ID: 1118710812

View in Genome Browser
Species Human (GRCh38)
Location 14:68518097-68518119
Sequence TTGAACAAACGCTGCCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118710812_1118710817 13 Left 1118710812 14:68518097-68518119 CCCAGAAGGCAGCGTTTGTTCAA 0: 1
1: 0
2: 1
3: 9
4: 193
Right 1118710817 14:68518133-68518155 CTGTGAGCATTGTATTGCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118710812 Original CRISPR TTGAACAAACGCTGCCTTCT GGG (reversed) Intronic
900580529 1:3406399-3406421 TTAAACAAACCCTGGCCTCTGGG - Intronic
900785339 1:4646194-4646216 TTGAACACATGCTGCCTGCTAGG + Intergenic
901028246 1:6290669-6290691 TTACAAAACCGCTGCCTTCTGGG + Intronic
903406998 1:23106172-23106194 GTGAACACAAGCTGGCTTCTAGG + Intronic
904124874 1:28231286-28231308 ATGCACAACCTCTGCCTTCTGGG - Intronic
906249621 1:44301135-44301157 ATCAACTCACGCTGCCTTCTTGG + Intronic
908069827 1:60447471-60447493 TTGAACTAACCTTGCATTCTGGG - Intergenic
909051158 1:70770021-70770043 TTGAACAAACCTTGCATCCTGGG + Intergenic
909267558 1:73580009-73580031 TTGAACAAACTTTGCATTCCAGG - Intergenic
910753722 1:90662945-90662967 TGCAACAACCTCTGCCTTCTGGG - Intergenic
914997336 1:152556322-152556344 TTGAACCAACTCTGCATTCCAGG - Intronic
916258392 1:162814495-162814517 TTGATCAGATGCTGCCTTCCGGG - Intergenic
917183314 1:172322851-172322873 TTAAACAAACACTGCATCCTTGG - Intronic
918948786 1:191107541-191107563 TTGAACCAACCTTGCATTCTGGG + Intergenic
921626964 1:217387783-217387805 TGGAACTAACGTGGCCTTCTTGG - Intergenic
922390286 1:225134542-225134564 TTGAACCAACCTTGCATTCTGGG + Intronic
923463008 1:234223392-234223414 GTGAACAAAAGTTGCCTTTTGGG - Intronic
924060652 1:240170665-240170687 TTGGATAAAGTCTGCCTTCTAGG + Intronic
1063625218 10:7682774-7682796 TTGAACCAACCCTGCATTCCAGG - Intergenic
1066020586 10:31296461-31296483 TTGAACAAAACTTGCATTCTTGG + Intergenic
1068325490 10:55480650-55480672 TTGAACCAACCTTGCATTCTTGG + Intronic
1069320764 10:67168455-67168477 TTGAACCAACCTTGCATTCTGGG - Intronic
1069333756 10:67324556-67324578 TTGAACCAACCTTGCATTCTAGG + Intronic
1071029371 10:81157331-81157353 TTAAACAAACCTTGCATTCTGGG - Intergenic
1071727658 10:88216246-88216268 TTGAGCAAACGCTACTTTCCTGG - Intergenic
1075776989 10:124995551-124995573 TGGAACACAGGCTGCCTGCTCGG - Intronic
1077560116 11:3255081-3255103 TGGCTGAAACGCTGCCTTCTGGG - Intergenic
1077566009 11:3300884-3300906 TGGCTGAAACGCTGCCTTCTGGG - Intergenic
1078501998 11:11888873-11888895 TTGAACAAACCTTGCATCCTGGG - Intronic
1078805634 11:14698426-14698448 TTGAACCAACACTGTATTCTTGG + Intronic
1080150612 11:29048087-29048109 TTGAACCAACCTTGCCTCCTAGG + Intergenic
1081008990 11:37783948-37783970 TTGAACCAACCTTGCATTCTGGG - Intergenic
1081738137 11:45419398-45419420 TTGAACTAACCCTGCATTCCTGG + Intergenic
1084989836 11:72912442-72912464 TTGAACCATCCCTGCATTCTTGG + Intronic
1085419514 11:76343474-76343496 TTGAACAAATGGTGGGTTCTAGG - Intergenic
1085731713 11:79005424-79005446 TTGAACAAACCTTGCATTCCAGG - Intronic
1087574410 11:99972348-99972370 GTGAAAAAAGGCTGCTTTCTAGG - Intronic
1089849280 11:121482397-121482419 GAGAAAAAAGGCTGCCTTCTTGG + Intronic
1089865939 11:121631776-121631798 TTGAAAAAAAGCAGCCTTTTAGG + Exonic
1089913340 11:122126177-122126199 TTGAAGAAACACTGACCTCTGGG - Intergenic
1093801532 12:23379330-23379352 TTGAACCAACCTTGCATTCTTGG - Intergenic
1094206686 12:27847903-27847925 TTGAACAAACCTTGCATCCTGGG + Intergenic
1100577929 12:95909723-95909745 TTGAACAAACCTTGTATTCTAGG - Intronic
1107420807 13:40244721-40244743 CTGCTCAAATGCTGCCTTCTCGG - Intergenic
1108154118 13:47567712-47567734 TTGAACCAACCTTGCCTTCCAGG - Intergenic
1109131242 13:58588723-58588745 TTGATCAAATGATGCCTTCAGGG - Intergenic
1109325795 13:60866385-60866407 TTGAACCAACCTTGCATTCTAGG + Intergenic
1110174608 13:72540893-72540915 TTCAACAAATGCTGCCTATTAGG - Intergenic
1111045519 13:82808900-82808922 TTGAACAAACCTTGCATTCCAGG - Intergenic
1114555165 14:23557810-23557832 TTTTACAAAAGCTGCCCTCTGGG + Intronic
1114858537 14:26484957-26484979 ACGAACAAACCCTGCCTTCATGG + Intronic
1115684521 14:35781654-35781676 TTGAACCAACCTTGCCTTCTGGG - Intronic
1117398379 14:55334925-55334947 TAGAACAAACTCTTCCTTGTGGG + Intronic
1118710812 14:68518097-68518119 TTGAACAAACGCTGCCTTCTGGG - Intronic
1121246868 14:92467223-92467245 TTGAACCAACCTTGCATTCTTGG - Intronic
1122308087 14:100778004-100778026 TTGAACATACGCTCTCTTCCAGG - Intergenic
1124023183 15:25942353-25942375 TTGAACCAACTTTGCCTTCCTGG + Intergenic
1124345553 15:28919364-28919386 ATGAACAACCGCTGACTTCCTGG + Intronic
1127648302 15:60980199-60980221 TTGAACAAACTTTGCATTCCTGG + Intronic
1127841881 15:62838905-62838927 TTTGCCAAAAGCTGCCTTCTGGG - Exonic
1129924131 15:79347201-79347223 TTGAACAAACCTTGCATCCTAGG - Intronic
1130581957 15:85145504-85145526 TTCAACAACCTCTGCCTCCTGGG - Intergenic
1131159787 15:90098166-90098188 TTGCACAAACACTGTCCTCTTGG + Intronic
1133264136 16:4573135-4573157 TTGGAGAAACCATGCCTTCTCGG + Intronic
1133310506 16:4843228-4843250 TCGAACAATCTCTGCCTCCTGGG + Intronic
1133493980 16:6298624-6298646 TTGACCAAAACCTTCCTTCTGGG + Intronic
1140155584 16:72422513-72422535 TTGAACCAACCTTGCATTCTTGG + Intergenic
1141159981 16:81622775-81622797 TTTCACAAATGCTGCCTTCCAGG - Intronic
1141872315 16:86795706-86795728 TTGAACAAACAATGCCTTTGGGG - Intergenic
1145121213 17:20261558-20261580 TTCAGCAAAAGCTGTCTTCTTGG - Intronic
1149247779 17:54731527-54731549 TTGAACCAACGTTGCCTCCCAGG - Intergenic
1150517844 17:65833028-65833050 TTGAACCAACCTTGCATTCTGGG - Intronic
1152452548 17:80391344-80391366 TAGTGCAACCGCTGCCTTCTGGG + Intronic
1153072404 18:1120471-1120493 TTGAACCAACCTTGCCTCCTGGG + Intergenic
1156901745 18:42308473-42308495 TTGATCAAAAGCTACCTACTAGG - Intergenic
1160589261 18:79933119-79933141 TTGAACCAACCTTGCATTCTTGG - Intronic
1163302911 19:16458958-16458980 TGGAGCAGGCGCTGCCTTCTAGG - Intronic
1164113077 19:22188184-22188206 TTGAACAAACCTTGCATTCCAGG - Intronic
1164905860 19:31967429-31967451 ATGAGCAGATGCTGCCTTCTGGG + Intergenic
1166588504 19:43973074-43973096 TTGAACCAACGTTGCATCCTGGG - Intronic
1168126944 19:54289531-54289553 TTGACCTGACTCTGCCTTCTTGG + Intergenic
1168173508 19:54606929-54606951 TTGACCTGACTCTGCCTTCTTGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927457317 2:23265563-23265585 TTAAACAAACCTTGCATTCTTGG + Intergenic
927612317 2:24553611-24553633 TTGAACCAACATTGCATTCTTGG + Intronic
927681757 2:25144245-25144267 TTTAACAATAGCTGCCTGCTGGG + Intronic
930349882 2:50237543-50237565 TTAAACAAAACCTGACTTCTAGG - Intronic
931331376 2:61288059-61288081 TGAAACAAACTCTGTCTTCTAGG - Intronic
932935857 2:76099970-76099992 TTGAACTAACCCTGCATTCCAGG - Intergenic
937688809 2:124729969-124729991 ATTAACAGAGGCTGCCTTCTAGG - Intronic
938098711 2:128482158-128482180 TTGAACCAACATTGCATTCTGGG - Intergenic
939425288 2:142028201-142028223 TAGAATAAACGCTCCCTTTTTGG + Intronic
941045195 2:160667026-160667048 TTGAACTAACTCTCTCTTCTAGG + Intergenic
943850822 2:192720419-192720441 TTGAACAAACTCTGCCTTCATGG + Intergenic
944126788 2:196303233-196303255 TTGAACCAACCCTGCATCCTGGG + Intronic
944207400 2:197171022-197171044 TTAAACAAACGCTGGATGCTTGG - Intronic
944338546 2:198566984-198567006 TGGAAAAAAAGATGCCTTCTAGG + Intronic
944847378 2:203682193-203682215 TTGAGCATAAGCTGCCTTCATGG - Intergenic
945336296 2:208596631-208596653 TTGAACAAATTCTGCTCTCTGGG + Intronic
945693299 2:213069488-213069510 TTGAACAAAGGCAACCTGCTAGG - Intronic
1170044078 20:12066846-12066868 TGGAACTAAAGCAGCCTTCTTGG + Intergenic
1175664604 20:60847772-60847794 TTGCAGAATCGCTACCTTCTTGG - Intergenic
1176149531 20:63582658-63582680 TTAAAAAAAATCTGCCTTCTAGG - Intergenic
1177962342 21:27682855-27682877 TTGGACTAACGTTGCCTTTTAGG - Intergenic
1180258450 21:46650229-46650251 CTGCACAAACGCTGTCTGCTTGG + Intronic
1181953599 22:26572194-26572216 TTGAACCAACACTGCAGTCTGGG - Intronic
1185059015 22:48596232-48596254 TTGAAGAGACGCGGCCTTCTGGG + Intronic
950344477 3:12279885-12279907 TTTAAAAATCCCTGCCTTCTTGG + Intergenic
951947631 3:28158400-28158422 TTGAACCATCCCTGCATTCTTGG - Intergenic
951972031 3:28456790-28456812 TTGAACCAACGTTGCATCCTGGG + Intronic
953887108 3:46720808-46720830 TGGAACAAAAGCTGTCTTCTGGG - Intronic
956338225 3:68189315-68189337 TTTAACAAAAGTTGCTTTCTAGG - Intronic
956355189 3:68383500-68383522 TTGAACAAACTTTGCATTCCAGG + Intronic
956848935 3:73210662-73210684 TTAAACAAACCCTGACTGCTTGG - Intergenic
957840903 3:85668027-85668049 TTCAACAAACGTTGGCTTATAGG + Intronic
958082475 3:88764240-88764262 TTGAACAAACCTTGCATTCCAGG + Intergenic
959433640 3:106285730-106285752 TTGAACCAACCCTGCATCCTGGG - Intergenic
960286647 3:115837437-115837459 TAGACCAAACGCTGACTACTAGG + Intronic
960596264 3:119410805-119410827 TTTAACCATCCCTGCCTTCTTGG + Intronic
960754624 3:120997904-120997926 TTGAACAAACCTTGCATTCTAGG - Intronic
961016872 3:123475356-123475378 GTCAAGAATCGCTGCCTTCTCGG + Intergenic
963004218 3:140710932-140710954 TTGAACAATTGTTGCCTTCCTGG + Intergenic
963082923 3:141410971-141410993 TTGCACAAAGCCTGCCTTCACGG - Intronic
967701886 3:192602860-192602882 TTGAACCAACGTTGCCTCCTAGG - Intronic
969213623 4:5707031-5707053 TTGCACAAGCTCTTCCTTCTGGG - Intronic
970033126 4:11700432-11700454 TTGAAAAAAAGATGCCTTCCAGG - Intergenic
971421969 4:26481786-26481808 ATGAACAAACGCTTCCGCCTCGG - Exonic
972627545 4:40815756-40815778 GTGAACTAACGCTGCGTCCTTGG - Exonic
972881149 4:43424595-43424617 GTGTAGAAATGCTGCCTTCTTGG + Intergenic
973149105 4:46865580-46865602 TTGAACAACTGCTTCCTCCTAGG + Intronic
976357808 4:84140012-84140034 TTGAACCAACACTGTGTTCTTGG - Intergenic
977005631 4:91566209-91566231 TTGAACCAACCCTGCATTCCAGG + Intronic
977614852 4:99076750-99076772 TTGGATAAAGTCTGCCTTCTAGG - Exonic
980163550 4:129197248-129197270 TTAAACTAACCTTGCCTTCTGGG + Intergenic
981452402 4:144913426-144913448 TTGTAAAAATGCTGCTTTCTAGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
984173167 4:176385154-176385176 TTCAACAAACGGTGGCTGCTTGG + Intergenic
987571112 5:19660696-19660718 TTCTACAGACTCTGCCTTCTTGG - Intronic
988909321 5:35823848-35823870 TACCACAAACTCTGCCTTCTGGG - Intergenic
990445920 5:55894271-55894293 CTGTACAAAGGCTGTCTTCTGGG + Intronic
994308212 5:98234140-98234162 TTGAACAAACCGTGCATTTTAGG - Intergenic
995428925 5:112053214-112053236 TTGAACAAACCTTGCCTCCCAGG - Intergenic
997998643 5:138606548-138606570 TTGGAATAAAGCTGCCTTCTAGG - Intergenic
998108164 5:139481630-139481652 CAGAACCAAGGCTGCCTTCTGGG + Exonic
999360585 5:150982926-150982948 TTGACCCAACGGTGACTTCTAGG + Intergenic
999833967 5:155349351-155349373 TTTAACAAAGGCTGCCCTCAGGG + Intergenic
1000355189 5:160387653-160387675 TTGAACCAACCTTGCATTCTTGG + Intergenic
1000509958 5:162168432-162168454 TTGAACAAACCTTTCATTCTGGG - Intergenic
1000673491 5:164091552-164091574 TTGTACAAATGCTACCTTTTGGG + Intergenic
1001166122 5:169369644-169369666 TTGAACCATCCCTGCCTTCATGG - Intergenic
1003737209 6:8890205-8890227 TTGAACAACAGCTGACTTATTGG + Intergenic
1006048940 6:31325223-31325245 TTGAACAAACCTTGCATACTGGG - Intronic
1008736524 6:54551005-54551027 TTGAACCAACCTTGCATTCTAGG - Intergenic
1009603673 6:65837537-65837559 TTGGATAAACTCTGCCTTCTAGG - Intergenic
1009802300 6:68554086-68554108 TTGAACAAACCTTGCCTCCCTGG - Intergenic
1010555992 6:77280326-77280348 TTGAACCAACCTTGCATTCTTGG - Intergenic
1011196955 6:84791317-84791339 CTGAAGAAACTCTGGCTTCTGGG + Intergenic
1012397480 6:98815893-98815915 TTGAACTAACCTTGCATTCTTGG - Intergenic
1014094983 6:117449897-117449919 TAGTGCAAACTCTGCCTTCTGGG - Intronic
1018691764 6:166351424-166351446 TTGAACCAACTTTGCATTCTTGG + Intergenic
1019643371 7:2116363-2116385 TTGAACAAACGCTTCCTGAACGG + Intronic
1021833779 7:24646471-24646493 TTGAACAGACCTTGCATTCTGGG + Intronic
1022353804 7:29591895-29591917 CTGAACAAACCTTGCATTCTTGG + Intergenic
1023563824 7:41503951-41503973 TTGAATGAACGCTACATTCTTGG + Intergenic
1035544837 8:472372-472394 TTGAACCAACCTTGCATTCTTGG + Intergenic
1039138555 8:34356851-34356873 TTGAACAAACCTTGCCTCCTGGG + Intergenic
1039583574 8:38686418-38686440 TTGAACACACCCTTCCCTCTGGG + Intergenic
1040975034 8:53181494-53181516 TTGAACAAACTTTGCATTCTTGG + Intergenic
1041322286 8:56625746-56625768 TTGAATAAAGGCTTCCTTATTGG - Intergenic
1043671207 8:82886923-82886945 TTGAACAATCTTTGCCTTCCTGG - Intergenic
1046044638 8:108948971-108948993 TTAAACAAGCCCTGCCTTCAGGG - Intergenic
1046493486 8:114983895-114983917 GTCAATAAACGCTGCCTCCTAGG - Intergenic
1049497155 8:142941425-142941447 ATGAACAGGCGCTGCCTCCTGGG + Intergenic
1050425216 9:5505848-5505870 TTGAACCAACCTTGCCTCCTGGG - Intergenic
1051027141 9:12626363-12626385 TTTAACAAACCAAGCCTTCTAGG + Intergenic
1051803796 9:20967793-20967815 TTGAACAAACTTTGCATTCCTGG + Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1054920905 9:70541346-70541368 TTGAACACACCCAGCATTCTGGG - Intronic
1055706416 9:79010148-79010170 TTGAACACACTCTGCATTCATGG - Intergenic
1055912189 9:81365229-81365251 TTGAACCAACCTTGCATTCTGGG - Intergenic
1056608219 9:88105272-88105294 TTGAACCAACATTGCATTCTAGG - Intergenic
1058522448 9:105824624-105824646 TTGAACAATCCTTGCATTCTTGG + Intergenic
1062163738 9:135094841-135094863 TTGAAAATACTCTCCCTTCTAGG - Intronic
1062383378 9:136298384-136298406 TTGAACAAACTCCGCCCCCTCGG - Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1188851223 X:35134823-35134845 TTGAACCAACTTTGCATTCTGGG + Intergenic
1188946708 X:36314185-36314207 TTCTAAAAATGCTGCCTTCTTGG + Intronic
1190257943 X:48778035-48778057 TTGACCAAACCTTGCATTCTTGG - Intergenic
1190739052 X:53276890-53276912 TTGAACAATCCCTGCACTCTTGG + Intronic
1192055993 X:67773900-67773922 TTGAACCAACCTTGCATTCTGGG - Intergenic
1192311370 X:70017522-70017544 TTGAACAAACCTTGCATTCCAGG - Intronic
1194080232 X:89453656-89453678 TTGAACAAACCATGCATCCTAGG - Intergenic
1198625498 X:138568040-138568062 TAGAATCAATGCTGCCTTCTTGG + Intergenic
1198627130 X:138589124-138589146 TTGAACCAACCATGCCTTCCTGG + Intergenic
1200432911 Y:3109719-3109741 TTGAACAAACCATGCATCCTAGG - Intergenic
1200936494 Y:8742934-8742956 TAGAACAAAAGCTTCCTTGTTGG + Intergenic
1201125768 Y:10912745-10912767 TTGAATAAGCTCTGCCTACTGGG - Intergenic