ID: 1118709693

View in Genome Browser
Species Human (GRCh38)
Location 14:68509128-68509150
Sequence CTGGATAAAGGTGGTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118709688_1118709693 -10 Left 1118709688 14:68509115-68509137 CCAGCCACTGGGCCTGGATAAAG 0: 1
1: 0
2: 0
3: 42
4: 820
Right 1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1118709680_1118709693 18 Left 1118709680 14:68509087-68509109 CCAGCTAGGGCCAGAGGGCCTGG 0: 1
1: 0
2: 3
3: 27
4: 357
Right 1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1118709683_1118709693 8 Left 1118709683 14:68509097-68509119 CCAGAGGGCCTGGGCTCACCAGC 0: 1
1: 0
2: 3
3: 33
4: 318
Right 1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1118709686_1118709693 0 Left 1118709686 14:68509105-68509127 CCTGGGCTCACCAGCCACTGGGC 0: 1
1: 0
2: 2
3: 45
4: 382
Right 1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 204
1118709679_1118709693 19 Left 1118709679 14:68509086-68509108 CCCAGCTAGGGCCAGAGGGCCTG 0: 1
1: 0
2: 2
3: 22
4: 227
Right 1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118709693 Original CRISPR CTGGATAAAGGTGGTTTTCA AGG Intronic
902425014 1:16313672-16313694 TTGCATCAAGGTGGTTCTCATGG - Intronic
905026070 1:34850590-34850612 CTAGATAAAGGAGGTTTTACTGG + Intronic
905418481 1:37821780-37821802 CCAGAAAAAGGTTGTTTTCAAGG - Intronic
905451921 1:38062503-38062525 CTGGAAAAAGGGGGTTTTCTGGG + Intergenic
906455175 1:45989343-45989365 CTTGATAAAGTTGTTTCTCAAGG - Intronic
906577887 1:46907360-46907382 CAGAATAATGGTGATTTTCAGGG + Intergenic
907411315 1:54285748-54285770 GTGAATAATGGGGGTTTTCAGGG - Intronic
908181938 1:61614435-61614457 CTGGTTAAATAAGGTTTTCATGG - Intergenic
911059522 1:93735682-93735704 ATGGATAAATGAGCTTTTCATGG - Intronic
913518032 1:119621949-119621971 CTGGGTCAAGGTGGTTTACCTGG - Exonic
915886193 1:159723567-159723589 CAGGATAACAGTGATTTTCAGGG - Intergenic
918799059 1:188948114-188948136 CTGTAGAAAGATGGTTATCAGGG - Intergenic
919373512 1:196763001-196763023 CTGGACCAGGGTGGTTTCCAGGG + Intergenic
919379953 1:196847678-196847700 CTGGACCAGGGTGGTTTCCAGGG + Intronic
1065196816 10:23274618-23274640 CAGGATAACAGTGATTTTCAGGG - Intronic
1065790559 10:29256409-29256431 CTGGGTAAGGGTGGTGGTCATGG - Intergenic
1066621253 10:37353855-37353877 CAGGATAACAGTGATTTTCAGGG + Intronic
1068071722 10:52204823-52204845 CAGGATAACAGTGGTTTTCAGGG + Intronic
1068152833 10:53156048-53156070 CAGGATAACAGTGATTTTCAGGG - Intergenic
1068464039 10:57364747-57364769 CTTGATGAAGGAGGCTTTCAGGG + Intergenic
1068504054 10:57876687-57876709 CTGGATAAAGGAGATCTTAAAGG - Intergenic
1068666364 10:59679819-59679841 CTGCATAAAGGTAATTTGCATGG + Intronic
1072149396 10:92673629-92673651 ATGGATTAAGGTTGTTATCACGG - Intergenic
1073357498 10:102869136-102869158 CTGAAGAAAGATGGATTTCACGG + Intronic
1078013242 11:7590370-7590392 CTGGAGAACGGTGATTTTGAAGG + Intronic
1078440330 11:11359740-11359762 ATGGATAAAGGTTAATTTCAAGG - Intronic
1082574090 11:54781646-54781668 CAGGATAACCGTGATTTTCAGGG + Intergenic
1083082622 11:60109671-60109693 CTGGAAATAGGTGATTTCCAGGG - Intergenic
1083282702 11:61637074-61637096 CTGGAAAAAGGAGGTCTTCTCGG - Intergenic
1083664651 11:64267900-64267922 ATGAATAAAAGTGGATTTCAGGG + Intronic
1084394681 11:68901532-68901554 CTTTAAAAAGGTGGTTTTTATGG - Intronic
1084944973 11:72633465-72633487 TTGGATGAAGATGGTCTTCAGGG + Intronic
1086358059 11:86026291-86026313 TTGGATAAAAGTGGATTGCAAGG - Exonic
1086762150 11:90644740-90644762 CTGGATAGAGGTGGGATTAAGGG + Intergenic
1087509437 11:99071816-99071838 TTTGATAAATGTGTTTTTCATGG - Intronic
1087757383 11:102069114-102069136 ATGAATAAAGGTGCTATTCATGG - Intronic
1088965175 11:114713095-114713117 CAGTAGAAAGGTGGTTATCAAGG + Intergenic
1090679824 11:129043015-129043037 CTGTAAAAAGGTGGTTACCAAGG + Intronic
1091144921 11:133270643-133270665 CTGTAAACAGGTGGTTTTCGTGG + Intronic
1091645617 12:2270266-2270288 CTGGCTCAAGGTAGTTTGCAAGG - Intronic
1091993090 12:4972739-4972761 GTGGATAAAGGTGAGTTTTAAGG + Intergenic
1091999416 12:5020166-5020188 CTGGATGAGGGTGGTGTGCAAGG - Intergenic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1093705547 12:22271189-22271211 CTGCATTAAGGATGTTTTCAAGG + Intronic
1094055649 12:26266978-26267000 CTGGAAAAGTTTGGTTTTCAAGG + Intronic
1094740406 12:33281994-33282016 CAGGATAACAGTGATTTTCAGGG - Intergenic
1095358211 12:41303129-41303151 CAGGATAAAGACGGTCTTCAGGG + Intronic
1095605622 12:44063849-44063871 GTGGCTAAAGGTGGTTGCCAGGG + Intronic
1095987712 12:48010659-48010681 CAGGATAAACTTGGTTTGCAGGG - Intergenic
1096144514 12:49268757-49268779 CTGGTTTAAGCTGGTTTTAAAGG + Intronic
1098839168 12:75458356-75458378 CAGGATAACAGTGATTTTCAGGG - Intergenic
1101302034 12:103492994-103493016 CTGGATTAAGGTAGTGTTAATGG - Intronic
1101722944 12:107366279-107366301 CTGGAAAATAGTTGTTTTCAAGG - Intronic
1102644531 12:114395610-114395632 CTGGAGAAAGGGAGTTTCCAAGG - Intronic
1103337234 12:120198902-120198924 CTGGAAAAAGGAGGTCTTCTCGG + Exonic
1104085175 12:125467723-125467745 CTGGATATAGGTGTTTTTACAGG - Intronic
1106407428 13:29486073-29486095 CTGTTTATAGGAGGTTTTCATGG - Intronic
1108208278 13:48113021-48113043 CTAGACTAAGGTGGTTTTAAAGG - Intergenic
1108799064 13:54070373-54070395 CAGGATAACAGTGATTTTCAGGG - Intergenic
1109574455 13:64235079-64235101 CTGTAGAATGGTGGTTTCCAGGG + Intergenic
1109809277 13:67489974-67489996 CTTGACAATGGTGGTTTTGATGG - Intergenic
1110881364 13:80576782-80576804 CTAGATAAAGATTGTTATCAAGG + Intergenic
1112716403 13:102191140-102191162 CTGGGGAAAGGTTGTTTACAAGG - Intronic
1114406310 14:22459606-22459628 CTGGAGAAAGGTAGTTAGCATGG + Intergenic
1117344736 14:54821042-54821064 CTGGATAAAAGTGCTTTACTCGG + Intergenic
1117790871 14:59340661-59340683 CTGGATAAATTAGCTTTTCACGG - Intronic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1120702139 14:87709830-87709852 ATGGATAAAAGTGGTTTGTATGG - Intergenic
1125818580 15:42608071-42608093 CTGGACAAAGGTGTTTCTCAAGG - Intronic
1128075454 15:64822795-64822817 CTGGACAATGGGGGTCTTCAGGG - Intronic
1128624593 15:69186754-69186776 CTGGCTAAAGCTGTTTTTGAAGG + Intronic
1128637501 15:69312606-69312628 CAGGAGAAGGGGGGTTTTCATGG - Intronic
1128820825 15:70651439-70651461 ATGAATAAAGATGGTTTTAAAGG + Intergenic
1130357313 15:83145325-83145347 ATGGCTAACCGTGGTTTTCAGGG - Intronic
1131303599 15:91221633-91221655 CTGGACAAAGGTGGTGGCCATGG - Intronic
1132722667 16:1324445-1324467 CTGGGTGAACGTGGTGTTCAAGG - Intronic
1134259213 16:12637344-12637366 CTGGACACAGGTGGGCTTCAAGG - Intergenic
1137458771 16:48638819-48638841 CTGGATTAAGGTCGTTTTTTTGG - Intergenic
1138852101 16:60641622-60641644 CTGGAAACAGCTGGATTTCAGGG - Intergenic
1141780541 16:86157531-86157553 CTGGATGAAGGTGGTTTCTGGGG - Intergenic
1143295147 17:5865546-5865568 GTTGATAAGGGTGGTCTTCATGG - Intronic
1145801270 17:27686920-27686942 CGGGATAACAGTGATTTTCAGGG - Intergenic
1147531615 17:41283847-41283869 CTAGATCAAGGTGGTTTACCTGG - Intergenic
1147555642 17:41477293-41477315 CAGGATCAAGGTGGTTTTTAGGG - Intronic
1148523543 17:48306370-48306392 CTTGAAAAAGGTGGTTGTCCAGG - Intronic
1149296351 17:55265510-55265532 CGGGATAAAGGTGGGATTCAGGG - Exonic
1151289502 17:73139326-73139348 CTAGATAACAGTGGTCTTCAAGG - Intergenic
1152817444 17:82416429-82416451 CTGGAGGAAGGTTGTTTCCAGGG + Intronic
1153243469 18:3051841-3051863 CTGGCCAAGGGTGGTTCTCAAGG - Intergenic
1156883862 18:42111937-42111959 CAGGATAACAGTGATTTTCAGGG + Intergenic
1157690311 18:49676568-49676590 AAGGAGAAAGGTGGTTTCCAGGG + Intergenic
1164969531 19:32519548-32519570 CGGGATAAAGGTGCCATTCATGG - Intergenic
1164969722 19:32521273-32521295 CGGGATAAAGGTGCCATTCATGG - Intergenic
1166912571 19:46170505-46170527 CAGGATAACAGTGATTTTCAGGG + Intergenic
925596682 2:5562417-5562439 CTGGATATAATTGTTTTTCATGG - Intergenic
927271692 2:21217162-21217184 CTAGAAAAAAGTGGATTTCATGG + Intergenic
928013114 2:27629147-27629169 CTGTACAAAAGTGGTTTTCCCGG - Exonic
929120783 2:38482245-38482267 CTGGAAAAAGGAGGTCTTCTCGG - Intergenic
929250889 2:39753782-39753804 CTGGCCCAAGGTGGTATTCAAGG - Intronic
929976834 2:46643255-46643277 CAGGATAACAGTGATTTTCAGGG - Intergenic
932242413 2:70167813-70167835 CTGGACAAAGGTGGTAGTAATGG + Intronic
937503267 2:122506869-122506891 CCGGAGATGGGTGGTTTTCATGG + Intergenic
938616559 2:133005019-133005041 CAGGATAACAGTGATTTTCAGGG - Intronic
942517409 2:176768403-176768425 GTGGAGAAAGGTCGTTTCCATGG + Intergenic
943284841 2:185984628-185984650 ATGGGTAAAGGTGTTCTTCACGG - Intergenic
947563827 2:231181096-231181118 CTGGAGAAATCTGTTTTTCAGGG - Intergenic
948756301 2:240161460-240161482 CCGCACTAAGGTGGTTTTCAGGG - Intergenic
1169814882 20:9646089-9646111 CTGAATAAATGTGCTGTTCAGGG - Intronic
1170429688 20:16264704-16264726 CTGGATCCAGATTGTTTTCAAGG + Intergenic
1172188272 20:33045290-33045312 CAGGATAACAGTGATTTTCAGGG + Intergenic
1172678685 20:36695335-36695357 CTGGATAACAGTGATGTTCAAGG + Intronic
1172934118 20:38607438-38607460 CTGGAGGAAAGTGGTTTGCAAGG - Intronic
1176513250 21:7764347-7764369 ACGGATCAAGGTGGCTTTCAAGG - Intronic
1178647363 21:34394871-34394893 ACGGATCAAGGTGGCTTTCAAGG - Intronic
1178748326 21:35275165-35275187 GTGGGTTAAGGTGCTTTTCAAGG - Intronic
1179598859 21:42462061-42462083 CTGGATTAGGCTGGGTTTCAGGG + Intergenic
1179955470 21:44735825-44735847 CTGGAGAAAGGTAGACTTCAGGG + Intergenic
1180007584 21:45030085-45030107 CTGGACAAAGGTGGCATTCAGGG + Intergenic
1182252069 22:29008745-29008767 CTGGTTAAAGCTGGTTAACAAGG - Intronic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
1184598011 22:45525934-45525956 CTGGAGACAGGCGGTTCTCAGGG - Intronic
1184889830 22:47372879-47372901 AGGGATAAAGGAGGTGTTCAAGG - Intergenic
1185071233 22:48657782-48657804 CTGGTTGAAGCAGGTTTTCAGGG + Intronic
949906464 3:8862727-8862749 CTGGGTAAAGGTGGTGGTCAGGG - Intronic
950216240 3:11161803-11161825 CTTGTTAATGGAGGTTTTCAAGG - Intronic
950945272 3:16939440-16939462 CTTGAAAGAGGTGGTTTTCAAGG + Intronic
952818867 3:37468634-37468656 CAAGATGAAGGTGGCTTTCAGGG + Intronic
952875827 3:37943438-37943460 TTGGATAAGGGAGGTTATCAGGG + Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
955224346 3:57048861-57048883 CTGGGTGAAGTTGGTTTTCTTGG - Intronic
956599110 3:71000012-71000034 CTGCATAAATGGGGTTTGCAGGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956715506 3:72076256-72076278 CAGGATAACAGTGATTTTCAGGG - Intergenic
959284090 3:104384913-104384935 CTTGATAAAAGTGGCTTTCAAGG + Intergenic
959317821 3:104831448-104831470 CTTGAGAAAAGTGGTGTTCAGGG + Intergenic
960508815 3:118524387-118524409 CTTGATAAAGGGGGTTTTATAGG - Intergenic
961122579 3:124385257-124385279 ATGGAGACAGGTGGTTTTCGGGG + Intronic
966269545 3:178088285-178088307 ATGGAGAAAGCTGGTCTTCAGGG + Intergenic
970722369 4:19002641-19002663 CAGGATAACAGTGATTTTCAGGG - Intergenic
973553757 4:52061016-52061038 ATGGATATTGGTGGTTTCCATGG + Intronic
976132778 4:81902704-81902726 ATGGAGAAAGGTACTTTTCATGG - Intronic
976677432 4:87718825-87718847 CTTGATTAAGGTGGTTTGCAAGG - Intergenic
979853398 4:125601529-125601551 GTGGATAAAGGTGGGTCTCAAGG - Intergenic
980289162 4:130823455-130823477 CTGGATAATGGTGTTTGCCATGG + Intergenic
983180674 4:164644719-164644741 CTGGAGAAATGTGTTTTACATGG - Intergenic
988346497 5:30043144-30043166 CTGCATACAGGTGGGTGTCACGG - Intergenic
990100590 5:52181077-52181099 GTGTAGAAAGGTGGTTTCCATGG + Intergenic
990560151 5:56975599-56975621 CTTGACACAGGTGATTTTCATGG + Intergenic
990853153 5:60230448-60230470 CGGGATATGGGTGGTTTGCAAGG - Intronic
990999868 5:61771970-61771992 GTGGATATGGGTGGTTTTTATGG + Intergenic
991164247 5:63543788-63543810 TTGCATAATGGTAGTTTTCAGGG - Intergenic
992860362 5:80903027-80903049 CAGGATAACAGTGATTTTCAGGG - Intergenic
993367280 5:87049443-87049465 CAGGATAACAGTGATTTTCAGGG - Intergenic
994927156 5:106131089-106131111 CTGAATAAATGTGATATTCAGGG - Intergenic
996146887 5:119987477-119987499 CAGGATAACAGTGATTTTCAGGG - Intergenic
997491939 5:134284848-134284870 TAGGATAACAGTGGTTTTCAGGG - Intergenic
999642742 5:153688341-153688363 CTGGATAAATGTCATTCTCAAGG - Intronic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1005103837 6:22202013-22202035 CTGGAGATAGGTAGTTTTGATGG + Intergenic
1007354087 6:41297774-41297796 CAGAATAATGGTGATTTTCAGGG - Intergenic
1007697492 6:43743139-43743161 CTGGATGAAGCTGGGATTCAAGG - Intergenic
1009511512 6:64555322-64555344 GAGGAGAAAGGTGGTTATCAGGG + Intronic
1011513712 6:88129152-88129174 ATGGTTAAAGGTGATTTTGATGG - Intergenic
1012742126 6:103030800-103030822 TTGTCTTAAGGTGGTTTTCAAGG + Intergenic
1014029334 6:116682454-116682476 CTGTACAAAAGTGGTTTTCTTGG + Intronic
1014092885 6:117425273-117425295 CTGGGTAAAGGAGGTTTAAATGG - Intronic
1016454234 6:144215023-144215045 CTTGATAAAAATGGCTTTCAAGG - Intergenic
1016657632 6:146540242-146540264 AAGGAGAATGGTGGTTTTCAGGG - Intergenic
1016789697 6:148055093-148055115 CAGGATAACAGTGATTTTCAGGG - Intergenic
1017268959 6:152483719-152483741 CTGGACAAAGATGGGTTTAAAGG + Intronic
1017854667 6:158339733-158339755 CAGGATAACAGTGATTTTCAGGG - Intronic
1018059885 6:160081857-160081879 CAGGATAACAGTGATTTTCAAGG - Intronic
1019675595 7:2310251-2310273 CAGGATAAGGGTTTTTTTCAGGG - Intronic
1022686803 7:32604524-32604546 CAGGATAAAAGCGATTTTCAGGG - Intergenic
1024244492 7:47458943-47458965 CTGGCTAAAGTTGGTTATCTTGG - Intronic
1024641922 7:51335970-51335992 CTAGGTAGAGGTGGTTTTAATGG + Intergenic
1024777550 7:52805401-52805423 CTTGATAAAGGTGATTTTTAAGG + Intergenic
1025914283 7:65853249-65853271 CTGGAGAAAAGAGGTGTTCAAGG - Intergenic
1027138372 7:75639774-75639796 CTGGACAAAGGGGGAATTCACGG + Intronic
1027559405 7:79708395-79708417 CTGGAGAAAGATGGTTTTAGAGG - Intergenic
1028018164 7:85740541-85740563 CTTGATAAAGGTGGGTGCCAAGG + Intergenic
1028870499 7:95766331-95766353 CTGTATAAAGGTAATTTCCAAGG - Intergenic
1029153178 7:98496074-98496096 ATGGATGAAGGTGGTTTTTCAGG - Intergenic
1029800599 7:102943169-102943191 CTGGGAAAAGGTTGTTTTCTAGG + Intronic
1030834738 7:114267978-114268000 ATGGAGAATGGTGGTTTTTAGGG - Intronic
1033677125 7:143553621-143553643 CAGGATAACAGTGATTTTCAGGG - Intergenic
1033694710 7:143775816-143775838 CAGGATAACAGTGATTTTCAGGG + Intergenic
1035701366 8:1641341-1641363 CTTGAAAACGGTGGTTTTGAAGG - Intronic
1039589267 8:38733319-38733341 CTGGTTAAAGGGGGTTCTGATGG - Intronic
1041468391 8:58180788-58180810 CTTGATAGAGGTGGGTTACATGG - Intronic
1042447954 8:68910697-68910719 CTGGATCAAGATGTTTTTCTTGG + Intergenic
1045614318 8:103890239-103890261 CTGAATGAAGCTTGTTTTCAGGG + Intronic
1045954392 8:107889802-107889824 CAGGATAACAGTGATTTTCAGGG - Intergenic
1046043997 8:108942307-108942329 CAGGATAACAGTGATTTTCAGGG + Intergenic
1046191357 8:110798942-110798964 CAGGATAACAGTGATTTTCAGGG - Intergenic
1047000965 8:120571938-120571960 GTGAATAGAGGAGGTTTTCAGGG - Intronic
1052020646 9:23521877-23521899 GTGGATAAGGGTTGTCTTCAAGG + Intergenic
1052061061 9:23962042-23962064 CAGGATAACAGTGATTTTCAGGG + Intergenic
1052125950 9:24774615-24774637 CAGGATAATAGTGATTTTCAGGG - Intergenic
1056390955 9:86141095-86141117 CTAGATAAGGGAAGTTTTCAGGG + Intergenic
1059859330 9:118440886-118440908 CTGGCTAGTGGAGGTTTTCAGGG - Intergenic
1059980613 9:119767654-119767676 CTGGGGATAGGTGGTTTTCATGG - Intergenic
1060679812 9:125552266-125552288 CTGGATAGAGTTGTTGTTCAGGG - Intronic
1186759520 X:12708914-12708936 CTGGATCCAGAGGGTTTTCATGG + Intronic
1186994587 X:15106191-15106213 CAGGATAACAGTGATTTTCAGGG - Intergenic
1187785641 X:22882732-22882754 CTGGGAAAATGTGGTTGTCATGG - Intergenic
1189072400 X:37877358-37877380 CTGGAGGAAAGTGGTATTCATGG - Intronic
1189906809 X:45769791-45769813 CTGGATAAAGGAGTATTTCCTGG + Intergenic
1191637150 X:63391970-63391992 ATGTGTAAAGGTGGTTTCCAAGG - Intergenic
1193561989 X:83029898-83029920 CAGGATAACAGTGATTTTCAGGG - Intergenic
1194618421 X:96136775-96136797 ACAGATAAATGTGGTTTTCATGG + Intergenic
1194948651 X:100098285-100098307 CTGGATATGGGTGGTTGTGATGG + Intergenic
1195106468 X:101607101-101607123 GTGGATGATGGTTGTTTTCACGG - Intergenic
1195830302 X:109050374-109050396 ATGGGTAAAGGTTGTTTTCCTGG - Intergenic
1196311179 X:114167666-114167688 CAGGATAACAGTGATTTTCAGGG - Intergenic
1199360815 X:146916075-146916097 CAGGATAACAGTGATTTTCAGGG - Intergenic
1199438049 X:147836328-147836350 CCGAATACAGGTAGTTTTCATGG + Intergenic
1199759389 X:150893538-150893560 CTGGATTGGGGTTGTTTTCAAGG - Intronic
1201474007 Y:14361560-14361582 CTGGATAAAGTGGGTCTCCAGGG + Intergenic
1201792800 Y:17860510-17860532 CTGCAGAACGGTGGTTTTCCAGG - Intergenic
1201808754 Y:18045476-18045498 CTGCAGAACGGTGGTTTTCCAGG + Intergenic