ID: 1118712518

View in Genome Browser
Species Human (GRCh38)
Location 14:68533924-68533946
Sequence GAGAGGGGCAAAGGCGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118712510_1118712518 17 Left 1118712510 14:68533884-68533906 CCAAATTTGAAGATTTTTCTAGG 0: 1
1: 0
2: 4
3: 29
4: 302
Right 1118712518 14:68533924-68533946 GAGAGGGGCAAAGGCGTGTAAGG 0: 1
1: 0
2: 2
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118712518 Original CRISPR GAGAGGGGCAAAGGCGTGTA AGG Intronic
900363790 1:2302294-2302316 GAGCGAGGCAAAGGTGTGTGTGG + Intronic
900972861 1:6001084-6001106 GAGAGGGACAAGGGCAGGTAAGG + Intronic
901053542 1:6437905-6437927 AAGAGGGGCTAAGTCGTGTTGGG + Intronic
901202976 1:7477055-7477077 GAGAAGGGCAAGGGGGTGTGAGG + Intronic
901810894 1:11766334-11766356 GAGAGGGGCAAAGGCTTCAGTGG - Exonic
902875743 1:19339775-19339797 GAAAGGGGCAAAGGGGTACATGG + Intronic
902880691 1:19370113-19370135 GAGAGGCGCACAGGCCTGTGGGG - Intronic
904211901 1:28891373-28891395 GAGAGGTTCAAAGGCTTGTCTGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905816190 1:40952815-40952837 GAGAAGGGCAAAGGCGAGTAGGG - Intergenic
906112631 1:43334451-43334473 GAGAGGGCCTAAAGGGTGTATGG + Intergenic
906588461 1:47001492-47001514 GAGCTGGGCCAAGGCGGGTATGG + Intergenic
906984429 1:50667971-50667993 GAGAAAGGCAAAGGCCTGGATGG - Intronic
907048909 1:51316637-51316659 GAGAGGGGAAAAGGTGTTTCTGG - Intronic
910711135 1:90182425-90182447 GATGTGGGCACAGGCGTGTAAGG + Intergenic
911260585 1:95680636-95680658 GAGAGGGAGGAAGGGGTGTAAGG - Intergenic
911672074 1:100618857-100618879 AAGAGAGGCAAAGTCATGTAGGG - Intergenic
912921170 1:113868726-113868748 GACAGGGGCAGATGGGTGTAGGG + Intronic
913452928 1:119004355-119004377 GAGAGTTGCAAAGGAATGTACGG + Intergenic
914218393 1:145655592-145655614 GAGAGGGACCCAGGCGAGTAGGG - Intronic
914470956 1:147978286-147978308 GAGAGGGACCCAGGCGAGTAGGG - Intronic
915935808 1:160089720-160089742 GAGAGAGGCAGAGGGGTGGAAGG + Exonic
916991960 1:170254200-170254222 GAGAGGGGCAAAGTCTGATATGG - Intergenic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
920403466 1:205692079-205692101 CAGAGGGGGAAAGGTGTGGAGGG - Intergenic
920930542 1:210383701-210383723 GAGAGGGGTTAAGGGGTCTATGG + Intronic
1066449055 10:35511474-35511496 GGGAGGGGAAAAGGTCTGTAGGG + Intronic
1067534063 10:47095227-47095249 GTGAGGGGCCAAGGCGAGGATGG + Intergenic
1068629503 10:59284900-59284922 GAGAGGTGTGAAGGTGTGTATGG - Intronic
1073134903 10:101215092-101215114 GAGGGGGGCAAAAGCGTGGCAGG + Intergenic
1074088684 10:110227148-110227170 GAGAGGGGCACGCGCGTGTGTGG + Intronic
1074544604 10:114393013-114393035 GATAGGGGCACATGCGTGTTGGG - Intronic
1074884933 10:117685954-117685976 TAGAGGGGGAAAGGAGTGTCAGG - Intergenic
1076016341 10:127030358-127030380 GCGAGGGCCAAAGGCGGGGAAGG - Intronic
1076155625 10:128202912-128202934 CACAGGGGCAGAGGTGTGTAAGG + Intergenic
1077332183 11:1988581-1988603 GAGAGGGGCACAGGCCAGAAAGG + Intergenic
1082948741 11:58788432-58788454 GGGAGGGGCCAAGGTGAGTAGGG - Intergenic
1083295101 11:61711087-61711109 GAGTGGGGTAAAGACGTGTTAGG + Intronic
1084064088 11:66693514-66693536 GAGAGAGGCACAGGGGTGAAGGG - Intronic
1084225426 11:67712058-67712080 GCGAGGGGCATAGGCGGGGAAGG - Intergenic
1084263248 11:67991908-67991930 GCGAGGGGCATAGGCGGGGAAGG - Intronic
1084416500 11:69035771-69035793 GAGAGGGGAAAAGGCTGGGAGGG - Intergenic
1084810153 11:71607219-71607241 GCGAGGGGCATAGGCGGGGAAGG + Intergenic
1085125910 11:74002223-74002245 AAGAGGAGCAAAGGCATGGAGGG - Intronic
1085242252 11:75067589-75067611 GAGAGGAGCCAAGGTGTCTAGGG + Intergenic
1085788096 11:79472783-79472805 GAGAGGGGCAGAGGAATGTCAGG + Intergenic
1085855639 11:80172467-80172489 GAAAGGTGCAAAGGGGTGTTAGG - Intergenic
1088191037 11:107228412-107228434 GAGAAGGGCAAATGAGTGTTGGG - Intergenic
1089679833 11:120113173-120113195 GAGAGAGGCAAAGGGCTGTGGGG - Intronic
1202815164 11_KI270721v1_random:43757-43779 GAGAGGGGCACAGGCCAGAAAGG + Intergenic
1092953700 12:13530503-13530525 GAGAAGGGAAAAGGCATATAAGG + Intergenic
1093240474 12:16664667-16664689 GAGAGGTGCAACGGCATGCATGG + Intergenic
1096233406 12:49910007-49910029 GGGAGGGGCAAAGGTGTGGGCGG + Intergenic
1096669497 12:53190171-53190193 GAGAGGCGCAAAGCAGTGAAAGG + Exonic
1101849654 12:108392065-108392087 GAAAGTGGCAAAGGCTTGCAGGG + Intergenic
1102096614 12:110246314-110246336 GAGGGTGTCAAAGGCCTGTAAGG - Intergenic
1107236658 13:38178663-38178685 GAGAGAGGGAAAGGGGTGTGTGG + Intergenic
1110648018 13:77911649-77911671 GAGAGAGGAGAAGGCGTGAAGGG - Intronic
1111573982 13:90126450-90126472 AAGAGGGGCAAAGTAATGTAGGG + Intergenic
1112429445 13:99337763-99337785 GAGAAGGGAAAAGCTGTGTAGGG - Intronic
1114537862 14:23434224-23434246 GAAAGGGGCCAAGGCCTGCAGGG + Exonic
1115678181 14:35705068-35705090 GGGAGGGGGAAAGGGATGTATGG - Intronic
1116018288 14:39432231-39432253 GAGAGGGGGAAAGGCCTCTGCGG + Exonic
1117699060 14:58395685-58395707 CACAGGGGCAGAGGCGTGTTTGG + Intergenic
1118712518 14:68533924-68533946 GAGAGGGGCAAAGGCGTGTAAGG + Intronic
1119246901 14:73117927-73117949 TAGAGGGGCAGATGTGTGTATGG + Intronic
1122309727 14:100786828-100786850 GAGAAGTGGAACGGCGTGTATGG - Intergenic
1122353969 14:101112541-101112563 GTGAGGGGCACAGGCCTGTAGGG - Intergenic
1123413801 15:20080885-20080907 AAGAGGGGGAAAGGCATGAAAGG + Intergenic
1123523143 15:21087996-21088018 AAGAGGGGGAAAGGCATGAAAGG + Intergenic
1123828491 15:24107816-24107838 TAGAGGGGCAAAGCCGAGTGTGG + Intergenic
1123843402 15:24271351-24271373 TAGAGGGGCAAAGCCGAGTGTGG + Intergenic
1123858476 15:24437610-24437632 TAGAGGGGCAAAGCCGAGTGTGG + Intergenic
1123863113 15:24488037-24488059 TAGAGGGGCAAAGCCGAGTGTGG + Intergenic
1126534601 15:49747707-49747729 GTGAGGGGCAAAGGCATGTGAGG + Intergenic
1133376409 16:5291081-5291103 GAGAGGGGCTAGGTCATGTAGGG + Intergenic
1133853428 16:9527043-9527065 GAAAGGGGGAAAGGCGTGCCAGG - Intergenic
1137036509 16:35574003-35574025 GGGAGGGGCAGAGGCGTGAAGGG + Intergenic
1138113601 16:54343021-54343043 GAGAGGGGGAATGGTGGGTAAGG - Intergenic
1138590023 16:57994594-57994616 GAGAGGGGCACAGGCCTGAGTGG - Intergenic
1139346659 16:66308089-66308111 GATAAGGGCAAAGTCATGTAGGG - Intergenic
1139952971 16:70680873-70680895 GAGAGGGACAACGGCATGGATGG + Intronic
1143862804 17:9903347-9903369 GACAGGGGAGAAGGCGTGTTGGG + Intronic
1145160529 17:20571075-20571097 GAGAGGGGAAAAGCCATGCAAGG - Intergenic
1145795077 17:27650810-27650832 GAGAGGGGCGAAGTCGGCTAGGG + Intergenic
1145908175 17:28527684-28527706 GAGAGGGGCAAAGAGGAGTGTGG + Intronic
1146352675 17:32108905-32108927 GAGGGAGGCAAAGGTGTGTGTGG + Intergenic
1146824182 17:36009170-36009192 GAGAGGGGAGAAGGCGGGGAGGG - Intergenic
1148985035 17:51613495-51613517 GAGAGGGGCAGAGGGGGGTGAGG - Intergenic
1149792118 17:59488394-59488416 AAGAGGGGCAAAGGAATGAATGG + Intergenic
1150005102 17:61464271-61464293 GAGAGGGGCACAGGCGGGGCTGG + Intronic
1151563937 17:74886723-74886745 GAGAGGGGAAAGGGGGCGTATGG - Intronic
1152312922 17:79561774-79561796 GAGAGGGGCACATGAGGGTAGGG + Intergenic
1152707351 17:81851476-81851498 CAGAGGGGCAAAGGCGGGTAAGG + Intronic
1153458351 18:5304205-5304227 GGGAGGGGGAAAGGCTTGAAAGG + Intergenic
1153607627 18:6850455-6850477 GAGAAAGGCAAAGGCTGGTATGG + Intronic
1158873822 18:61713819-61713841 GAAAGGGGCTAAGGCTTGTGTGG - Intergenic
1160110988 18:76030579-76030601 GAAAAGTGCAAAGGCGTGAAAGG - Intergenic
1160484543 18:79277070-79277092 GACATGGGCAAAGCGGTGTATGG + Exonic
1160992437 19:1865208-1865230 GAGAGGGGCAAGTGTGTGCAGGG - Intergenic
1165618739 19:37226256-37226278 GTGTGGGGGAAAGACGTGTATGG - Intronic
1166122575 19:40694259-40694281 GAGAGGGGCAGAGGGGTGGCTGG - Intronic
1166981399 19:46634309-46634331 GACAAGGGGAAAGGCCTGTATGG - Intronic
1168665956 19:58204893-58204915 GAGAGAGTCAAAGGCAGGTAGGG + Intronic
926008300 2:9389605-9389627 GACAGGGGCAGAGCCGTGTGAGG - Intronic
927976166 2:27340037-27340059 GGGAGGGGCAAAGGTGGGGAGGG - Intronic
928281751 2:29952576-29952598 AAGATGGGCAAAGGCTTGGAGGG + Intergenic
929117971 2:38460438-38460460 GAGAGTGGCAGAGGTGTGTTTGG - Intergenic
932873754 2:75429619-75429641 GGGAGGTGCAAAGGCAGGTATGG - Intergenic
934541640 2:95180199-95180221 GAGAGGGGACAAGCCGTGGATGG + Exonic
934666810 2:96177456-96177478 GAGATGGGCAAAGGCTATTAGGG + Intergenic
935444983 2:103146620-103146642 GGCTGGGGCAAAGGCCTGTATGG - Intergenic
938708692 2:133956560-133956582 GAGAGGAGCAAAGGAGTTGATGG - Intergenic
938757490 2:134394051-134394073 GAAAGGGAAAAAGGCGTGTGAGG - Intronic
938934782 2:136118242-136118264 GAGAGGGGCAGACGCGAGGAAGG + Intergenic
939441730 2:142259677-142259699 CAGAGGGCCAAAGCCCTGTATGG + Intergenic
940954594 2:159713042-159713064 GCGCGGGGCAAAGGCGGGCAGGG + Intronic
941905705 2:170715369-170715391 GCGAGGGGCAAGGGCGGGGAGGG + Exonic
945972428 2:216243712-216243734 GAGAGGGGTAAAGGAGGATAGGG - Intergenic
946353313 2:219169478-219169500 GAGAGGGGCAGAGTCCTGGAGGG - Intronic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
948191348 2:236061698-236061720 GGGAGGGGCAGTGGCGTATACGG + Intronic
1179890078 21:44330924-44330946 GAGGGAGACAAAGGCGTGTGAGG + Intronic
1180751747 22:18129575-18129597 GAGAGGGGCAAAGTGGGGAAGGG - Intronic
1180880023 22:19197105-19197127 GAGAGTGTCAGAGGCGTGTGGGG - Intronic
1181763404 22:25073677-25073699 GAATGGGGCAGAGGGGTGTAGGG - Intronic
1181938796 22:26458589-26458611 GAGAGGGTCATGGGCTTGTAGGG + Intronic
1182546314 22:31078684-31078706 AAGAGGGGGAAAGGCATGAAAGG - Intronic
1183364551 22:37400102-37400124 GGGAGGGGCAAGGGAGTGCAAGG + Intronic
1184747000 22:46461937-46461959 GTGAGGGGCAAAGGGGAGGAAGG + Intronic
950698954 3:14726875-14726897 GAGAGGGGCAAAGGGGAGGGCGG - Intronic
952981898 3:38742852-38742874 GAGAGGGGCAAAGGAATTGAGGG - Intronic
957078687 3:75619850-75619872 GCGAGGGGCATAGGCGGGAAAGG - Intergenic
960703629 3:120460858-120460880 GCAAGGGGAAAAGGCATGTAGGG + Intergenic
961112678 3:124298363-124298385 AAGGGGGGCAGAGGCGAGTAAGG + Intronic
965321121 3:167252037-167252059 GAGAAGGGCAGAGGTGTTTAAGG - Intronic
968892319 4:3375985-3376007 GAGGAGGGCAAAGGCCTGTGTGG + Intronic
969021768 4:4143818-4143840 GCGAGGGGCATAGGCGAGGAAGG - Intergenic
969474099 4:7411497-7411519 GAGAGGAGCAAAGGTGGGAAGGG - Intronic
969525059 4:7700107-7700129 CAGAGGGGCAAAGGCCTGGAGGG - Intronic
969732100 4:8963597-8963619 GAGAGGGGCATAGGCGAGGAAGG + Intergenic
969791695 4:9497682-9497704 GCGAGGGGCATAGGCGGGGAAGG + Intergenic
972669138 4:41196881-41196903 CAGAGGGGGAAAGGAGTGTGTGG - Intronic
975208556 4:71672326-71672348 GAGAGGGGATAAGGAGTGTCAGG + Intergenic
979419372 4:120484970-120484992 GAGAGGGGAAAAAGCATATATGG + Intergenic
980208821 4:129758276-129758298 GAGAGGGACAAAGGAGTTGATGG - Intergenic
980875636 4:138659391-138659413 GAGGAGGGCAAAGGAGTGTGAGG + Intergenic
982157725 4:152537618-152537640 GAGAGGGGCAAAGGAGGATGTGG + Intergenic
983090418 4:163495152-163495174 CAGAGAGGCAGAGGTGTGTAGGG - Intronic
990261066 5:54022852-54022874 GAGAAGGGCATAGGGGTGAAGGG - Intronic
1002154936 5:177269771-177269793 AAGATGGGCAAAGGAGTGGATGG + Exonic
1003088839 6:3084023-3084045 GAGAGGGGCAAGGGCGAGTCTGG - Intronic
1003864091 6:10347816-10347838 GAGAGGGGCAATGGAGTGAAGGG + Intergenic
1005927016 6:30452673-30452695 GGGTGGGGCAAAGGCGGGTATGG + Intergenic
1006419766 6:33925691-33925713 GAGAGAGGAAAAGGCCTGGAGGG - Intergenic
1007392099 6:41555439-41555461 GGGAGGGGCCAAGGCATGTCGGG + Intronic
1007835245 6:44668798-44668820 GAGAGGGGGAAATGCGGGTACGG - Intergenic
1008394789 6:50993890-50993912 GAGAGATGCAAAAGAGTGTAAGG + Intergenic
1011336061 6:86260907-86260929 GAGAGGAGAAAAGGGGTGTGGGG - Intergenic
1014712360 6:124822068-124822090 GAGAGAGGCACAGCCATGTATGG - Intronic
1014739200 6:125127229-125127251 GATAGGGCCAAAGGCTTGTAGGG - Intronic
1019571962 7:1717045-1717067 AGGAGGGGGAAAGGCGTGGAAGG + Intronic
1019669877 7:2271776-2271798 GAGAGAGGAAAAGGCGGGTCCGG + Intronic
1021499707 7:21319046-21319068 GAGAGGGGAAATGGGGTGGAGGG - Intergenic
1025014217 7:55425904-55425926 GAGAGGGGCCAAGGTGCGCAGGG - Intronic
1029147756 7:98458763-98458785 CAGAGAGGCAAAGGCGAGGAGGG - Intergenic
1031042283 7:116850877-116850899 GATATGTGCAAAGGGGTGTAGGG - Intronic
1036033159 8:4993796-4993818 GAGAGGAGGAATGGGGTGTATGG + Intronic
1037368290 8:18145921-18145943 GTGAGAGACAAAGGAGTGTATGG + Intergenic
1037606538 8:20442450-20442472 GATAGGGACAAAGGCCTGTTTGG + Intergenic
1042266787 8:66916621-66916643 CTGAGGGGCAAAGGAGTGGAGGG + Intronic
1044973694 8:97644069-97644091 GGGTGGGGCAAAGGCGTGTCAGG - Intergenic
1049195167 8:141311729-141311751 GAGTGGGGCAAAGATGTGTGGGG - Intergenic
1049632336 8:143665523-143665545 GACAGGGACAAGGGAGTGTATGG + Intergenic
1052165855 9:25327124-25327146 GAGAAGAGCAAAGGCATTTAGGG + Intergenic
1053448206 9:38169694-38169716 AAGAGGGGGAAAGGCATGTAGGG - Intergenic
1054740835 9:68804337-68804359 GAGAGGGACAAAGATGGGTATGG + Intronic
1054964105 9:71002589-71002611 GATAGGGGAAAAGGAGTCTAGGG - Intronic
1059312223 9:113396497-113396519 GAAAGGGGCAAAGGTGGGGAAGG + Intronic
1061166763 9:128927313-128927335 GAGCGAGGGAAAGGTGTGTAAGG - Intronic
1062054673 9:134464588-134464610 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054689 9:134464645-134464667 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054735 9:134464816-134464838 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054751 9:134464873-134464895 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054765 9:134464930-134464952 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054795 9:134465044-134465066 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054827 9:134465158-134465180 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054843 9:134465215-134465237 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054875 9:134465329-134465351 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054891 9:134465386-134465408 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054923 9:134465500-134465522 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054955 9:134465614-134465636 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054971 9:134465671-134465693 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055033 9:134465899-134465921 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055047 9:134465956-134465978 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055077 9:134466070-134466092 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055125 9:134466241-134466263 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055157 9:134466355-134466377 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055173 9:134466412-134466434 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055189 9:134466469-134466491 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055203 9:134466526-134466548 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055217 9:134466583-134466605 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055231 9:134466640-134466662 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055245 9:134466697-134466719 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055259 9:134466754-134466776 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055272 9:134466811-134466833 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055286 9:134466868-134466890 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055300 9:134466925-134466947 GAGCGGGGCAGAGGCGCGTATGG - Intergenic
1186976236 X:14908344-14908366 GAGAGAGGCAGAGAAGTGTAGGG + Intronic
1189181844 X:39011937-39011959 GAGAGGGACAACGGCCTGCAAGG + Intergenic
1189286724 X:39857009-39857031 GAGAGAGGCAAAGGAAAGTAGGG + Intergenic
1189446795 X:41086735-41086757 CAGAGGGCCAAAGCCGTGAAAGG + Intronic
1190322953 X:49189020-49189042 GAGAGGGGCCAAGGGATGCAGGG + Exonic
1192591713 X:72365787-72365809 GAGAGGGGAAAAGCCATGGATGG + Intronic
1199846119 X:151694277-151694299 GAGAGGGGCAAAGGGGTTCCGGG - Intergenic
1199861812 X:151807741-151807763 GGAAGGGGCAAAGGAGAGTAAGG + Intergenic