308681 AGAGATAGAACTCACTATTGTGG - Intergenic
1131995454 15:98128529-98128551 ACAGACAGAACACAATGGGGTGG - Intergenic
1202948151 15_KI270727v1_random:5060-5082 ACAAATAGAACATACAATGGGGG + Intergenic
1134095181 16:11414293-11414315 ACAGAGAGAACAGAATGTGGAGG + Intronic
1136999194 16:35214656-35214678 ACAGTGAGAACTCACTGTAGAGG + Intergenic
1137912214 16:52389181-52389203 AGAGATAGAAAACAGAGTGGTGG + Intergenic
1138098375 16:54231581-54231603 ACAGATATAAGTCACTGTGCTGG - Intergenic
1138563763 16:57817578-57817600 ACAGAGAGAACACCATGTGCAGG - Intronic
1138808989 16:60126927-60126949 AAAGATGGAAGACAGTGTGGCGG - Intergenic
1140694188 16:77515878-77515900 ACACATAGAACACAATGGGATGG + Intergenic
1142029947 16:87833480-87833502 ACAGAGACATCACTCTGTGGAGG + Intronic
1142124545 16:88403646-88403668 ACAAATGGTACAAACTGTGGGGG - Intergenic
1143287429 17:5800714-5800736 AGAGATAGACCACACAGTGGAGG + Intronic
1146623218 17:34416278-34416300 ACAAATAGAACCCAATGTAGAGG - Intergenic
1149314285 17:55423669-55423691 ACAGATGTACCACACTGTTGGGG + Intergenic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1151710117 17:75799671-75799693 ACAGTCAGAATCCACTGTGGTGG + Intronic
1153104958 18:1515925-1515947 ACAGCTAGAAAACACTAAGGAGG - Intergenic
1155529161 18:26748345-26748367 AAAGTTAGAATACATTGTGGTGG - Intergenic
1155848613 18:30741647-30741669 ACAGATACAAAACACTGTATGGG + Intergenic
1156728568 18:40161061-40161083 AAAAATAAAACACACTTTGGTGG - Intergenic
1158430545 18:57382389-57382411 ACGGATAAAACACACAGTGGTGG + Intergenic
1159892680 18:73967402-73967424 ACAGAAAGTACACACTCGGGGGG - Intergenic
1160950404 19:1664199-1664221 ACAGATTGAACTCACCCTGGTGG - Intergenic
1161623153 19:5309872-5309894 GCAGAAAGGACAGACTGTGGGGG - Intronic
1163220145 19:15913207-15913229 ACAGAGAGAACGCACTGGGAGGG + Exonic
1163326094 19:16604172-16604194 AAAGCTGGGACACACTGTGGAGG + Intronic
1164193036 19:22928911-22928933 ACAGACAGAACCCACTGGTGAGG + Intergenic
1164408985 19:27981646-27981668 ACAGACAGAACAGAATGTGGGGG - Intergenic
1164428800 19:28168860-28168882 TCAGATGAAACACACTGAGGAGG - Intergenic
1166636141 19:44453131-44453153 AGAGATGGAACACATTGGGGAGG + Intergenic
1202643289 1_KI270706v1_random:117599-117621 ACAAATGGAACACTCTCTGGTGG + Intergenic
927149911 2:20189602-20189624 ACAGATACTGCACACTGGGGTGG + Intergenic
930717390 2:54605708-54605730 GCAGATAGAACACACGTTGTGGG + Intronic
933382502 2:81567208-81567230 ACATATAGAAAACAGTGTGGAGG + Intergenic
938095343 2:128457707-128457729 ACAGAGAGAAAACTCTCTGGAGG - Intergenic
939652088 2:144776360-144776382 AGAAATAGAACACACTGTACTGG - Intergenic
940785110 2:157972462-157972484 ACAGACACAACAGCCTGTGGAGG - Intronic
943894824 2:193343217-193343239 AAAGATAGAACTCAAAGTGGTGG + Intergenic
945065643 2:205945659-205945681 GCAGATAGAATACACTGAGTGGG - Intergenic
945971426 2:216235238-216235260 ACAGCTAGAAGAGACGGTGGAGG + Intergenic
947833573 2:233159230-233159252 TCACAAAGAACCCACTGTGGGGG - Intronic
1168815310 20:732740-732762 ACAGAGAAAACACACTGTTGTGG + Intergenic
1171314659 20:24178778-24178800 AGAAGTAGAGCACACTGTGGTGG + Intergenic
1172177102 20:32979193-32979215 ACAGATACAAACCACTGTGCTGG + Intergenic
1172861130 20:38053076-38053098 ACAGGCAGGACAAACTGTGGGGG - Intronic
1178216476 21:30605062-30605084 ACAGATAGAAGACACAGTCCTGG + Intergenic
1179675910 21:42982000-42982022 ACAGATGGAACAGACAGTGGAGG - Intronic
1181995105 22:26871682-26871704 AAAGATAAAAAACACTGTAGGGG - Intergenic
1183013126 22:34963578-34963600 ACAAATAGAACACAGATTGGTGG + Intergenic
1185274156 22:49943214-49943236 GCAGACAGGACACGCTGTGGTGG + Intergenic
949724442 3:7027018-7027040 ACAGGCAGAACACAATGGGGAGG - Intronic
950863413 3:16170300-16170322 ACAGCTATAACACACAGTGATGG - Intergenic
951191252 3:19774381-19774403 ACAAATATAACACTTTGTGGAGG - Intergenic
952601404 3:35088353-35088375 ACAGACAGAGCAGCCTGTGGAGG + Intergenic
953931501 3:47008061-47008083 ACTGACAGACCACCCTGTGGAGG - Exonic
955874483 3:63475534-63475556 ACAGAAAGAAGGCACTGTGCTGG + Intronic
955949916 3:64232781-64232803 ACAGATGGAGCAGATTGTGGGGG - Intronic
956906191 3:73767815-73767837 ACAGATCAAACAAACTGGGGAGG - Intergenic
957159761 3:76595281-76595303 ATACATAGAACACATTTTGGGGG + Intronic
957381763 3:79440011-79440033 ACAGATAGAACAAAAGGTAGAGG + Intronic
957572648 3:81968118-81968140 ACAGATAGAAAGCACTGTAGTGG - Intergenic
958032676 3:88131854-88131876 ACAGACAGCACAGACTTTGGAGG - Intronic
958076278 3:88683986-88684008 ACAGATAGAAATTTCTGTGGTGG + Intergenic
960513052 3:118572771-118572793 CCAGATAGAACACCATGCGGAGG - Intergenic
960575258 3:119222846-119222868 ACACCTAGAACAAACTATGGTGG - Intronic
963844391 3:150140672-150140694 GCAGAAAGAACACTCGGTGGGGG + Intergenic
966664061 3:182450771-182450793 AGAGATAAAACACAGTGAGGAGG - Intergenic
966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG + Intergenic
968720580 4:2200349-2200371 ACAGACAGAGCAGAGTGTGGAGG + Intronic
968880975 4:3299991-3300013 AGAGTTAGAAAAGACTGTGGGGG - Intronic
969662877 4:8540622-8540644 ACAGATGGATCACACGGGGGAGG - Intergenic
969844742 4:9911506-9911528 ACACAAAGCACACACCGTGGGGG - Intronic
969905074 4:10386274-10386296 ACTGACAGAACACACGGTGCTGG + Intergenic
971057214 4:22927181-22927203 AAAGAAAGAACACACAGTGCAGG - Intergenic
971148029 4:24000599-24000621 ACAGAAATAAATCACTGTGGGGG + Intergenic
971248754 4:24954042-24954064 ACCTATAGGACACATTGTGGAGG + Intronic
975384428 4:73739203-73739225 ACACTGTGAACACACTGTGGAGG - Intergenic
977571673 4:98635361-98635383 CCTGATAGTACACCCTGTGGAGG + Intronic
978701014 4:111646192-111646214 ACAGATAGATGACACTGATGAGG - Intergenic
979533563 4:121794702-121794724 ACAGATGGACCACACTGATGAGG + Intergenic
980190848 4:129523062-129523084 ACACATAGAACAGACTTTAGGGG + Intergenic
982619631 4:157688260-157688282 ACAGATACAACACAATTTGTTGG - Intergenic
984300343 4:177909443-177909465 ACACACAGCACACACTGTTGTGG - Intronic
985353033 4:189087032-189087054 ACAGATTGAACACTGTGTGAAGG - Intergenic
985443065 4:189998917-189998939 ACAAATAAAACACAATGTGTGGG - Intergenic
989127663 5:38072891-38072913 ACAGATAGAATACACAGTGCAGG - Intergenic
989776885 5:45219648-45219670 ACAAATACACCACTCTGTGGGGG + Intergenic
994037298 5:95216479-95216501 GCTGATAGAACACAGTGTAGAGG - Intronic
994978963 5:106847795-106847817 ATAGGTTGAAAACACTGTGGTGG - Intergenic
996887694 5:128377751-128377773 ACAGATGGAAAAAACTGTGTTGG - Exonic
998708658 5:144795190-144795212 ACAGACAGAACAGTGTGTGGAGG - Intergenic
999754562 5:154654478-154654500 TCATATAGAGCACAGTGTGGTGG + Intergenic
1000662540 5:163953241-163953263 ACAGATAGAACACACATTGGTGG - Intergenic
1003599505 6:7504035-7504057 ACAGAAAAATCACACTGTGGGGG + Intergenic
1004112173 6:12729705-12729727 ACATACAGGACACACTGGGGAGG + Intronic
1004998747 6:21219413-21219435 ACAAATAGAAAACACTCAGGGGG - Intronic
1006645111 6:35510395-35510417 AGAGATAGCACACTCTGTAGTGG - Intronic
1006865359 6:37205322-37205344 ACAGTCAGAAGACACTGAGGAGG + Intergenic
1007668813 6:43534675-43534697 ACAAAAAGAACAAACTATGGAGG - Intronic
1007668943 6:43535526-43535548 ACAAACAGAACAAACTATGGAGG - Intronic
1008471290 6:51888044-51888066 CCAGAGAGAACACATTGTGTAGG - Intronic
1010351016 6:74874384-74874406 ATAGAAAGAACAGGCTGTGGGGG - Intergenic
1010805213 6:80227882-80227904 ATAGAAAGAACCCACTGTAGGGG + Intronic
1011977838 6:93328087-93328109 ACAGAGAGAACAGCCTGTGCAGG - Intronic
1013027502 6:106291824-106291846 ACAGATAGAGCACATAGTGTTGG - Intronic
1013435935 6:110106913-110106935 ACAGAAAGAACACAGTCTGATGG - Intronic
1013885734 6:114963991-114964013 ATAGATAGAACACAGATTGGGGG - Intergenic
1015123044 6:129722125-129722147 ACAAAGAGAAAACACAGTGGTGG + Intergenic
1015517030 6:134093010-134093032 ACAGAAAGAACACCATGTGAAGG + Intergenic
1017160257 6:151359248-151359270 AAAAATAGAATACACTTTGGGGG - Intergenic
1018789330 6:167134632-167134654 ACTGATATGACACAGTGTGGGGG + Intronic
1019401390 7:856051-856073 ACGTTTAGAACACACTCTGGAGG + Intronic
1020699019 7:11454003-11454025 ACAGAGAGAAAAGACAGTGGAGG + Intronic
1028064816 7:86370253-86370275 AAAGATAGAATATACTGTGTTGG - Intergenic
1028503784 7:91549305-91549327 ACAGAAAGAACAAAATGTGTTGG - Intergenic
1032302546 7:130701322-130701344 AAAGATAGAACACAGATTGGTGG - Intergenic
1035561729 8:609642-609664 ACAGTTAGAACTCACTTTTGGGG + Intergenic
1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG + Intronic
1040463818 8:47675964-47675986 ACAGCTGGAACATCCTGTGGCGG - Intronic
1041198467 8:55425605-55425627 ACAGATAGAAGATACAGGGGAGG - Intronic
1041306641 8:56468728-56468750 CCAAATAGAACACGTTGTGGGGG - Intergenic
1044893740 8:96865348-96865370 ACAGAGACAGCCCACTGTGGTGG - Intronic
1048817931 8:138351391-138351413 ACAGGTAGAACACTATGTGAAGG + Intronic
1050126799 9:2365092-2365114 AAAGATGGAACACACTCTAGGGG + Intergenic
1051110355 9:13628009-13628031 AGAGTTAGAACACACAGTGCAGG + Intergenic
1051305541 9:15704914-15704936 ACAGAGAAAACAGACTGAGGGGG - Intronic
1052201959 9:25793085-25793107 ACAGATTGAAAACTCTGTTGTGG + Intergenic
1053133594 9:35634812-35634834 ACAGATGGAACACACTATAAGGG - Intronic
1053485826 9:38455411-38455433 GCAGAAAGAACAAAGTGTGGTGG + Intergenic
1054358481 9:64088396-64088418 ACAAATGGACCACTCTGTGGTGG - Intergenic
1055467774 9:76582541-76582563 AAAGAAAGAAAAGACTGTGGAGG - Intergenic
1056449671 9:86704698-86704720 ACAGATAGAAGTCTCTTTGGCGG + Intergenic
1056626648 9:88259138-88259160 ACAGATGGACCACTCTGTGGGGG - Intergenic
1059743723 9:117180294-117180316 ACAGAAAGAGCAGACTGTAGAGG - Intronic
1188290290 X:28379430-28379452 ACAAATGGAATACACTGAGGAGG - Intergenic
1188722375 X:33539134-33539156 AGAGATATAACACAGTGTTGAGG + Intergenic
1188943348 X:36266287-36266309 ACTGATGGGACACACTGTGACGG + Intronic
1189128133 X:38469660-38469682 ACAGCTAGAAGACACCTTGGAGG + Intronic
1189448298 X:41102294-41102316 GCAGAAAGAACACCCAGTGGAGG + Intronic
1193584556 X:83304879-83304901 ACAGATAGAACACAGTGTTAAGG - Intergenic