ID: 1118705689

View in Genome Browser
Species Human (GRCh38)
Location 14:68478205-68478227
Sequence CTGTGTCAGAGGGAGGTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118705689 Original CRISPR CTGTGTCAGAGGGAGGTCGA TGG Intronic
900935026 1:5759555-5759577 CTGTGTCAGGCAGAGGGCGAGGG + Intergenic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901123178 1:6911337-6911359 CAAGGTCACAGGGAGGTCGAAGG - Intronic
901209080 1:7514478-7514500 ATGTGTCAGAGGGAGCACCAGGG + Intronic
901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG + Intronic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903287481 1:22285960-22285982 ATGTGTAGGAGGGAGGTCCAGGG - Intergenic
907111589 1:51931353-51931375 CTGTGACAGAGGGATGTTGGGGG - Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
912022064 1:105117704-105117726 CTATGTCAGAGGGAAGACGGAGG - Intergenic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
915593923 1:156885784-156885806 GGGTGTCAGAGGGAGGGAGAAGG - Intergenic
918569499 1:185972115-185972137 CTGTGCCGGAAGGAGGTAGAAGG - Intronic
919640224 1:200039230-200039252 CTGAGCCAGAGGGCGGTGGAGGG + Intronic
919971460 1:202582537-202582559 GTGTTTCAGAGGGAGGACCATGG - Exonic
922110862 1:222553775-222553797 CTGTGACAGAGGGAGTCTGAAGG - Intergenic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
1063422215 10:5922035-5922057 CTGTTTCACAGGGAGTTAGAAGG + Intronic
1065603475 10:27392983-27393005 CTGTGACAGGAGGAGGTCCAGGG + Intergenic
1067091664 10:43268792-43268814 TTGACTCAGAGGGAGGTGGAGGG + Intergenic
1067582265 10:47453114-47453136 CTGGGCCAGAGGGAGCTCCAGGG - Intergenic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1070161040 10:73866904-73866926 CAGTGTCAGGGTGAGGTCGGTGG - Intronic
1071411242 10:85399143-85399165 CTGTGTCTGGGGGAGGTAGTTGG - Intergenic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1074120067 10:110487529-110487551 CTCTGGCAGAGGGAGGGGGAAGG - Intergenic
1075454851 10:122578504-122578526 CTCTCTCAGAGAGAGGTGGAAGG + Intronic
1075622792 10:123940033-123940055 CTGGGACTGAGGGATGTCGATGG - Intronic
1078880573 11:15444924-15444946 CTGTGTCAAAGGGCGGGTGAGGG + Intergenic
1080957944 11:37123428-37123450 CTGTGTCAAAGAGAAGTAGATGG - Intergenic
1083327250 11:61879002-61879024 CTGAGTCCCAGGGAGGTGGAGGG + Intronic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085532952 11:77202537-77202559 CTGGGTCAGAGGGAGCTGGAGGG + Intronic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1088217078 11:107522952-107522974 CTGTGTGAGAGGGGGCCCGAAGG - Intronic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1089757133 11:120695332-120695354 CTGGGCCAGAGGGAGGGCCAGGG - Intronic
1090414760 11:126533366-126533388 CAGTGGGAGAGGGAGGTCTAAGG - Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092252447 12:6907454-6907476 CTGGGTCAGAGGGTGGTGCAGGG + Intronic
1094263366 12:28527233-28527255 CTCTGTCAGAAGAAGGTCTAGGG + Intronic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1101634542 12:106527524-106527546 CTGAGTCAGAGGAAGTTAGAGGG - Intronic
1106101155 13:26695923-26695945 CTTTGTCAGAACGAGGTCGGGGG - Intergenic
1108557386 13:51607926-51607948 CTTTGTAAGAGGGAGGCAGAAGG + Intronic
1111057062 13:82964846-82964868 CTGAGGCAGAAGGAGGTTGAGGG + Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113582659 13:111440000-111440022 AGGGGTCAGAGGGAGGTGGATGG + Intergenic
1113783175 13:112988123-112988145 CCGATTCAGAGGGAAGTCGACGG + Intronic
1113879028 13:113612339-113612361 CCCTGTCAGAGGGAGGTGGTGGG + Intronic
1114663772 14:24367124-24367146 TTGTGTGAGAGGGAGTTAGATGG - Exonic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1120543203 14:85777284-85777306 CTCTGTCTGAGGGAAGTAGAGGG - Intergenic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1122897464 14:104767419-104767441 CTGTGTCAGAGGTACCCCGAAGG - Intronic
1123630474 15:22257290-22257312 CGGTGTAAGAGGGAGGTAGTGGG - Intergenic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1127882380 15:63169717-63169739 TTGTGTCATAGGGAAGTGGATGG - Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1130839303 15:87682744-87682766 CTGTGGCAGAGGGAGGAATAAGG - Intergenic
1131764702 15:95662760-95662782 CTGTGTCAGTGAGATGTCAATGG - Intergenic
1131817129 15:96233610-96233632 CTGTCTCAGAGGGCAGTCTACGG - Intergenic
1133437094 16:5789089-5789111 CTGTGTGAGAGAGAGGAAGAGGG - Intergenic
1133453581 16:5923359-5923381 CTGAGTCAGAGGGATGCCAAAGG + Intergenic
1134053305 16:11152786-11152808 CAGTGTCAGAGGGAGGCTGGAGG - Intronic
1135763098 16:25153432-25153454 CTGTGTGAGAGAGAGGTGAAGGG + Intronic
1136547512 16:30964105-30964127 CTGTGTCAGAGGAAGAGCGGCGG - Exonic
1138619283 16:58198287-58198309 CTGTGGCGGCGGGAGGGCGAGGG - Intergenic
1139084776 16:63571528-63571550 CCTTGTCAGAGGGAGGCAGAAGG + Intergenic
1140200809 16:72893288-72893310 CTGTTTCATAGGGAGGTAGTGGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141145116 16:81523801-81523823 CTGTGTCTGAGCGAGGTTCAGGG - Intronic
1141972616 16:87493357-87493379 CGGTGTAAGAGGGAGGTAGTGGG + Intergenic
1142285447 16:89169772-89169794 TTGTGTCAGAGGTAGGTGGCAGG - Intergenic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1145275954 17:21430606-21430628 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145313800 17:21716519-21716541 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1145712242 17:26988493-26988515 CTTTATCAGAGGGAGGCAGAGGG + Intergenic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1150132937 17:62679091-62679113 GTGTCTCAGAGGGAGGCCCATGG - Intronic
1151482891 17:74380519-74380541 CTGTCTCCCAGGGATGTCGAAGG + Intergenic
1152831111 17:82497460-82497482 CTGGGTGGGAGGGAGGTCGGCGG - Intergenic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1158617911 18:59004921-59004943 CTGTGTCTCAGGTAGGTCCAGGG + Intergenic
1160592968 18:79954150-79954172 CTTTGTAAGAGGGAGGCAGAAGG + Intergenic
1161455189 19:4366431-4366453 CTGTGTCAGAGGGAAGGCAGGGG - Intronic
1161650006 19:5478476-5478498 CTGTGGAAGAGGGAGGCCGCTGG + Intergenic
1164610419 19:29627943-29627965 CTGTGACAGAGGGAGGGCTGGGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1164816137 19:31204865-31204887 CTGTGTCGAAGGGAGGACCAAGG - Intergenic
1165475779 19:36029938-36029960 CTGACTCAGTGGGAGGTCGGAGG - Intronic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167742346 19:51331287-51331309 CAGTGATAGAGGGAGGTAGAGGG + Intergenic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168281282 19:55306745-55306767 CTGAGTCATAGGGAGGTCAATGG + Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925619136 2:5773662-5773684 CTGGGTGAGAGGGAGGCCGTGGG - Intergenic
925774319 2:7319190-7319212 CTGAGGGAGAGGGAGGTAGAAGG - Intergenic
929536622 2:42788077-42788099 GGGTGGCAGAGGGAGTTCGAGGG - Intronic
930294896 2:49542940-49542962 TTGTGTCAGAGGGCTGTGGAAGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933917841 2:87014502-87014524 CTTTGTGAAAGGGAGGTCTAGGG + Intronic
934005154 2:87755412-87755434 CTTTGTGAAAGGGAGGTCTAGGG - Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935768111 2:106389504-106389526 CTTTGTGAAAGGGAGGTCTAGGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937249198 2:120512549-120512571 GGGTGTCAGAGGGAGGAGGAAGG + Intergenic
937296922 2:120815017-120815039 CTGAGACAGGGAGAGGTCGATGG + Intronic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
943145734 2:184042768-184042790 CTGTGTCAAGGGGAGGACCAGGG + Intergenic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
948113976 2:235480002-235480024 TTGTGTCTGAGGGAAGTAGAAGG - Intergenic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174038140 20:47680660-47680682 CTGTGTCATGGGGGGCTCGAAGG + Intronic
1174794487 20:53510772-53510794 CTTTGCAAGAGGGAGGTCCAGGG - Intergenic
1175259027 20:57663405-57663427 CTGTGTCAGCGGGGGGACGGTGG + Intronic
1175421174 20:58834669-58834691 CTGTGGCAGAGGGAGAGAGAGGG + Intergenic
1178393058 21:32215005-32215027 CTCTGTGAGAGGGAGGGCAATGG + Intergenic
1178672042 21:34600099-34600121 CTGTGTCATAGGGAGGTACCAGG - Intronic
1179589730 21:42398578-42398600 GTGTGTCAGATGTAGGTCAAAGG + Intergenic
1180249142 21:46568116-46568138 CTGTTTCACAGGGAGGCTGATGG + Exonic
1181434522 22:22902616-22902638 CTGTGACCAAGGGAGGGCGAAGG - Intergenic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
950312393 3:11969999-11970021 AGGTGTCAGAAGGAGGTGGATGG + Intergenic
950400578 3:12766677-12766699 CAGTGTCAGAGGGTGGCCGATGG - Intronic
952020202 3:29009706-29009728 CTGTGTCTGAGGGATGGAGAAGG + Intergenic
952408307 3:33025599-33025621 CTGTGGCGGAAGGAGGTCGTGGG + Intronic
952408320 3:33025658-33025680 CTGTGGCGGAAGGAGGTCGTGGG + Intronic
952408333 3:33025717-33025739 CTGTGGCGGAAGGAGGTCGTGGG + Intronic
952732565 3:36653935-36653957 CTATGTCAGAGGGAGGTTATGGG - Intergenic
953405204 3:42656519-42656541 CTGGGACAGAGGGAGATGGATGG + Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
956116685 3:65926381-65926403 CTCTGACAGAGGGAGGTGTAGGG - Intronic
956488107 3:69742512-69742534 CTGTAGCAGAGGGAGGTAGGAGG - Intronic
960921011 3:122747469-122747491 CTGTCTGGGAGGGAGGTCGGGGG + Intronic
961496734 3:127298538-127298560 CAATGCCAGAGGGAGGTCGATGG + Intergenic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
970594343 4:17586110-17586132 CTGTGTCAGTGGGAGGCTGTTGG + Intronic
972169110 4:36323267-36323289 CTGTGTCAAAGGGAGGAAGCAGG + Intronic
973839549 4:54846898-54846920 CTGTTTCATAGGGTGGTTGAAGG + Intergenic
975178826 4:71319803-71319825 CTGAGTCAGAGGGAGAAGGAGGG + Intronic
975872723 4:78798358-78798380 GTGTTTCAGAGGTGGGTCGAAGG + Intronic
979561736 4:122108797-122108819 CTCTGTCAGAGGGAAGTCTAGGG - Intergenic
979638468 4:122983993-122984015 CTCTGTCAGAAGAAGGTCTAGGG - Intronic
980985750 4:139692518-139692540 CTGTGGCAGAGGGAGATTAAGGG + Intronic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
985008520 4:185559367-185559389 CTCTGTCACAGGAAGGTCTAGGG + Intergenic
985726261 5:1517329-1517351 CTGTGTCAGAGGCAGGGACATGG + Intronic
985890473 5:2711677-2711699 CTGTGTCATAGAGATGTTGATGG - Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
990744924 5:58950077-58950099 CTGCGTTAGGGGGAGGTCAATGG - Intergenic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
995785344 5:115821807-115821829 CTGTTTCAGAGGGAGTTCAGGGG + Intergenic
997324624 5:133009756-133009778 CTGTGTCAGAGTTAAGACGAAGG + Intronic
997522609 5:134532831-134532853 CTGTGACAGTGGGAGCTCGCTGG + Intronic
997662126 5:135597392-135597414 CAGTGTCAGAGGCAGGTCGGAGG - Intergenic
997838907 5:137220132-137220154 ATGTTTCAGAGGGAGGAAGATGG + Intronic
997975801 5:138440612-138440634 CTGGCTCTGAGGGAGGTGGAGGG + Intronic
998179432 5:139926096-139926118 CTGTGTCAGAGGAAGGCCCTAGG - Intronic
998564583 5:143205619-143205641 CTATGTCAGAGGGAGTACGCTGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000671263 5:164066122-164066144 CTGTTGCAGAGGGAAGTCGAAGG - Intergenic
1001425960 5:171622835-171622857 GTGTGAAAGAGTGAGGTCGAGGG - Intergenic
1003027061 6:2564500-2564522 CTGGGTCAGAGGGAGTTCCCAGG + Intergenic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004509096 6:16270186-16270208 CTGTGTCAAGGAGAGGTTGAAGG - Intronic
1007854254 6:44838416-44838438 CTGTGTAAGAGGGCAGTAGAGGG + Intronic
1008115603 6:47545867-47545889 CTCTGTCAGAGGGAAGTGTAGGG - Intronic
1009332409 6:62440666-62440688 CTATGTCAGAGGGAAGACGTTGG + Intergenic
1010380206 6:75215413-75215435 CTGCTTCAGAGGGAGGAAGAGGG + Intergenic
1011168716 6:84479992-84480014 CTCTGTCAGAGGGGGTTCTAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017986150 6:159444797-159444819 CTGTGTCAGAGAGAAGTCATGGG + Intergenic
1018128954 6:160709678-160709700 CTTTGTGAAAGGGAGGTCTAGGG - Intronic
1019550221 7:1598525-1598547 ATGTGTCAGAGGGAGGCAGCAGG + Intergenic
1027525270 7:79261274-79261296 GTGTGTCGGAGGGACGTCAAGGG - Intronic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1029437664 7:100572123-100572145 CTGTGTTAGGCGGAGGGCGAGGG - Intergenic
1029711883 7:102304245-102304267 CTGTGTGAGAGGGAAATCTAAGG - Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1035769209 8:2133459-2133481 CTCTGTCGGAGGCAGGTAGATGG - Intronic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1037539644 8:19858461-19858483 CTGTGTGAGAGGGAGCCTGAAGG + Intergenic
1037816678 8:22116235-22116257 CTGTGGCACAGGGAGGTGGGAGG + Intronic
1038004512 8:23418324-23418346 CTGCCTCACAGAGAGGTCGAGGG - Intronic
1038740561 8:30213135-30213157 CTGTCTCAGAGGGAGGAGCAGGG + Intergenic
1039864926 8:41491869-41491891 CTCTGTGACAGGGAGGACGAGGG + Intronic
1040038216 8:42891885-42891907 CTGTGTCCTAGGGAGGGTGATGG - Intronic
1041352354 8:56960403-56960425 CTGTGTCAGAGGGAGAGGGGTGG - Exonic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1042770857 8:72380798-72380820 CAGTGACAGAGAGAGGTGGAGGG + Intergenic
1042927668 8:73983066-73983088 ATGTGTATGAGGGAGGTTGATGG + Intergenic
1044958492 8:97506133-97506155 CTGTATCAAAGGGAGGCAGAGGG + Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047626054 8:126657227-126657249 CTGTGTCAGACAGGAGTCGAAGG + Intergenic
1048257827 8:132918606-132918628 CTCTGCCAGAGGGAGGTGGCTGG + Intronic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1051220434 9:14843171-14843193 CAGTGTCAGAGGGAAGAAGATGG - Intronic
1052650110 9:31291147-31291169 CTCTGCCAGAGGGAGTTCCATGG + Intergenic
1053188110 9:36036453-36036475 CCGTGTCTGCGGGAGGCCGAAGG + Exonic
1054852592 9:69864000-69864022 CTGTGTGAGAAGCAGGTCCATGG + Intronic
1057810697 9:98254936-98254958 CTGAGTCAGAGGGAGATGAAAGG - Intronic
1058872335 9:109213362-109213384 CATTGTCAGAGGGAGATAGAGGG + Intronic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1061875295 9:133540511-133540533 CTGTCTCAGAGGGAGGAAAAGGG + Intronic
1062733374 9:138121286-138121308 CTGTGTGCGGGGGAGGGCGATGG - Intronic
1187075377 X:15929499-15929521 CTGTGGTAGAGGGAGGTCTTTGG + Intergenic
1188842100 X:35028850-35028872 CTGTGTCTGAGGGAGGTACCTGG - Intergenic
1194095234 X:89631706-89631728 CTATGTCAGAGGGAGGACCTGGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197364393 X:125545552-125545574 CTGTGTCAGAGGGAAGTTCTGGG - Intergenic
1199748853 X:150795355-150795377 CTGTCTCAGAGGGAGCCCCATGG + Intronic
1200447868 Y:3287884-3287906 CTATGTCAGAGGGAGGACCTGGG + Intergenic
1202059368 Y:20869711-20869733 CTGTGCCACAGGAAGGTCTAGGG + Intergenic