ID: 1118705611

View in Genome Browser
Species Human (GRCh38)
Location 14:68477673-68477695
Sequence TGACCTTTGTCTAGAGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118705609_1118705611 1 Left 1118705609 14:68477649-68477671 CCAAGAGAAGCCATAGGGATACT 0: 1
1: 0
2: 3
3: 5
4: 129
Right 1118705611 14:68477673-68477695 TGACCTTTGTCTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 115
1118705606_1118705611 9 Left 1118705606 14:68477641-68477663 CCTTTAGGCCAAGAGAAGCCATA 0: 1
1: 1
2: 2
3: 13
4: 142
Right 1118705611 14:68477673-68477695 TGACCTTTGTCTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 115
1118705610_1118705611 -9 Left 1118705610 14:68477659-68477681 CCATAGGGATACTGTGACCTTTG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1118705611 14:68477673-68477695 TGACCTTTGTCTAGAGTTGATGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118705611 Original CRISPR TGACCTTTGTCTAGAGTTGA TGG Intronic