ID: 1118698631

View in Genome Browser
Species Human (GRCh38)
Location 14:68410763-68410785
Sequence AGATGTAAGATGCAATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118698631 Original CRISPR AGATGTAAGATGCAATTTGG AGG Intronic
900855418 1:5177948-5177970 AGATGTGAGGTTCCATTTGGTGG - Intergenic
910080264 1:83333452-83333474 ACATGTAAGATGACACTTGGAGG - Intergenic
912252773 1:108028319-108028341 AAATGTAGAATGCAATTTTGTGG + Intergenic
916995185 1:170289198-170289220 ATATTTAAGTTGCATTTTGGAGG - Intergenic
917455941 1:175185993-175186015 AGAGGTAGGATGCAGATTGGTGG + Intronic
917700387 1:177574569-177574591 AAATGTAAGATTTAATTTAGAGG - Intergenic
917983507 1:180290683-180290705 AGATGTAAGATGAGCTTTGAAGG + Intronic
918334243 1:183492071-183492093 AGATTTAACATGAATTTTGGAGG + Intronic
921464236 1:215466700-215466722 AGAGGCAAGAAGAAATTTGGTGG + Intergenic
923366446 1:233266386-233266408 AGATGCTAGATTCAATTTGGAGG - Intronic
1063051305 10:2452101-2452123 AGATGTGTGATGCAATTTCTAGG - Intergenic
1064226712 10:13492592-13492614 AGATGTAAGTTGCCATTTTCTGG - Exonic
1068861330 10:61851019-61851041 AGTTGTAAGAGACAATGTGGAGG - Intergenic
1069388801 10:67910626-67910648 CCATGTAAGATGGAATTTGGGGG + Intronic
1069441515 10:68432982-68433004 AGATGGAATTTGGAATTTGGAGG - Intronic
1071009751 10:80924264-80924286 AGATGTTAGATGCAGTTTTGTGG - Intergenic
1072852243 10:98908381-98908403 AGATATAAGATGGTATATGGAGG + Intronic
1073144834 10:101273698-101273720 CTATGTAAGATGCAATTCAGAGG + Intergenic
1073736017 10:106347517-106347539 AGAATTAAGAAGCAATTTGTTGG - Intergenic
1077539560 11:3140138-3140160 AGATGGTGGCTGCAATTTGGGGG - Intronic
1078681999 11:13486087-13486109 AGATGTAAGAGGTAACTTTGTGG + Intergenic
1085177390 11:74502579-74502601 AGATGCCAGCTGCATTTTGGGGG + Intronic
1085520297 11:77134229-77134251 AGATTTAAGATGTTATTTGTAGG - Intronic
1086107345 11:83159650-83159672 AGATGTAAAAGTCACTTTGGGGG + Intronic
1087060315 11:93970826-93970848 ATATCTAAGATGTAATTTTGTGG + Intergenic
1089878279 11:121747031-121747053 AGTTTTAACATGCATTTTGGAGG - Intergenic
1090590789 11:128265414-128265436 AGAGCAAAGATGCATTTTGGGGG - Intergenic
1091505728 12:1065973-1065995 AGATGTAGAATGCTAATTGGTGG + Intronic
1092931726 12:13321914-13321936 AGTTTTAACATACAATTTGGTGG - Intergenic
1093873869 12:24326308-24326330 CAATCTAGGATGCAATTTGGAGG + Intergenic
1096795430 12:54074521-54074543 AGATGTAACATCCACTCTGGTGG - Intergenic
1101937202 12:109068060-109068082 AGATGTCATATGCAATTTCAAGG + Intronic
1102667535 12:114588321-114588343 ACATGAATGATGCAAATTGGTGG + Intergenic
1104340641 12:127945547-127945569 GGATGTTAGATGTAATTTTGCGG - Intergenic
1104526456 12:129527733-129527755 AAATGCAAAATGCAATTTGATGG + Intronic
1105390209 13:19969540-19969562 AGATGTATGATGAAATTCAGAGG + Intronic
1106023065 13:25932777-25932799 AGATGAAAAGTGAAATTTGGGGG - Intronic
1106654825 13:31732133-31732155 AGATGTGAGATGTATTTTGGAGG - Intergenic
1107030605 13:35849381-35849403 AAATGTTTGATGCCATTTGGAGG - Intronic
1107565608 13:41600835-41600857 AAATTCAAGAAGCAATTTGGAGG - Intronic
1109251447 13:60025313-60025335 AGATTTAAGAAACAATATGGCGG - Intronic
1109296505 13:60538754-60538776 AGATGCCACAGGCAATTTGGAGG + Intronic
1111156016 13:84327429-84327451 AGGTGTAAGATACAAAATGGTGG - Intergenic
1111566860 13:90028009-90028031 AGGTGTAAGATGCAAATGGTTGG - Intergenic
1113180386 13:107618629-107618651 GAATTTGAGATGCAATTTGGAGG + Intronic
1115966157 14:38890722-38890744 AGAGGTAGGCTGGAATTTGGAGG - Intergenic
1116762213 14:49027844-49027866 AGCTATAAGATTAAATTTGGTGG - Intergenic
1117426438 14:55603243-55603265 AGAAATAAGATGGAACTTGGAGG - Intronic
1118698631 14:68410763-68410785 AGATGTAAGATGCAATTTGGAGG + Intronic
1119409419 14:74420473-74420495 AGATCTAAGGAGCAATTAGGAGG + Intronic
1120747156 14:88162895-88162917 AGAATAAAGCTGCAATTTGGAGG + Intergenic
1121806336 14:96827675-96827697 AGATGTAAAAGACAATTTGAAGG - Intronic
1127879250 15:63141725-63141747 ATATGTAACATGCAATCTGTTGG + Exonic
1128899751 15:71409554-71409576 AGATGTAAGAGGTGATTTGGGGG - Intronic
1137910720 16:52375122-52375144 AGATGATAGATACAATTAGGTGG + Intergenic
1138838525 16:60469084-60469106 AGAAGCATGATGAAATTTGGAGG - Intergenic
1140302846 16:73774916-73774938 GGATGTAAGATGAATTTTGAAGG - Intergenic
1141155012 16:81591333-81591355 AGATGTAAGGTGCTATTTTAAGG + Intronic
1145002289 17:19313799-19313821 AGATGTAAGAGGAATTGTGGTGG + Intronic
1148897644 17:50849065-50849087 AAATTTGACATGCAATTTGGTGG + Intergenic
1150934950 17:69625175-69625197 AGAAGAAAGGTGCAATTTAGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153489623 18:5633457-5633479 GGAGGTCAGAGGCAATTTGGAGG - Intergenic
1154099189 18:11453758-11453780 TGATTTAAGATGCATTTTGGAGG - Intergenic
1154141002 18:11824356-11824378 TGATGTAATTTGCATTTTGGGGG + Intronic
1154203384 18:12316444-12316466 AGATGCAAGAAGCAATTTCGGGG - Intronic
1158744071 18:60177506-60177528 AAATGAAGTATGCAATTTGGTGG + Intergenic
1159470495 18:68849434-68849456 TGATGTGAGATCCAGTTTGGAGG - Intronic
1164735702 19:30539560-30539582 AGTTGTAACATGCAATGGGGAGG + Intronic
1165589547 19:36955768-36955790 AGATTTCAGATACATTTTGGAGG + Intronic
926446602 2:12950187-12950209 AGAAGTAAGAAGGAATGTGGAGG - Intergenic
930386208 2:50698506-50698528 ACATGCAACATGCAATGTGGTGG + Intronic
930638959 2:53835916-53835938 ACATGCAACATGAAATTTGGAGG - Intergenic
930971641 2:57402766-57402788 AGATAAAATATGCAATTTGGGGG - Intergenic
931218163 2:60265239-60265261 AGGAGTAAGATCCAATATGGCGG + Intergenic
931997009 2:67848317-67848339 AGATGAACGTTGCAATTTGCTGG - Intergenic
937029673 2:118727969-118727991 AGGTGTTAAATGCAAATTGGAGG + Intergenic
939339649 2:140877752-140877774 ATATGTAAGATGAACATTGGTGG - Intronic
940018125 2:149128306-149128328 AGATTTAAAATGCTATTTGATGG - Intronic
944959409 2:204854147-204854169 TGATGTAAGATGAAGCTTGGAGG + Intronic
945379451 2:209122257-209122279 AGATGAAAGAAGCATTTGGGGGG - Intergenic
945905081 2:215583669-215583691 GAATGTAGGATGCAATTTGAAGG + Intergenic
946634572 2:221710397-221710419 AGAGGTAAGATGCCCTTTGCAGG - Intergenic
1169385653 20:5147232-5147254 AGATCTAAGATGCAATACAGAGG + Intronic
1169916744 20:10690953-10690975 AGAGGAAAGCTGCAATTTGAAGG + Intergenic
1170382849 20:15780770-15780792 AGATTCAAGATGCATTTTTGAGG + Intronic
1171981149 20:31630147-31630169 ACATTTAAGCTGCAATTTGAAGG + Intergenic
1173147039 20:40533929-40533951 AGATATCAGAGGGAATTTGGTGG - Intergenic
1175633747 20:60562918-60562940 AGATTTGAAATGGAATTTGGGGG - Intergenic
1179036283 21:37760990-37761012 AGAAGAAAGATGCACTTTGTGGG + Intronic
1179193595 21:39144123-39144145 AGATGTTATATTCAATTTGCTGG + Intergenic
1180897888 22:19350538-19350560 AGATTCAAGATGTATTTTGGAGG - Intronic
1182130395 22:27845998-27846020 GGATGTAAAATGCAACATGGGGG + Intergenic
1182928945 22:34154573-34154595 AGATGTAAGAGGTATTTTGAAGG + Intergenic
1183980217 22:41535065-41535087 AGATGCAAGTTCCAGTTTGGAGG - Intronic
951106503 3:18750064-18750086 AGATGAAAGATAAATTTTGGAGG + Intergenic
951650254 3:24943714-24943736 AGGTGCAAAATGCAATTTGCAGG - Intergenic
952466520 3:33593390-33593412 AGATAAAAGATACAATTTGTAGG + Intronic
952500802 3:33960008-33960030 TGATTCAAGATACAATTTGGAGG + Intergenic
953475729 3:43204380-43204402 AGCTGTAAGATACAAATTGTGGG - Intergenic
954999647 3:54915616-54915638 AGATGAAAGACCCAATTTGCAGG - Intronic
955551493 3:60089858-60089880 AGTTTTAACATGCAATTTGGAGG + Intronic
955715701 3:61827238-61827260 TGTTGTAAGATTCTATTTGGAGG + Intronic
955743794 3:62120306-62120328 ATATTTAAGATGCATTTAGGAGG + Intronic
956213562 3:66825953-66825975 AGTTGTAAGATGGACTTTGAAGG - Intergenic
957034444 3:75281047-75281069 AGATGAAAGATGGCATTTTGGGG + Intergenic
957695191 3:83627318-83627340 ACATGTAAGATCCACGTTGGTGG - Intergenic
957885106 3:86277204-86277226 ATATGTTAGATGTAATTTAGAGG + Intergenic
957910117 3:86609154-86609176 AGAGGTTAGATGGAGTTTGGAGG - Intergenic
959397738 3:105862474-105862496 AGATGTGGGAGGCATTTTGGAGG - Intronic
962994603 3:140613187-140613209 AGATGTTAAAAGCAATTTAGAGG + Intergenic
963910745 3:150815621-150815643 AGATTTAAGATGTGATTTTGAGG + Intergenic
964034390 3:152178339-152178361 AGATGGAAGATCCAATTTTAAGG + Intergenic
964429183 3:156586800-156586822 AGATGCAAGATATATTTTGGAGG + Intergenic
964811121 3:160665879-160665901 AGATTCAAGATATAATTTGGAGG - Intergenic
964918802 3:161870889-161870911 GGAAATAAGATTCAATTTGGAGG - Intergenic
965096084 3:164227869-164227891 AGATGTAAGATGAAAGATGAAGG - Intergenic
965246235 3:166273559-166273581 AGGTTTAAAATACAATTTGGAGG + Intergenic
965426464 3:168529956-168529978 AAATACAAGATGAAATTTGGGGG + Intergenic
965715343 3:171596643-171596665 TGAAATAAGATGCAATTGGGTGG - Intergenic
966130163 3:176628375-176628397 AGCTGCAACATGCAATTTGAAGG - Intergenic
967479772 3:189959737-189959759 AGATTTGAGATACAATTTGGAGG - Intronic
969047496 4:4347085-4347107 TGATGTAAGATGCCATTTCTTGG + Intergenic
969136375 4:5032528-5032550 AGATGGAAAATGCAGTTTAGGGG - Intergenic
970108933 4:12616338-12616360 AGCTGTAAGATGAAAGTTAGAGG - Intergenic
970615426 4:17764354-17764376 AGATTAGAGGTGCAATTTGGAGG - Intronic
970755729 4:19423837-19423859 AGAGGTAAGATACAATGTGAAGG - Intergenic
971311792 4:25531439-25531461 AGATGGAACATGAAATTTTGTGG + Intergenic
971819798 4:31537402-31537424 ACATAAAAGATACAATTTGGTGG - Intergenic
974017262 4:56658895-56658917 AGATGTTACATGCAATCTGCTGG + Intronic
975462783 4:74674114-74674136 AGATGTGTGATGCATTTTGAAGG + Intergenic
975598795 4:76077625-76077647 ATATGTAAGAATGAATTTGGGGG + Intronic
976688179 4:87839164-87839186 AGAAGCAAGCTGCAATTTGGTGG - Intronic
977534022 4:98235988-98236010 ATATGTAAGACGCAATTAAGGGG + Intergenic
978517906 4:109588596-109588618 AGATGGAATCTTCAATTTGGTGG - Intronic
979269049 4:118738109-118738131 AGATTAAGAATGCAATTTGGGGG - Intronic
979327755 4:119399420-119399442 AGCTGCAAGATGAGATTTGGTGG + Intergenic
979587520 4:122438513-122438535 AAATGTAAGATTCACTTTGTTGG + Intergenic
982462588 4:155689649-155689671 AGATTTAAGAGGCAATTCTGTGG - Intronic
982513773 4:156318597-156318619 AGATGCAAGATGCAATGTAGTGG + Intergenic
982787887 4:159557687-159557709 AAATGTAAGATTTACTTTGGTGG + Intergenic
984468777 4:180137654-180137676 AGTTGTCAGCTGCAATATGGTGG - Intergenic
984473796 4:180212279-180212301 AAATGTAAGGTGCCATTAGGAGG + Intergenic
984852499 4:184166708-184166730 AGATGGTAGATGATATTTGGAGG + Intronic
985352813 4:189084242-189084264 AGATGTAAGATGAAAATTTGGGG + Intergenic
986494775 5:8331499-8331521 AGAGGGAAGAAGCAATTCGGTGG - Intergenic
986599868 5:9462150-9462172 TCATGTAAGAGGCAATTTTGGGG - Intronic
986891739 5:12317504-12317526 AAATGTGAGATAAAATTTGGAGG - Intergenic
988034821 5:25813725-25813747 AGATGTAAGAAACAGTATGGTGG - Intergenic
988678713 5:33461916-33461938 AGATTAAAGATGCGATTGGGCGG + Exonic
988996334 5:36718246-36718268 AGTTGTATGATCAAATTTGGTGG - Intergenic
990255857 5:53968078-53968100 AGATGTGAGTGGCAACTTGGGGG + Intronic
990648822 5:57875537-57875559 AGATGTAAGAAGTATTTGGGAGG + Intergenic
991351037 5:65721545-65721567 AGATGGATGATGCGATTTGGTGG - Intronic
992235334 5:74703302-74703324 GGATGTAAGAGGCAACTTGAAGG - Intronic
993264348 5:85704750-85704772 AGATGTAAGAGGCAGGTAGGAGG - Intergenic
993628787 5:90258585-90258607 AGATTCAAGATAGAATTTGGAGG - Intergenic
994312310 5:98288355-98288377 ATATGAAAGATGCATTTTGAGGG - Intergenic
994548572 5:101203837-101203859 AAATTTAAGATGAGATTTGGGGG - Intergenic
996236302 5:121135139-121135161 AGAGGTAAGTTTAAATTTGGTGG - Intergenic
997775022 5:136596061-136596083 AGATGTAATGTGCAATGTGTGGG + Intergenic
999702957 5:154244943-154244965 AGATGTAAGATAGAGATTGGGGG + Intronic
1000038485 5:157467067-157467089 ACCTGAAAGATGCAATGTGGTGG + Exonic
1001318091 5:170658552-170658574 AGATGGCAGATGAATTTTGGAGG + Intronic
1005582614 6:27248943-27248965 AGAGGTAAGAGGCAATGTTGGGG + Exonic
1006301888 6:33198148-33198170 AGATGTAGGACGCGATTGGGGGG - Intronic
1006889073 6:37408839-37408861 AGAAGTATGAGGGAATTTGGTGG - Intergenic
1006931575 6:37692155-37692177 AAAGGCAAGATGCAATGTGGCGG + Intronic
1007880923 6:45165907-45165929 AGAAATAAGATGCATATTGGAGG + Intronic
1008352616 6:50510400-50510422 AAATGAAAAATGCATTTTGGGGG - Intergenic
1008672800 6:53790607-53790629 AGATGTAATTTGCAACTTGTTGG + Intergenic
1008806774 6:55439346-55439368 AGATGTGGGAAGCAATTTTGAGG - Intronic
1009789744 6:68386223-68386245 AGATTTAAGATGCAGTTTATGGG + Intergenic
1010036323 6:71329563-71329585 GGATGCAGGATGCATTTTGGAGG + Intergenic
1010722563 6:79300368-79300390 AGATGCAAGAGGAAATTTGGGGG + Intergenic
1011143349 6:84185087-84185109 ATTTGTAAGATTCAATTTGCAGG - Intronic
1011785091 6:90834875-90834897 AGATTTAAGAAGCATTTTGAGGG - Intergenic
1012309619 6:97705978-97706000 AGATGTTAGGTGCAGTTTTGTGG + Intergenic
1013868803 6:114730880-114730902 ACATGTAACATGCAATGGGGTGG - Intergenic
1015827172 6:137326570-137326592 AGATGTGAGTTGCAAATTGAAGG - Intergenic
1016193532 6:141301685-141301707 AGAAGTGAAATGGAATTTGGAGG + Intergenic
1016331363 6:142955285-142955307 GGATGTAACTTGCAATTGGGTGG + Intergenic
1016902929 6:149119546-149119568 AGCAGTAAGATGCAATAAGGTGG - Intergenic
1017391037 6:153939690-153939712 ATATGTTAGATGCATATTGGTGG + Intergenic
1020150884 7:5680887-5680909 AGATGTGAGGTGCATTTTGGAGG - Intronic
1021213259 7:17883050-17883072 AGAAGTAATAAGCAAATTGGTGG + Intronic
1021499774 7:21319767-21319789 AGTTTTAACATGCATTTTGGAGG - Intergenic
1021864477 7:24941255-24941277 AGAAGTAAGACCCAATTAGGAGG - Intronic
1023601508 7:41885760-41885782 ATAAGGAAGAAGCAATTTGGGGG + Intergenic
1024128078 7:46321415-46321437 GTATGTAAGATGCCCTTTGGTGG + Intergenic
1024772187 7:52736281-52736303 ACATGTAAGATACATTTTAGAGG + Intergenic
1027298036 7:76798716-76798738 ACATGTAAGATGACACTTGGAGG - Intergenic
1028679041 7:93504260-93504282 AAATGTAAGATAGAATTTGTTGG - Intronic
1028796072 7:94906253-94906275 AGATGTAACAGGCAATGTGAGGG - Intergenic
1028870049 7:95760711-95760733 AAATCTAACATGCAAGTTGGTGG + Intergenic
1032730722 7:134640128-134640150 AGATGTAACACGCAACTGGGAGG - Intergenic
1032978509 7:137253463-137253485 AACTGGAAGAAGCAATTTGGCGG - Exonic
1034608428 7:152341041-152341063 AGATGTATGTTGTAATTTGTTGG - Intronic
1036676489 8:10838407-10838429 AGGTGTAAAATGCTATTTGTAGG - Intronic
1037639791 8:20732108-20732130 AGAGGAAAGATGGGATTTGGTGG - Intergenic
1037725264 8:21478193-21478215 ACATTTAAGATGCCATTTGGAGG - Intergenic
1043021887 8:75012211-75012233 AGACGTATGGGGCAATTTGGAGG + Intronic
1044731976 8:95236255-95236277 TGTTGTAAGATGAAAGTTGGTGG + Intergenic
1045986076 8:108251182-108251204 AGATCTAAGATGGACTTTGGTGG + Intronic
1048516350 8:135115070-135115092 AGATGTAAGAAACCATTTGTGGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052083147 9:24231465-24231487 AAATGTAAGATGCATTTTGAAGG + Intergenic
1053053999 9:34983048-34983070 AGATTGGAGATGCCATTTGGGGG + Intergenic
1056388525 9:86119162-86119184 AGATCTAACTTGGAATTTGGGGG + Intergenic
1057007368 9:91572568-91572590 AGAGGTAAGAAGAAATATGGGGG + Intronic
1058217004 9:102246967-102246989 AGATTTAATATGAATTTTGGGGG + Intergenic
1059557863 9:115299494-115299516 AGACATAAGATGAAACTTGGGGG + Intronic
1061941308 9:133885649-133885671 AGCTGTTAGATGGAAATTGGAGG - Intronic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1186980657 X:14954518-14954540 AGCTATAAGATGAAATTTGGTGG + Intergenic
1189227473 X:39424950-39424972 AACTGTGAGAAGCAATTTGGTGG + Intergenic
1191648022 X:63505070-63505092 AGATGTATGATCCTATTGGGAGG + Intergenic
1195635933 X:107116150-107116172 AGATGTAAGAGAAAATTTGCTGG - Intronic
1197171324 X:123437646-123437668 AGATTTATGATTCATTTTGGAGG + Intronic
1202119220 Y:21507415-21507437 AGTTGTAAGATACATTTTGATGG - Intergenic
1202121672 Y:21530955-21530977 AGTTGTAAGATACATTTTGATGG - Intronic
1202157333 Y:21898427-21898449 AGTTGTAAGATACATTTTGATGG + Intronic
1202159780 Y:21921968-21921990 AGTTGTAAGATACATTTTGATGG + Intergenic