ID: 1118698538

View in Genome Browser
Species Human (GRCh38)
Location 14:68410203-68410225
Sequence GTAGTTCAGTGGTTCTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118698538_1118698544 15 Left 1118698538 14:68410203-68410225 CCAGCCAAGAACCACTGAACTAC 0: 1
1: 0
2: 2
3: 9
4: 163
Right 1118698544 14:68410241-68410263 CATTTGGGCCCAGGTGCTTAAGG 0: 1
1: 0
2: 4
3: 125
4: 1694
1118698538_1118698541 -1 Left 1118698538 14:68410203-68410225 CCAGCCAAGAACCACTGAACTAC 0: 1
1: 0
2: 2
3: 9
4: 163
Right 1118698541 14:68410225-68410247 CATTTGTCTGTTGCAGCATTTGG 0: 1
1: 0
2: 2
3: 12
4: 193
1118698538_1118698543 6 Left 1118698538 14:68410203-68410225 CCAGCCAAGAACCACTGAACTAC 0: 1
1: 0
2: 2
3: 9
4: 163
Right 1118698543 14:68410232-68410254 CTGTTGCAGCATTTGGGCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 151
1118698538_1118698542 0 Left 1118698538 14:68410203-68410225 CCAGCCAAGAACCACTGAACTAC 0: 1
1: 0
2: 2
3: 9
4: 163
Right 1118698542 14:68410226-68410248 ATTTGTCTGTTGCAGCATTTGGG 0: 1
1: 0
2: 1
3: 34
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118698538 Original CRISPR GTAGTTCAGTGGTTCTTGGC TGG (reversed) Intronic
905039683 1:34945566-34945588 GGAGTTCAGTGGCTATTGACAGG - Intergenic
905469793 1:38183148-38183170 GAAGCTCACTGCTTCTTGGCTGG - Intergenic
906792290 1:48669536-48669558 GTAGGAGAGTGGTTCTTGACTGG - Intronic
906846619 1:49199727-49199749 TTAGTTCAGTTCTCCTTGGCTGG + Intronic
907126503 1:52055471-52055493 GAAGTGCAGCGGTTCTTGGGGGG - Exonic
908455706 1:64302858-64302880 GTATTTCAGTGGGGCATGGCTGG + Intergenic
911264323 1:95725496-95725518 ATAGTTCATTGTTTCTAGGCTGG - Intergenic
915255230 1:154623498-154623520 GAAGTTCAGAGGTCCTAGGCAGG - Intronic
918446953 1:184626153-184626175 TTAGTTCAGTTGTGCTTTGCTGG - Exonic
922008424 1:221555839-221555861 GTATATCAGTGGCTCCTGGCAGG + Intergenic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
922668636 1:227492726-227492748 GCATTCCAGTGGTTCCTGGCGGG - Intergenic
924574048 1:245263035-245263057 GTAATTCAGTGATTCATGGCGGG + Intronic
924614756 1:245603492-245603514 GCAGCTCTGTGGATCTTGGCTGG + Intronic
1063420214 10:5906490-5906512 GTGGCTCAGTGCTTCCTGGCAGG - Exonic
1064460741 10:15532490-15532512 CTAGGTCAGTGGTTCTTAACTGG - Intronic
1065822436 10:29538365-29538387 GTAGTCCTTTGGTTTTTGGCTGG - Intronic
1065914410 10:30341169-30341191 GGAGTGCAGTGGCTGTTGGCAGG - Intronic
1072337638 10:94413016-94413038 GTATTTCAGTGGTTATAGTCGGG - Intronic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1072641947 10:97218091-97218113 GGAGTTCAGTGGTTATTCGGTGG - Intronic
1074797326 10:116961426-116961448 TTAGTTAAGTGGTTTTTGGTTGG - Intronic
1075595364 10:123725322-123725344 GTAGTTCACTGGCTCCTGGCTGG + Intronic
1076375470 10:129981041-129981063 GTTTTTCAGTGGTGTTTGGCTGG - Intergenic
1077286084 11:1766609-1766631 GAGGTTCTGTGGTTCTCGGCGGG + Intergenic
1078195479 11:9133512-9133534 GTAGTTCAGTGGGACTTAACGGG - Intronic
1079225458 11:18600948-18600970 GTGGATCAGTGGTTATTGGTAGG + Intergenic
1081430808 11:42974777-42974799 CTCGCTCAGTGGTTCTAGGCAGG + Intergenic
1083214394 11:61209431-61209453 GGAGGTCACTGGTTCTTAGCTGG - Intronic
1083217278 11:61228260-61228282 GGAGGTCACTGGTTCTTAGCTGG - Intronic
1083220266 11:61248008-61248030 GGAGGTCACTGGTTCTTAGCTGG - Intronic
1086299413 11:85409547-85409569 GGAGTTCAATGGATCTTGGAAGG + Intronic
1091786100 12:3244259-3244281 GTAGGTAAGCGGGTCTTGGCTGG + Intronic
1098858937 12:75685974-75685996 GTAGTTCAGTGGCTGTTGTAGGG - Intergenic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1101884328 12:108648570-108648592 GGAGTGCAGGGGTGCTTGGCTGG - Intronic
1102657663 12:114496457-114496479 GTAGTTCAGCTGCTCATGGCTGG + Intergenic
1104435650 12:128754405-128754427 GTGGCTCGGTGGATCTTGGCTGG + Intergenic
1105039659 12:132952975-132952997 GGAGTTCAGTGGTTTGTGTCTGG - Intronic
1105529658 13:21207952-21207974 GTAGTTCAGTGGTTATTCAAAGG - Intergenic
1106017290 13:25881825-25881847 CTAGTCCAGTAGTTCTGGGCTGG - Intronic
1107558953 13:41543654-41543676 GGAGTGCAGTGGTTATTTGCAGG + Intergenic
1110483517 13:76011769-76011791 TAAGATCAGTGGTTCTTAGCTGG + Intergenic
1110659523 13:78043262-78043284 GTGGTTCAGTGGCCCTTGGATGG + Intergenic
1110663009 13:78080424-78080446 GTAGTTCAGTGGCTATTGACAGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1115627286 14:35206435-35206457 GTAGTTCACTGTTTACTGGCTGG + Intronic
1117854978 14:60020129-60020151 GCAGATCAGTGGTTGTTGCCAGG - Intronic
1118698538 14:68410203-68410225 GTAGTTCAGTGGTTCTTGGCTGG - Intronic
1121095447 14:91215229-91215251 TTTATTCAGTAGTTCTTGGCTGG + Intronic
1123776189 15:23583035-23583057 GAAGTTAAGAGTTTCTTGGCCGG - Intronic
1124175090 15:27417030-27417052 CTAGAGCAGTGGTTCTTAGCTGG + Intronic
1128061434 15:64738206-64738228 GTAGATCAGGGCTTCCTGGCTGG - Intergenic
1128224118 15:65989785-65989807 TTGGATCAGTGGTTCTTGCCTGG + Intronic
1128570203 15:68728143-68728165 GTAGAACAGTGGTTCTTAACCGG - Intergenic
1129076576 15:73002130-73002152 GGAGTGCAGTGGTTATTGACAGG - Intergenic
1129393912 15:75234148-75234170 GTAGCTCAGTGGTTTGGGGCCGG - Intergenic
1129663730 15:77567584-77567606 GGAGTGCAGTGGAGCTTGGCGGG - Intergenic
1131421726 15:92311980-92312002 CTAGTCCAGTGGTTCTTAACTGG + Intergenic
1131649920 15:94387418-94387440 TTAGGTCAGCGGTTCTTGACTGG - Intronic
1132132443 15:99295086-99295108 GTAGTTCATTGTGTTTTGGCGGG + Intronic
1134806469 16:17130156-17130178 GTGGCTCTGTGGTCCTTGGCTGG - Intronic
1138616336 16:58170269-58170291 GCAGGTCAGTGGTTGTGGGCAGG - Intronic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1140242416 16:73215235-73215257 GTAGGCCTGTGGTTCTGGGCTGG - Intergenic
1140265885 16:73420354-73420376 TTATTTCAGTGGTTCTGAGCTGG + Intergenic
1140752988 16:78043049-78043071 CTAGAGCAGTAGTTCTTGGCTGG - Intronic
1142937065 17:3343631-3343653 GTAATTCAGTAGTTCTGGGTGGG + Intergenic
1144966627 17:19080561-19080583 GAAGGTCAGTTGGTCTTGGCTGG - Intergenic
1144981291 17:19171496-19171518 GAAGGTCAGTTGGTCTTGGCTGG + Intergenic
1144986933 17:19206743-19206765 GAAGGTCAGTTGGTCTTGGCTGG - Intergenic
1148632056 17:49118648-49118670 ATAGTTCAGTTGATCTAGGCTGG + Intergenic
1150408359 17:64921250-64921272 GTATTCCAGTGGTTCTCAGCCGG - Intergenic
1150433291 17:65135970-65135992 TTAAAGCAGTGGTTCTTGGCTGG - Intergenic
1150443685 17:65211945-65211967 GTGGCTCTGTGGATCTTGGCTGG + Intronic
1150766544 17:68006913-68006935 GTCGCTCATTGGTTGTTGGCAGG - Intergenic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151381853 17:73731318-73731340 CTCGTTCTGTGGTTGTTGGCTGG - Intergenic
1152489924 17:80623946-80623968 GGAGTGCAGTGGCTGTTGGCAGG + Intronic
1160413810 18:78693536-78693558 GAAGTTCAGTGGTTGGTGCCTGG - Intergenic
1161604592 19:5207622-5207644 GGGGGTCAGTGGTTCTTGGCAGG + Intronic
1164789420 19:30963475-30963497 GTAGTTCAGTGGTTGGGGCCTGG - Intergenic
1166575735 19:43835791-43835813 GGAGTTAAGTGGTTCTTCCCAGG + Intronic
1166612604 19:44212508-44212530 GTAGTTCAGGAGCTCTGGGCAGG + Exonic
1167273931 19:48523645-48523667 GTGGTTCAAAGGTTCTTGGCCGG + Intergenic
929543883 2:42843195-42843217 GTAGAGCTGTGGTGCTTGGCTGG + Intergenic
931160177 2:59681006-59681028 GGAGTTCAGTGACTCTTGTCTGG + Intergenic
932083093 2:68732955-68732977 GGAGTTCAGGGGGTCTGGGCTGG + Intronic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
933114626 2:78452566-78452588 TTAAATAAGTGGTTCTTGGCCGG + Intergenic
939092267 2:137792891-137792913 GTAGTCCAGTGGTAATGGGCTGG - Intergenic
939300416 2:140330147-140330169 GTAGTTCAGTGATGCTAGTCTGG - Intronic
940303621 2:152202100-152202122 AAAGATCAGTGGTTGTTGGCTGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
943726430 2:191256185-191256207 GTGGTGCAGTGGTTATGGGCTGG + Intronic
944079776 2:195773991-195774013 GTAGTTCAGTGATTCTAGATTGG - Intronic
946931022 2:224671430-224671452 GTAATTCAGTAGGTCTTGGATGG - Intergenic
947268971 2:228312386-228312408 CTAATTCAGTGGGTCTTGGGTGG - Intergenic
947374785 2:229484579-229484601 TTAGGTCGGTGGTTCTTGACTGG + Intronic
1169136966 20:3203394-3203416 ATTGTGCAGTGGCTCTTGGCCGG + Exonic
1170244577 20:14206248-14206270 CTAGATCACTGGTTCTTGACTGG + Intronic
1172689120 20:36778395-36778417 CTAATTCAGTGGGTCTTGGGTGG + Exonic
1173968403 20:47131375-47131397 TTAGGGCAGTGGTTCTCGGCAGG - Intronic
1173995015 20:47331296-47331318 GTAGTTCAATGGTGATAGGCTGG + Intronic
1174441355 20:50557713-50557735 AGAGTTCAGTGGCTCTTCGCGGG + Intronic
1174712176 20:52718756-52718778 GTAGTCCAGTGGTTTTTAACTGG + Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1183296233 22:37031115-37031137 CTAGGGCAGTGGTTCTTGACTGG - Intergenic
1183647818 22:39136640-39136662 GTTCTTCAGTGGTTCTAGTCTGG - Intronic
1185349166 22:50325629-50325651 GAAGTTAAGAGGTTCCTGGCCGG - Intronic
950152090 3:10695657-10695679 GTAGCTCTGTGGATCCTGGCGGG - Intronic
956173311 3:66450257-66450279 GTAGCTCCTTGGATCTTGGCAGG - Intronic
963652890 3:148006654-148006676 GTTTTTCAGTGGTTGTTGGCAGG - Intergenic
966012967 3:175104145-175104167 GAAGTGCAGTGGTTCTTGAATGG - Intronic
966624521 3:182001739-182001761 GCAGTTCAGTGCTTCCTGGAAGG + Intergenic
966674097 3:182566356-182566378 CTAATTCAGTGGTTCTTCGGTGG + Intergenic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
975926905 4:79466882-79466904 GTAGGGCAGTGGGTGTTGGCTGG + Intergenic
981774333 4:148347801-148347823 GTGGTGCAGTGGTGGTTGGCTGG - Intronic
982201986 4:152970579-152970601 GCAGTTGAGCTGTTCTTGGCTGG + Intronic
983513052 4:168629569-168629591 GTAATTCAGTAGTTCTGAGCAGG + Intronic
988332283 5:29857478-29857500 GAAATTCAGTGGTGCTTGACAGG + Intergenic
988959019 5:36350431-36350453 GTAACCCAGTGGTTCTTGACTGG - Intergenic
991128871 5:63098219-63098241 GTGCTTCAGTGGGTATTGGCTGG + Intergenic
992916423 5:81457956-81457978 GTAATTTTGTGGTTTTTGGCCGG - Intronic
996502261 5:124230239-124230261 GAAGTTCAGCTGTTCCTGGCCGG - Intergenic
1001668684 5:173455418-173455440 TTAGCTGAGTGGTTCTTGCCGGG - Intergenic
1003402356 6:5800952-5800974 GTAGTTCAGTGGTTATTCAGAGG + Intergenic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1005426005 6:25702986-25703008 GTAATTAAGTGGTTGTTGGCCGG - Intergenic
1007324350 6:41048765-41048787 GTTGTTCCTTGGATCTTGGCTGG - Intronic
1013295551 6:108755412-108755434 GTAGTTCAGTGATTATTCACAGG + Intergenic
1015742099 6:136467868-136467890 CTAGTTCAGAGGGGCTTGGCAGG - Intronic
1016091287 6:139982466-139982488 TTAATGCAGTGTTTCTTGGCTGG - Intergenic
1016953104 6:149600142-149600164 GTAGTGCAGTGGTTATTCACAGG - Intronic
1022060983 7:26794749-26794771 GTAGTCCAGTGGTGGTGGGCTGG - Intronic
1023420903 7:39978707-39978729 GTGGTTCAGTAGGTCTGGGCTGG + Intronic
1023560074 7:41464570-41464592 GTAACTCATTTGTTCTTGGCTGG + Intergenic
1023597048 7:41841119-41841141 GTATTTCAGTTGTTTATGGCTGG + Intergenic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1032587261 7:133158396-133158418 GGAGTGCAGTGGTTCTTCACAGG - Intergenic
1034685923 7:152971398-152971420 GTGGTTCAGTGGGTCTGTGCTGG + Intergenic
1037340463 8:17839173-17839195 CTAGAACAGTGGTTCTTGGCCGG - Intergenic
1040797943 8:51307534-51307556 ATACTTCATTGATTCTTGGCTGG + Intergenic
1040833195 8:51701845-51701867 CAAGTCCAGTGGTTCTTGGATGG + Intronic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1043210313 8:77505853-77505875 GAAGTTCAGTGGTTGTTGGCAGG - Intergenic
1043309839 8:78844341-78844363 GTAGTTCAGTACTTCCAGGCTGG + Intergenic
1044113694 8:88307205-88307227 GTAGTTCAGAGATTGTTGGATGG - Intronic
1047769874 8:128022081-128022103 CTGATTCAGTGGTTCTGGGCAGG - Intergenic
1047775206 8:128064564-128064586 CTAATTCAGTGGTTCTAGGGTGG + Intergenic
1048656500 8:136543608-136543630 TTATTTCAGTGGTGTTTGGCTGG + Intergenic
1049297374 8:141849932-141849954 GTGATTCAGTGGTGCTTGTCAGG + Intergenic
1050125965 9:2356559-2356581 CTCATTCAGTGGTTATTGGCAGG + Intergenic
1050180528 9:2917764-2917786 GTTGTGCAGTGGTTGCTGGCTGG + Intergenic
1056310488 9:85335905-85335927 GATGCTCAGTGCTTCTTGGCAGG + Intergenic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1059233272 9:112741013-112741035 GGAGTTCAGGGGTTTTTGGGAGG - Intergenic
1059338427 9:113583619-113583641 GCTGGACAGTGGTTCTTGGCTGG - Exonic
1059512938 9:114865953-114865975 GTTGTTCAGTGGCTCTTAACTGG + Intergenic
1059851683 9:118348194-118348216 GCAGTTCAGAATTTCTTGGCTGG - Intergenic
1185776206 X:2804854-2804876 GTAGCCCTGTGGTCCTTGGCAGG + Intronic
1186202192 X:7165886-7165908 CTAGACCAGTGGTTCTTGCCAGG - Intergenic
1186852431 X:13593547-13593569 CTAGTTCCTTGTTTCTTGGCAGG - Intronic
1186888917 X:13941016-13941038 CTAGTTCAGGGGTTCTTGACTGG + Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1192350913 X:70355472-70355494 CTAATTCAGTGGGTCTTGGGCGG + Intronic
1195363378 X:104106159-104106181 CTAGTACAGTGGTTCTAAGCCGG - Intronic
1195372359 X:104189893-104189915 TTAAGCCAGTGGTTCTTGGCAGG + Exonic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1197114348 X:122815288-122815310 GTCTTTCAGTGGTTCTCAGCTGG + Intergenic
1200337503 X:155365750-155365772 GTTGTGCAGTGGCTCTTGACCGG + Intergenic
1200348967 X:155475477-155475499 GTTGTGCAGTGGCTCTTGACCGG - Intergenic
1202111309 Y:21423544-21423566 GAAGTCCAGTGGTTCATGCCTGG - Intergenic
1202587258 Y:26444677-26444699 TTAGTTCAGTGATTTTTGGTGGG + Intergenic