ID: 1118706467

View in Genome Browser
Species Human (GRCh38)
Location 14:68484841-68484863
Sequence GTATGCAGGACAAAATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118706467_1118706469 14 Left 1118706467 14:68484841-68484863 CCAGCAGATTTTGTCCTGCATAC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 1118706469 14:68484878-68484900 TCAAAACTTCAGTTTGCACATGG 0: 1
1: 0
2: 4
3: 26
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118706467 Original CRISPR GTATGCAGGACAAAATCTGC TGG (reversed) Intronic
900178240 1:1300053-1300075 GCATGAAGGACAGCATCTGCGGG + Exonic
900523646 1:3117858-3117880 GAATGCAGGACAAAGGCTCCAGG + Intronic
908787104 1:67746057-67746079 GTATGCAGGACTAAAGCTCTTGG + Intronic
920187562 1:204170544-204170566 GGATGTAGGACCACATCTGCTGG - Intergenic
921612025 1:217223488-217223510 GTGTCCAGGACAAATTCTTCAGG + Intergenic
1073856285 10:107678468-107678490 ATATGCAGGGCAAATTCTGTTGG + Intergenic
1079496753 11:21052891-21052913 GTAGGCAGGACCAAATCAGGTGG + Intronic
1081086775 11:38811503-38811525 ATATGCAGGATATAATCTCCTGG - Intergenic
1081647672 11:44801070-44801092 GTATGGATGCTAAAATCTGCAGG + Intronic
1082568941 11:54714360-54714382 ATGTGCAGGATAAAATCTCCTGG + Intergenic
1088766054 11:112979885-112979907 GTATGCAAAACAAAAACAGCTGG + Intronic
1090812789 11:130261745-130261767 GTGTCCAGGACAAAATCTTCCGG - Exonic
1091910260 12:4224998-4225020 GTATGCAAGATAAAAGCTGTTGG + Intergenic
1092628520 12:10354376-10354398 CTTTGCAGGACCAAATCTACTGG - Intergenic
1095906185 12:47380403-47380425 GTATCCACGAGAAAATCTGAAGG - Intergenic
1098041088 12:66354714-66354736 CTATGCAGGGCAAAATGTGAAGG + Intronic
1100217186 12:92463853-92463875 TTATGCAGAAAAAAATCTGAGGG - Intergenic
1102174330 12:110865082-110865104 GTAAGCAGGACTAAACCAGCTGG - Intronic
1104227645 12:126851513-126851535 TTATGCAGGATAAAAGATGCTGG - Intergenic
1107075037 13:36314573-36314595 GTATTCAGGAAGAAAACTGCAGG - Intronic
1108949317 13:56068936-56068958 GGATGCACAGCAAAATCTGCAGG - Intergenic
1114245647 14:20910908-20910930 GTGTGCAGGATATAATCTCCTGG - Intergenic
1118706467 14:68484841-68484863 GTATGCAGGACAAAATCTGCTGG - Intronic
1122786242 14:104164482-104164504 GCCTGCAGCACAAAATGTGCTGG + Intronic
1124456717 15:29849925-29849947 CCATGCATGACCAAATCTGCAGG - Intronic
1127760610 15:62135903-62135925 GTGTGCAGGACATAATGTGTGGG + Intergenic
1128580767 15:68808064-68808086 GGATGCAGGATTTAATCTGCTGG - Intronic
1133756187 16:8764326-8764348 GTGTGCAGGACAAAAGGAGCTGG + Intronic
1133840643 16:9406214-9406236 GTCAGTAGGATAAAATCTGCAGG + Intergenic
1136661548 16:31767417-31767439 GTCTGAAGGACAAACTCGGCAGG - Intronic
1137066853 16:35855726-35855748 GTTTGCAGGACAGACTCAGCAGG + Intergenic
1137333147 16:47520992-47521014 GTATACAGAATAAAATATGCAGG - Intronic
1137448595 16:48549663-48549685 GTATGCAAGACCAGATCTGATGG - Intronic
1138933917 16:61695521-61695543 GTGCTCAGGACAGAATCTGCAGG - Intronic
1144464502 17:15486222-15486244 TTATGCAGGATAATATCTTCAGG - Intronic
1146829937 17:36059758-36059780 GTTTGAAGGACAAGCTCTGCTGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150829678 17:68508165-68508187 ATATACAGTCCAAAATCTGCAGG - Intergenic
1156559566 18:38107306-38107328 GTATGCAGGAAAGAATCTGAAGG + Intergenic
1157737214 18:50060712-50060734 GTATGTAGGAGAACAGCTGCTGG - Intronic
1159179908 18:64889448-64889470 GAATTGAGGACAAAATCTTCTGG + Intergenic
1160334036 18:78021124-78021146 ATTTTCAGGACAAATTCTGCTGG + Intergenic
1165276693 19:34759224-34759246 TTATGCCGAACAAAATTTGCAGG + Exonic
1167782272 19:51606633-51606655 ATATGCAGGATAGAAGCTGCAGG - Intergenic
925100848 2:1244074-1244096 GCCTGCAGGGCAAACTCTGCTGG - Intronic
925248111 2:2402803-2402825 ATATGCAGGAGATAATGTGCAGG - Intergenic
927052080 2:19339715-19339737 GAATAGAAGACAAAATCTGCGGG + Intergenic
927633172 2:24792092-24792114 GTAGGCAGAACAGAAGCTGCTGG - Intronic
933913924 2:86969260-86969282 TGAAGCTGGACAAAATCTGCTGG + Exonic
934009069 2:87800638-87800660 TGAAGCTGGACAAAATCTGCTGG - Exonic
935772656 2:106441326-106441348 TGAAGCTGGACAAAATCTGCTGG - Exonic
935907415 2:107854588-107854610 TGAAGCTGGACAAAATCTGCTGG + Exonic
935993814 2:108746743-108746765 TGAAGCTGGACAAAATCTGCTGG + Exonic
936129205 2:109819728-109819750 TAAAGCTGGACAAAATCTGCTGG + Exonic
936215492 2:110551757-110551779 TAAAGCTGGACAAAATCTGCTGG - Exonic
936424629 2:112406330-112406352 TAAAGCTGGACAAAATCTGCTGG - Exonic
939349367 2:141014699-141014721 TTATGTAGGCCAAAATGTGCTGG + Intronic
941107399 2:161371729-161371751 TTATGCAGGACATATTCTGGAGG + Intronic
942888043 2:180952593-180952615 GTAAGCAGGACTGAATCTGAAGG - Intergenic
943088707 2:183348686-183348708 GTAAGCATTACAAATTCTGCTGG + Intergenic
945406285 2:209452709-209452731 GTATGCAGGCTAAAAACTGAAGG - Intronic
945753229 2:213814170-213814192 GTCTTCAGTACAAAATCTGCAGG + Intronic
1170159203 20:13295461-13295483 TTATGCAGGAAAAAATCTGCTGG - Intronic
1171203283 20:23258742-23258764 GACTGCAGGACAAAATTTCCAGG + Intergenic
1172415023 20:34758183-34758205 ATATACAGAGCAAAATCTGCTGG + Intronic
1172529031 20:35617895-35617917 GGATGTAGGAGAAAATGTGCTGG - Intronic
1178003646 21:28192579-28192601 GTAGGCAGGAGAACATGTGCAGG + Intergenic
1179476671 21:41651022-41651044 GCAGGCAGGACAGACTCTGCAGG - Intergenic
1183496423 22:38147327-38147349 GTATGCAAGACAAAACCTTTTGG - Intronic
1184406970 22:44305822-44305844 GTATGCTGGACAAAAGCCCCAGG + Intronic
953441299 3:42920212-42920234 GTATGAATGACAAAATGTCCAGG + Intronic
955812261 3:62803824-62803846 GGATGTAGGACAAGATCAGCAGG - Intronic
956639421 3:71401652-71401674 GTATGCAAGACAACCTTTGCTGG + Intronic
959446312 3:106444173-106444195 ATATGCAAGTCAAAATATGCTGG + Intergenic
962811110 3:138960384-138960406 GGCTGCAGGACAAAGACTGCGGG + Intergenic
965518802 3:169651852-169651874 GCATGGGGGAAAAAATCTGCTGG + Intronic
965935701 3:174108224-174108246 GAATGCAGGAGAAAATCTTTGGG - Intronic
966422078 3:179744011-179744033 GTTTCCAGGACCAGATCTGCTGG + Intronic
970384475 4:15542574-15542596 GTATGACTGACAAAGTCTGCAGG + Intronic
972185737 4:36525647-36525669 TAAAGAAGGACAAAATCTGCTGG - Intergenic
978407011 4:108390827-108390849 GTAAGCAGCAAAAATTCTGCAGG + Intergenic
979165513 4:117524839-117524861 GTTTCCAGAAGAAAATCTGCAGG - Intergenic
979936460 4:126703338-126703360 GTATGGAAGTCAAAACCTGCAGG - Intergenic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
991309241 5:65217016-65217038 GTATGAAGGACAAGAGCTGGAGG - Intronic
991628204 5:68626824-68626846 ATTTACAGGATAAAATCTGCAGG + Intergenic
995663893 5:114519473-114519495 GTCTGCAGGACAGACTCGGCAGG - Intergenic
1008795584 6:55298932-55298954 TTAGACAGGACAAAATCTTCTGG + Intergenic
1009350955 6:62678225-62678247 GTTTGCAGGCCAGAATCTGGAGG + Intergenic
1009988740 6:70814616-70814638 GTAGGCAGGACGAAATCAGATGG - Intronic
1011375568 6:86682566-86682588 GTATCCTGGACAGAATCTGGGGG - Intergenic
1013733703 6:113201855-113201877 GTATGCATGTAAAAATATGCAGG + Intergenic
1020774815 7:12440197-12440219 GTATGCAGAACAACATCAGAAGG - Intergenic
1024783265 7:52876479-52876501 GTATGTAGTACAAAATCATCTGG - Intergenic
1026259272 7:68740281-68740303 GGATGCACCACAAAATCTTCTGG - Intergenic
1026581482 7:71622154-71622176 GGACCCAGCACAAAATCTGCGGG + Intronic
1028660755 7:93270589-93270611 GTATCCAGGACTAGACCTGCTGG + Intronic
1030218164 7:107067977-107067999 TTATGCAGGACAAAAGTTGAAGG + Intronic
1031165737 7:118224988-118225010 ATATGCAGGACAAAAAATACAGG + Exonic
1031301196 7:120063311-120063333 GTATACAGGATAACAACTGCTGG + Intergenic
1038324951 8:26566089-26566111 TTATTCAGGACATAATCAGCTGG - Intronic
1043800362 8:84602029-84602051 GTATGCAGTACAAATGCTGAAGG - Intronic
1045029125 8:98118107-98118129 GTATGTAGGACAAAATGAGAGGG - Intronic
1047256731 8:123219043-123219065 TTGTGCAGGACAACATTTGCTGG + Intergenic
1047276830 8:123412029-123412051 GGTTCAAGGACAAAATCTGCAGG - Intronic
1049305802 8:141903201-141903223 GTAGGCAGGAGACAAACTGCTGG + Intergenic
1051323300 9:15934631-15934653 ATATGCAGGAGTAAATTTGCTGG - Intronic
1052922463 9:33982668-33982690 GTATGCTAGATAAATTCTGCAGG - Intronic
1054848570 9:69822320-69822342 GTTTGCAAGACAGAAACTGCAGG - Intronic
1056743590 9:89281578-89281600 GTTTGCAAGACAAAATCTTGAGG + Intergenic
1185576068 X:1173244-1173266 CTATGCAGGACACAAACTGAAGG - Intergenic
1188946078 X:36303922-36303944 ATATCCAGGACAAAATTTTCAGG - Exonic
1189555402 X:42139637-42139659 GTATTTAGGACAAAAACAGCAGG - Intergenic
1195807306 X:108789416-108789438 GAATGAAGGACAAAATCTATAGG - Intergenic
1196722319 X:118865890-118865912 GGATACAGAACAAAAGCTGCAGG + Intergenic
1199685653 X:150263039-150263061 GGAGGCAGGACATAAACTGCTGG - Intergenic
1200032506 X:153307617-153307639 GCAGGCAGGACAGAATCTCCAGG - Intergenic
1201447767 Y:14077002-14077024 GGATACAGGATAAAATCTCCTGG + Intergenic