ID: 1118715388

View in Genome Browser
Species Human (GRCh38)
Location 14:68556254-68556276
Sequence CCCAGACCAGAGCCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118715382_1118715388 20 Left 1118715382 14:68556211-68556233 CCACAGTCAGGCAACGGGGACAG 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 210
1118715383_1118715388 -4 Left 1118715383 14:68556235-68556257 CCTCAAACGTGAAAACCCACCCA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 210
1118715380_1118715388 22 Left 1118715380 14:68556209-68556231 CCCCACAGTCAGGCAACGGGGAC 0: 1
1: 0
2: 0
3: 3
4: 112
Right 1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 210
1118715381_1118715388 21 Left 1118715381 14:68556210-68556232 CCCACAGTCAGGCAACGGGGACA 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118715388 Original CRISPR CCCAGACCAGAGCCATCCTT GGG Intronic
900198759 1:1392680-1392702 ACCAGTCTAGAGCCAGCCTTCGG + Intronic
901145807 1:7063998-7064020 GCCAGGCCAGAGCCATCATCAGG - Intronic
901853787 1:12031556-12031578 CCCTGACCCTAGCCATCCCTCGG + Intronic
902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG + Intronic
903128670 1:21264223-21264245 CCCAGACCAGGGCTCCCCTTGGG - Intronic
903972406 1:27127603-27127625 CCCAGGCCAGAGCCCTCCAGTGG - Intronic
904807909 1:33144760-33144782 CCTAGACCAGGACCATCCTGAGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906955167 1:50368329-50368351 CCCAGGCCAAAGCCCTCCTTTGG + Intergenic
910990338 1:93049409-93049431 CCCAGTTCAGGGCCAGCCTTGGG - Intergenic
911104415 1:94118681-94118703 CCCAGACCAGGCCCAGCCCTGGG + Intronic
912437098 1:109669324-109669346 CCCAGAGCAACGCCATCCTGCGG + Exonic
912526866 1:110290006-110290028 CCCAGACCTCAGCCATCTCTGGG + Intergenic
915674581 1:157518400-157518422 GCCAGAACAGAGACATCCTTGGG + Intronic
922030545 1:221793517-221793539 CACAGAGCAGAGTCAGCCTTTGG + Intergenic
924026932 1:239843141-239843163 CTCAAACAAGGGCCATCCTTTGG + Intronic
1066270157 10:33814477-33814499 CCTAGCCCAGATCCAACCTTGGG - Intergenic
1066435319 10:35392322-35392344 CCCAGAACAGTGCCTTCCTCTGG - Intronic
1074005006 10:109412860-109412882 CCTAGCCTAGAACCATCCTTTGG + Intergenic
1074357163 10:112796617-112796639 CCCACACCAGGGCCAACCTGGGG - Intronic
1074536234 10:114330229-114330251 GCCAGTCCAGAGCCATTCTGGGG + Intronic
1076934314 10:133557197-133557219 CCCAGCCCAGTGCCCTCCTGGGG - Intronic
1077115624 11:883346-883368 CCCGCACCTGAGCCATCATTGGG + Intronic
1077338795 11:2016990-2017012 CACAGACCAGGGCCTCCCTTTGG - Intergenic
1077652136 11:3982860-3982882 CCCAGCCCATAACAATCCTTAGG + Intronic
1081665194 11:44912514-44912536 CCCAGACCAGGGCTATCCACAGG + Intronic
1083596136 11:63919028-63919050 TCCAGAGCAGAGTCTTCCTTTGG - Intergenic
1084307957 11:68298994-68299016 CCCAGGTCAGAGCCCTCCTTAGG + Intergenic
1084672581 11:70616010-70616032 CCGAGACCAGAGCCTGCCTCTGG + Intronic
1084856869 11:71995003-71995025 CACAGATCAGAGCCACTCTTAGG + Intronic
1085253908 11:75161583-75161605 CCCAGATCAGAGGAATCCTGAGG + Intronic
1090400153 11:126443768-126443790 CCCAGAGCAGGGCCCTCCTGAGG - Intronic
1090805428 11:130199247-130199269 CCAAGACCAGAGCCAGCCCGTGG - Intronic
1202821779 11_KI270721v1_random:72172-72194 CACAGACCAGGGCCTCCCTTTGG - Intergenic
1091842358 12:3630230-3630252 TCCTGACTTGAGCCATCCTTCGG - Intronic
1092084080 12:5741435-5741457 CCCAGACCAAAGCCAGTGTTAGG - Intronic
1096316213 12:50568550-50568572 CCAGGACCAGGCCCATCCTTGGG + Intronic
1096576087 12:52553703-52553725 CCCAGGCCAGAGCCAACCACGGG + Intergenic
1100514198 12:95310778-95310800 CCCAGACAACTGCCATCTTTTGG - Intergenic
1101541776 12:105672012-105672034 CCCTCACCAAAGCCATCCTTGGG - Intergenic
1101550739 12:105759284-105759306 CCAAGACCAGAGGCAACGTTGGG - Intergenic
1101986805 12:109453513-109453535 CCCAGACCTGAGCATTCCTGTGG + Intronic
1103237956 12:119389707-119389729 CCCAGACCCAAGGCATCTTTAGG + Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104056377 12:125234030-125234052 CCCTGACTACAGCAATCCTTTGG - Intronic
1104735612 12:131134224-131134246 CCTAGGCCAGGGCCAACCTTGGG + Intronic
1104794969 12:131511054-131511076 CCCAGACCAGGGCTGGCCTTGGG - Intergenic
1105206527 13:18230514-18230536 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1106057310 13:26250538-26250560 GCCATACCAGAGCCCTTCTTGGG + Intergenic
1107630828 13:42341516-42341538 CCCACTCCAGAGCCAGCCCTGGG - Intergenic
1118541140 14:66826914-66826936 ACCAGACCAGCCCCATCCTGAGG + Intronic
1118674523 14:68169268-68169290 CCCAGACCAGAGTCATATTCTGG + Intronic
1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG + Intronic
1119806908 14:77488030-77488052 CCCAGCCCATAGCCAACCTCTGG + Intronic
1121013745 14:90536067-90536089 CCTTGACCAGAGCCATGCTGGGG - Exonic
1122429313 14:101629894-101629916 CCCAGCCCAGGGCCACCCTTTGG + Intergenic
1122595831 14:102891162-102891184 CCCTGAGCACAGCCCTCCTTAGG + Intronic
1122813835 14:104302469-104302491 CCCAGCCCAGCGTCAGCCTTGGG + Intergenic
1125333364 15:38603723-38603745 CAAAGTCCAGAGCCATCCTCAGG - Intergenic
1125955284 15:43786769-43786791 CCTAGAAGAGAGCCAGCCTTAGG - Intronic
1131109323 15:89754951-89754973 CCCAGAGCAGAGACAGCCTGAGG - Intergenic
1132057566 15:98663691-98663713 CCCAGCCCAGAACCAGCCTCGGG - Intronic
1132986824 16:2771661-2771683 CAAAGACCAGAGCCAGCCTCAGG - Intronic
1133076130 16:3282754-3282776 CCCAGACCCGAGCGCTCCTCTGG + Intronic
1133346280 16:5072639-5072661 CCCACCACAGAGCCATCCCTAGG - Intronic
1138219220 16:55236778-55236800 CAAGGACCAGAGCCATCCATTGG + Intergenic
1141521089 16:84580097-84580119 TCCAGACCAGTGCCAGCCCTTGG - Intronic
1142039293 16:87882229-87882251 CCCAGACAAGTGCCTTCCTCTGG + Exonic
1145685987 17:26664664-26664686 CTCAGAGCAGAGCATTCCTTTGG + Intergenic
1146252553 17:31362041-31362063 CCCAGACCAGCAGCATCATTTGG + Intronic
1147188441 17:38725425-38725447 CCCAGGCCAGAGGCTTCCATTGG + Intronic
1147478729 17:40738683-40738705 CCTAGACCAGAGCCTTTATTGGG - Intergenic
1152122663 17:78428285-78428307 CCCAGACAAAAGGGATCCTTGGG - Intronic
1152537934 17:80961167-80961189 CCCAGCCCTGAGCCAGCCTGGGG + Intronic
1152937434 17:83148616-83148638 CCCAGTCCAGAGAGATGCTTGGG - Intergenic
1153666469 18:7371097-7371119 CCCAGGCCAGGGCCCTACTTTGG - Intergenic
1157515122 18:48305365-48305387 CCCTGAGCAGAACCATCCTGGGG - Intronic
1158986950 18:62827556-62827578 ACCAGATCAGACACATCCTTAGG - Intronic
1165273719 19:34731767-34731789 CCCAGCCCCGAGCCAGCCTCAGG + Intergenic
1165718654 19:38063365-38063387 CTCAGCCTAGAGCCATCCTCAGG + Intronic
1166049487 19:40249473-40249495 CCCAGCCCTGGGCCATCCTGCGG + Intronic
1166742373 19:45122196-45122218 CTCAGCCCAGAGCCAGCCTGGGG - Intronic
1167456543 19:49599287-49599309 CCCAGACCCTCGCCAGCCTTGGG - Exonic
1168121506 19:54254658-54254680 CCCAGCCCAGAGCTCTCCTGGGG + Intronic
1168125014 19:54278182-54278204 CCCAGCCCAGAGCTCTCCTGGGG + Intronic
1168176968 19:54633372-54633394 CCCAGCCCAGAGCTCTCCTGGGG - Intronic
925088265 2:1131053-1131075 CCCAGACAAGACACAGCCTTGGG + Intronic
928389659 2:30899322-30899344 CCCAGAGCGGAGCCTTCCCTGGG - Intergenic
931653207 2:64487498-64487520 ACAAGCCCAGAGACATCCTTAGG + Intergenic
932894281 2:75623515-75623537 GCCAGTGCAGAGCCAGCCTTTGG - Intergenic
935592680 2:104856044-104856066 CCCACACCAGGGCCACCCTGGGG + Exonic
936081225 2:109433998-109434020 TCCAGACCAGAGACCTTCTTCGG - Intronic
936519331 2:113201872-113201894 CCCAGAGCAAGACCATCCTTGGG - Exonic
938390594 2:130902012-130902034 CCGAGTCCAGAACCATTCTTGGG - Intronic
938397280 2:130961016-130961038 CTCAGGCCACAGCCATCTTTAGG + Intronic
938589895 2:132726384-132726406 GCCACACCAGTGACATCCTTAGG - Intronic
940094074 2:149953602-149953624 CCCTGACCTCAGCCATCCTTGGG - Intergenic
942173643 2:173310419-173310441 CCCATTCCATAGCCAGCCTTGGG + Intergenic
942512524 2:176717605-176717627 CCCAGTCCAGAGCCCCCCGTGGG - Intergenic
943095822 2:183428200-183428222 CCCAGAGAAAATCCATCCTTGGG - Intergenic
943729979 2:191292310-191292332 CCCATAACACAGCCCTCCTTGGG + Intronic
945989267 2:216380188-216380210 CCCAGCCCAGAGCCATCTGCCGG + Intergenic
946400459 2:219465694-219465716 CGCAGCCCAGAGCTGTCCTTGGG + Intronic
946878567 2:224155217-224155239 CCCAGACAAAGGCCAGCCTTGGG + Intergenic
947625688 2:231616817-231616839 CCCTGACCAGGGCCGGCCTTGGG + Intergenic
1169134578 20:3189623-3189645 TCCAGGGCAGAGCCTTCCTTAGG - Intergenic
1169154561 20:3318602-3318624 CCCTGATCAGAGACACCCTTGGG + Intronic
1169506774 20:6220013-6220035 CCCAGGCCAGAGCAATGGTTAGG - Intergenic
1172157622 20:32839776-32839798 ACCACACCAGGGCCAGCCTTAGG - Exonic
1172215782 20:33234678-33234700 CCCAGGCCTGAGGGATCCTTTGG - Intergenic
1173059699 20:39650001-39650023 CCCAGCCCAGAGCCTGGCTTAGG + Intergenic
1174214052 20:48902591-48902613 CTCAAAGCAGAGCCATCCTCAGG - Intergenic
1175328140 20:58143829-58143851 CCCAGACCAAAGCCATTCAAAGG + Intergenic
1178131885 21:29582624-29582646 CACAGAGCAGAGACCTCCTTTGG - Intronic
1180759425 22:18188194-18188216 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1180769735 22:18372494-18372516 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1180776594 22:18490172-18490194 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1180809322 22:18747541-18747563 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1180827672 22:18875450-18875472 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1181072243 22:20352522-20352544 CCCTCACCAGAGCCATCCCCGGG + Intronic
1181195317 22:21181463-21181485 CCCTCACCAGAGCCATCCCCGGG + Intergenic
1181214130 22:21311311-21311333 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1181513969 22:23401200-23401222 CCCAGACCAGCCCCATCCCTGGG - Intergenic
1182983552 22:34695715-34695737 CACACACCAGAGCCAGCCTTTGG + Intergenic
1183298495 22:37046342-37046364 CCCAAACCAAAGCCTTCCCTAGG + Intergenic
1183751620 22:39724177-39724199 CCCAGCCCAGAGCCCTCCCGAGG - Intergenic
1184169915 22:42752646-42752668 CCCTTTCCAGAGCCAGCCTTTGG - Intergenic
1184727387 22:46354934-46354956 CCCAGACCAGGGCCAGTCCTGGG + Intronic
1185086622 22:48744334-48744356 CCCAGATGAGGGCCACCCTTGGG + Intronic
1203231564 22_KI270731v1_random:113678-113700 CCCTCACCAGAGCCATCCCCGGG - Intergenic
1203277772 22_KI270734v1_random:101447-101469 CCCTCACCAGAGCCATCCCCGGG - Intergenic
950394886 3:12726522-12726544 GCCAGTCAAGACCCATCCTTTGG + Intergenic
950873123 3:16246239-16246261 CACAGCCCAGGGCCATCCTGAGG + Intergenic
959977104 3:112473209-112473231 CCAAAACCAGAGCTAGCCTTGGG + Intronic
960424101 3:117485170-117485192 ACCAAACCAGAGGCTTCCTTGGG + Intergenic
962311222 3:134328353-134328375 CCCACAGCTGAGTCATCCTTGGG + Intergenic
962797389 3:138861170-138861192 CCCAGCCCAGCCCCAGCCTTTGG + Intergenic
962966399 3:140358274-140358296 CCCAGCCCAGAGCCACCTCTGGG - Intronic
963549536 3:146702614-146702636 CCAAGACCATCCCCATCCTTTGG + Intergenic
966428755 3:179809286-179809308 CTTAGACCAGGGCCAACCTTCGG - Intronic
967929150 3:194678060-194678082 CCCAGGCCAGGGCCCTCTTTAGG - Intergenic
967929379 3:194679668-194679690 CCCAGACCAGGGCCCTCTTTAGG - Intergenic
968313285 3:197701701-197701723 CCCATACCTGAGCCATTGTTGGG + Exonic
969118700 4:4890795-4890817 GTCAGACCAGAGCCTGCCTTTGG - Intergenic
969447350 4:7252973-7252995 CCCAGCTCAGAGCCAGCATTTGG + Intronic
969704513 4:8784548-8784570 CCCAGACCAGGGCTATCCAGGGG + Intergenic
970737542 4:19192265-19192287 CCCAAACCAGAGTCTTCCCTTGG + Intergenic
971065359 4:23026217-23026239 CCAAAACCAGTCCCATCCTTTGG - Intergenic
971481857 4:27122096-27122118 CCAGGACAAGAGACATCCTTAGG - Intergenic
974403425 4:61433940-61433962 TCCAGAGCAAATCCATCCTTAGG + Intronic
974490658 4:62559332-62559354 CCCAGACAAGAGGCATCTATCGG - Intergenic
976476648 4:85491696-85491718 CTCTGGCCAGAGCCCTCCTTGGG - Intronic
984871747 4:184331711-184331733 CCCAAACCAGAGACAGCATTTGG + Intergenic
985207681 4:187557585-187557607 ACCAGACATGAGCCATGCTTGGG + Intergenic
985553984 5:547202-547224 TCCAGGGAAGAGCCATCCTTGGG - Intergenic
987403746 5:17503761-17503783 CCAAGACCATAGCTCTCCTTAGG + Intergenic
987411213 5:17616506-17616528 CCAAGACCATAGCTCTCCTTAGG + Intergenic
987413640 5:17639826-17639848 CCAAGACCATAGCTCTCCTTAGG + Intergenic
988689563 5:33558984-33559006 CAAAGACCAGAGCCTTGCTTTGG + Intronic
995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG + Intronic
997303685 5:132823949-132823971 CCCAGCCCAGAGCCACCCCTGGG - Exonic
997641394 5:135451058-135451080 CCCAGACCATACCCAGCCCTTGG - Intronic
997964587 5:138347174-138347196 CCCAGAGCAGACCCTTCCTATGG + Exonic
998386768 5:141761751-141761773 CCCAGTTCAGAGCTATGCTTAGG - Intergenic
1002467621 5:179415575-179415597 CCAAGAGTAGAGCCAGCCTTAGG + Intergenic
1002536841 5:179880443-179880465 CCCAGGCCAGAGCCCACCATGGG - Intronic
1004342745 6:14821819-14821841 TCAAGACAAGAGCCATCATTTGG + Intergenic
1006600869 6:35224889-35224911 CCCAGAGCAGTGCTATCCTGTGG + Intronic
1007665860 6:43512632-43512654 CCCAGGGCAGAACCATCTTTGGG + Intronic
1015766204 6:136719688-136719710 CCCAAATCTGAGCCAACCTTGGG - Intronic
1016357001 6:143228730-143228752 CCCAGACCACACCCATCTTGGGG - Intronic
1017820227 6:158043893-158043915 CACTGACCAGAGCCCTGCTTTGG - Intronic
1018178619 6:161200782-161200804 CAGAGACAAGAGCCATCCTGCGG - Intronic
1018834287 6:167471470-167471492 GACAGACCAGCGGCATCCTTGGG + Intergenic
1019609459 7:1929633-1929655 CCCACACCAGAGACAGCCCTTGG + Intronic
1020277525 7:6633982-6634004 CCCAGGTCAGAGGCATCCTCAGG + Intergenic
1021800919 7:24305576-24305598 CCCAGCCAAGATCCCTCCTTGGG - Intergenic
1021861914 7:24914243-24914265 CCCAGACCAGAGCCAGCCATTGG + Intronic
1022105009 7:27191205-27191227 CAAGGACCAGAGCCAACCTTCGG - Intergenic
1022497731 7:30863620-30863642 CCCAGACCAGAGCCAGGGTGAGG + Intronic
1024219140 7:47274038-47274060 CCCCGACCAGAGCCAGCCCTGGG - Intergenic
1026644582 7:72156551-72156573 GCCAGCACAGAGCCATCCCTTGG + Intronic
1027048624 7:75007655-75007677 CCCACACTGGAGCCACCCTTCGG + Intronic
1028832819 7:95345129-95345151 CCCTAACCAGGGCCATCCTCTGG + Intergenic
1029384383 7:100233994-100234016 CCCACACTGGAGCCACCCTTTGG - Intronic
1030359863 7:108583628-108583650 ACTCGACCAGAGGCATCCTTGGG - Intergenic
1030710101 7:112739761-112739783 CCCAGAGCAGACACACCCTTAGG - Intergenic
1030965149 7:115982697-115982719 CCAAGGCCAGAGCAATTCTTGGG + Intronic
1032240560 7:130155548-130155570 CCCAGCACAGAGCCCTCCTAAGG - Intergenic
1032536638 7:132669883-132669905 CCCAGACCTGAGAAATCATTAGG + Intronic
1033130300 7:138740233-138740255 CCCAGCCCAGGGACATGCTTGGG + Intronic
1034158660 7:148976263-148976285 CCCAGACCTGCGCCAGGCTTTGG + Intergenic
1035089512 7:156295613-156295635 CCCAGACGACAGTGATCCTTGGG + Intergenic
1035756453 8:2036440-2036462 CCCATACCACACTCATCCTTAGG - Intergenic
1035859203 8:3009915-3009937 CTCAAACCAGGGCCATCATTTGG + Intronic
1037121307 8:15290486-15290508 CCCAGGACAGTGCCCTCCTTGGG - Intergenic
1038154782 8:24978998-24979020 CTCAGATCAGAGCCAACGTTGGG - Intergenic
1038499330 8:28030401-28030423 CCCAGATAAGTGCCATCCTCGGG - Exonic
1040815344 8:51502331-51502353 CCCGGAGCAGAGCCTTTCTTGGG + Intronic
1041127715 8:54661636-54661658 CCCACACCAGCTCCATCCTCTGG - Intergenic
1044557472 8:93579279-93579301 CCCTGACCAGTGCTATACTTGGG + Intergenic
1048182909 8:132212848-132212870 TCCAGGCCTGAGCCATCCCTGGG + Intronic
1049470642 8:142773738-142773760 CCCTGACCAGGGCCATACTTTGG + Intronic
1049600477 8:143505184-143505206 CTGAGACCAGAGCTCTCCTTGGG - Intronic
1051835992 9:21338208-21338230 ACCAGACCTCATCCATCCTTGGG - Intergenic
1059460417 9:114426077-114426099 CCCACACCAGGGCCCTCCATTGG - Intronic
1060991871 9:127854171-127854193 CGCCCAGCAGAGCCATCCTTGGG - Intronic
1061159679 9:128886099-128886121 CAGATAGCAGAGCCATCCTTGGG + Exonic
1061258188 9:129464972-129464994 ACCAGCCCAGAGCCCACCTTGGG + Intergenic
1061294685 9:129670775-129670797 ACAAGACCAGAGCCAGGCTTTGG + Intronic
1061466704 9:130786135-130786157 CCCAGGCCAGAGCCTTTGTTGGG + Intronic
1061896795 9:133652422-133652444 CCCAGCCCAGAGCCACCCACAGG - Intronic
1062249709 9:135588022-135588044 CACAGACCAGGGCCATGCTCAGG - Intergenic
1062279804 9:135746889-135746911 CCTAGACCAGAGCCATCAGCAGG - Intronic
1062379255 9:136279185-136279207 CCCAGACCAGAGCTGTCCAATGG - Intergenic
1062379261 9:136279227-136279249 CCCAGACCAGAGCTGTCCAATGG - Intergenic
1062634661 9:137484550-137484572 CCCAGCCTCCAGCCATCCTTGGG - Intronic
1186472073 X:9829465-9829487 CAAGGACCAGAGCCATCCTTTGG + Intronic
1186499387 X:10039059-10039081 CCCAGCCCTCAGCCATCCTTTGG - Intronic
1191077206 X:56468252-56468274 TGCAGTCCAGCGCCATCCTTAGG - Intergenic
1194143906 X:90240699-90240721 CCCAGACCAGAAGCCTCCCTGGG - Intergenic
1195094610 X:101492149-101492171 CCCAGCCCAGAGCCCTCCACTGG - Exonic
1195657171 X:107343130-107343152 CCAAGGCCAGAGCCAGACTTCGG + Intergenic
1198730582 X:139723420-139723442 CAGAGGCCAGAACCATCCTTAGG - Intergenic
1201562339 Y:15331556-15331578 GCCAGAGCTGAGCCATTCTTGGG - Intergenic