ID: 1118716086

View in Genome Browser
Species Human (GRCh38)
Location 14:68561086-68561108
Sequence CAGAGGAAGGTGTAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 631}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118716086 Original CRISPR CAGAGGAAGGTGTAGGAGGC AGG (reversed) Intronic
900315086 1:2052365-2052387 AAGAGGAAGGGGTGGGAGCCTGG - Intronic
900788817 1:4666317-4666339 GAGAGGAAGGTGTATGTTGCGGG + Intronic
901197891 1:7450437-7450459 CAGAGGTGGGTGGAGGTGGCAGG - Intronic
901295376 1:8157099-8157121 CAGAGGAAGGTGTGGGGAGGGGG - Intergenic
901312716 1:8282000-8282022 CAGAGCCACGTGGAGGAGGCGGG - Intergenic
901522224 1:9793894-9793916 CAGGGGAAGCTCTAGGAAGCTGG - Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
902361484 1:15944661-15944683 CAGGGGCCGGGGTAGGAGGCCGG + Intronic
902618233 1:17635443-17635465 CAGAGGGAGGTGAGTGAGGCAGG - Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902782534 1:18713791-18713813 TAAAGGAAGGGGTAGGAGGTTGG + Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902827989 1:18990191-18990213 CAGGTGAACGTGTTGGAGGCAGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
902922828 1:19677427-19677449 AGGAGGAAGGGGTAGGAGGGAGG - Intronic
903286008 1:22277205-22277227 CAGAGGCCGGTGGGGGAGGCTGG + Intergenic
903287483 1:22285967-22285989 CGGGGGAATGTGTAGGAGGGAGG - Intergenic
903318611 1:22527938-22527960 CAGAAGCAGGTGTAGTCGGCTGG - Exonic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
904030047 1:27528045-27528067 CGGAGGAAGGAGTTGGAGGAGGG + Intergenic
904712908 1:32444478-32444500 TAGAGGAAGGTGCAGGTGACGGG + Intergenic
905025229 1:34845135-34845157 CAGAGGGAGATGTAGGATGCTGG + Intronic
905237601 1:36560813-36560835 AAGAGGAGTGTGGAGGAGGCTGG + Intergenic
906000266 1:42418746-42418768 CTGAGGAAGATGTAAGCGGCTGG + Exonic
906553048 1:46682313-46682335 CAGAGGAAGGTGTGGTGGACAGG + Intronic
906869091 1:49456720-49456742 CAGAGGAAAGGGTAGGAGCGGGG - Intronic
907105443 1:51878554-51878576 CGGAGGAAGTTGTGTGAGGCCGG - Exonic
907314090 1:53557421-53557443 TAGAGGAAGGTTTAGGAGACTGG + Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907974997 1:59423069-59423091 CAGAGGATTGTGTAGCAGGAGGG + Intronic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
908815590 1:68029806-68029828 CAGAGGAAAGTGTGGAAGGGGGG - Intergenic
910106896 1:83641518-83641540 AAGAGGAGGATGTGGGAGGCAGG - Intergenic
910182012 1:84494875-84494897 TAGAGGAAAGTTTAGGAGTCTGG + Intronic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
911076579 1:93881272-93881294 CAGAGGTAGGTGTAGAAAACTGG + Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911658665 1:100475533-100475555 CAGAGGAAGGTGGTGGCAGCTGG + Intronic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913403067 1:118457313-118457335 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
913521732 1:119650910-119650932 CAGAGGAAGGCTTGGGAGGGAGG + Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
915933918 1:160078822-160078844 CAGAGGAAGGTGGCACAGGCAGG + Intergenic
916293065 1:163187646-163187668 CAGAGGATGGTGTACCAGGTAGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
917145905 1:171891166-171891188 ATAAGGAAGGTGAAGGAGGCAGG + Intronic
917491704 1:175503805-175503827 AAGAGGAAGATGGGGGAGGCAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
919592635 1:199523605-199523627 CAGGGGAAAGGGTAGGAGGGAGG - Intergenic
919798413 1:201335955-201335977 CAGAGAGAGGTGTAGAAAGCAGG - Intergenic
920364157 1:205439344-205439366 CAAAGGAAGGGGTTGGAGGATGG + Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921566545 1:216728494-216728516 GAGAGGAAGGTGGCGGGGGCGGG + Intronic
922040247 1:221889294-221889316 CAGAGGGAAGTGGAGGAGGTAGG + Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
924064829 1:240210224-240210246 CTGTGGAATGTGTAGGTGGCAGG + Intronic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063173820 10:3533864-3533886 CGGAGGAAGGTGCAGGAAGGTGG - Intergenic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1068627933 10:59269386-59269408 AAGTGGAATGTGTAGGGGGCAGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071598499 10:86944615-86944637 CTGCTGTAGGTGTAGGAGGCAGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072299398 10:94044686-94044708 CCGAGGAAGGTGGAAGAGACAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1073127511 10:101160869-101160891 CAGAGGAAGATGGATGTGGCAGG - Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073481044 10:103786296-103786318 CACAGGTAGGTGGAGGAGCCAGG - Intronic
1074221896 10:111446067-111446089 CAGAGGGAGGGTTAGAAGGCTGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1075010544 10:118866121-118866143 CAGGGGGTGGTGGAGGAGGCAGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1076797136 10:132803877-132803899 CAGAGGGAGGTGTGGGAGAGGGG + Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077152324 11:1077845-1077867 CAGAGGAAGGTGGGGCAGGAAGG - Intergenic
1077163015 11:1122145-1122167 AAGAGGGAGGTAGAGGAGGCTGG - Intergenic
1077651599 11:3978123-3978145 CACAGGCATATGTAGGAGGCTGG - Intronic
1078786643 11:14500585-14500607 CAGAGGGAGGTGTAGGGGCGGGG - Intergenic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080062773 11:27974518-27974540 CAGAGGAAGGTAAAGGAGATTGG - Intergenic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1081573944 11:44308041-44308063 AAGAGGAAGGTGGAGGAAGTGGG + Intronic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083728397 11:64640342-64640364 AAGAGGAAGGTGTAGGAGAGAGG - Intronic
1084047722 11:66579727-66579749 CAGAGGAGCTTGTTGGAGGCAGG - Intergenic
1084274331 11:68043927-68043949 CGGAGGCGGGTGTAGGAGGTGGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1085027269 11:73243545-73243567 GAGAGGACGGCTTAGGAGGCTGG - Intergenic
1085299416 11:75449672-75449694 CATAGGTAGAAGTAGGAGGCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086539352 11:87889233-87889255 CAGAGGGAGGTGGAGAAGGGTGG - Intergenic
1087642456 11:100769825-100769847 CAGGGGGAGGTGTAGGGGGATGG + Intronic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1088889016 11:114030276-114030298 CAGAGGCAGGTGTAGAAGAGGGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1088994459 11:114984640-114984662 CACAGGAAGATGGAGGAGGAGGG - Intergenic
1089105759 11:116002602-116002624 GAGAGGAAGGTGTAAGATTCTGG - Intergenic
1089609737 11:119662756-119662778 CAGAGGGAGGTGGAGGAGCTGGG - Exonic
1090104065 11:123832947-123832969 CAGAGGAAAGTGTCGGAAGAGGG + Intergenic
1090204900 11:124878686-124878708 CATAGGAAGGTGTGGGAGAGGGG - Exonic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090764145 11:129862573-129862595 CGGAGGAGGGTCTGGGAGGCTGG - Intergenic
1091304789 11:134530355-134530377 CAGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091362387 11:134987721-134987743 GGGAGGAAGGTGGAGGAGGGAGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091896780 12:4111260-4111282 AAGAAGAAGATGTAGGAAGCTGG + Intergenic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092743827 12:11654637-11654659 AAGAGGAAGTAGTAGGAGGGAGG + Intronic
1093850545 12:24031526-24031548 CAGAGGTGGATGAAGGAGGCTGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1095386505 12:41657129-41657151 CAGAGGAAAGTCTAGAACGCAGG + Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096601509 12:52733046-52733068 AAGACGATGCTGTAGGAGGCAGG + Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1098119663 12:67222685-67222707 CATAGGATGATGGAGGAGGCTGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1100013423 12:89980481-89980503 GAGAGGAAGTTGGAGGAGGCTGG - Intergenic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103746992 12:123131681-123131703 CAGTGGAAGGTGTGGCTGGCTGG - Intronic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104092901 12:125530649-125530671 CAGCGGAAGCTGGAAGAGGCAGG - Intronic
1104999024 12:132676722-132676744 CAGAGGGAGGTAGAGCAGGCTGG - Intronic
1105722380 13:23129222-23129244 CAAAGGAAGGAGTAGGAGTAGGG + Intergenic
1105988530 13:25593672-25593694 GAGAGGAATGGGTAGGAGGAGGG + Intronic
1106278692 13:28242110-28242132 TAGAGGAATGTGAAGGAAGCTGG - Intronic
1107302057 13:38976307-38976329 CAGAGGGAGACTTAGGAGGCCGG + Intronic
1107785489 13:43952452-43952474 AAGAGGAAGATGTGGGACGCTGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108830994 13:54478051-54478073 CAGAGGAAGGGATTTGAGGCAGG + Intergenic
1109109366 13:58296351-58296373 CAAAAGAAAGTGTAGGAAGCTGG + Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1112558750 13:100493156-100493178 CAGGGGCAGGTGTAGGAGCTGGG - Intronic
1113436582 13:110296936-110296958 CAGAGCAAGGTGTAGGGGAAGGG + Intronic
1113565329 13:111316338-111316360 CAGAGGGTGGTGTGGGTGGCGGG - Intronic
1113582741 13:111440448-111440470 CAGGGGAAGCTGCAGGGGGCAGG - Intergenic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114146152 14:19980352-19980374 TAGGGGAAGGTGTAGGTGGTGGG - Intergenic
1114236042 14:20824613-20824635 TAGAGGAAGGTGCAGGTGGTGGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1117376523 14:55123032-55123054 CAGAGGGACAGGTAGGAGGCAGG + Intergenic
1117480503 14:56139225-56139247 CCAAGGAAGGTGGAGGAGGAGGG + Intronic
1117487049 14:56208423-56208445 CACTGGAAGGTGTAGGAGAATGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118729234 14:68654972-68654994 GAAAGGAGGGAGTAGGAGGCTGG + Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119510512 14:75207539-75207561 AAGATGAAGGTGTGGGAGGAAGG + Intergenic
1119860007 14:77929479-77929501 AAGAGGAAGCTGTTGGAGGGAGG - Intronic
1120342287 14:83236955-83236977 CTGAGGAAGCTCTGGGAGGCTGG - Intergenic
1120418665 14:84254300-84254322 CAGAGGAGGGTGTAAAAGTCCGG + Intergenic
1120421918 14:84298317-84298339 CAGAGGAAAAGGTAGGAGGGAGG + Intergenic
1120499384 14:85275597-85275619 CAGAAGAATGTGTAGAAGGTAGG + Intergenic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1121660723 14:95633066-95633088 CAGAGGAAGCCATGGGAGGCAGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1123072649 14:105649232-105649254 GAGGGGAAGGGGTAGGGGGCAGG + Intergenic
1123098235 14:105776459-105776481 GAGGGGAAGGGGTAGGGGGCAGG + Intergenic
1123581532 15:21718941-21718963 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1123618181 15:22161564-22161586 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1124934408 15:34156640-34156662 TAGGGGAAGGTGTAGGCGGTGGG + Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1127318029 15:57815925-57815947 CAGAGGAAGCTGCAGAGGGCAGG + Intergenic
1127640720 15:60913373-60913395 GAGAGGTGGCTGTAGGAGGCTGG - Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128243279 15:66116025-66116047 CAGCGGGAGGTGCAGGTGGCTGG - Intronic
1128665222 15:69532590-69532612 CAGAGGAAGGTGTAGGGTTTGGG + Intergenic
1128888454 15:71309833-71309855 CAGAGGAAGGTGTGGCATGCAGG + Intronic
1129257132 15:74339873-74339895 CAGAGGATGGTCTTGGAGACTGG - Intronic
1130371500 15:83288599-83288621 CAGAGGAATGTGGAGGACTCAGG - Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1131150858 15:90046473-90046495 TAGAGGAGGGTGGAGGAGGGCGG + Intronic
1131869827 15:96751776-96751798 CTGAGGAAGGTGTAAGACTCAGG - Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133130074 16:3671514-3671536 CAGAAGAAGGTGGGGGTGGCTGG - Intronic
1133599331 16:7323788-7323810 AAGATGAAGATGTAGGAGGAAGG + Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1135619378 16:23942222-23942244 CAGAGGGAAGTGTAGGAAACTGG + Intronic
1135945731 16:26863325-26863347 CAGAGGTAGGTATAGGAACCAGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136168467 16:28472542-28472564 TAGAAGAAAATGTAGGAGGCTGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137667715 16:50261442-50261464 GAGAGGCAGGAGGAGGAGGCAGG + Intronic
1137782960 16:51113567-51113589 CAGAGGGAGGTCACGGAGGCCGG + Intergenic
1137831840 16:51551247-51551269 CTGAGGAAGGTGTGAGAGGACGG - Intergenic
1138191006 16:55014186-55014208 CAGAGGAAGGAGTAGAAGATTGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141981104 16:87550970-87550992 CACACGGAGGTGGAGGAGGCGGG - Intergenic
1141981332 16:87552121-87552143 CACAGGAGAGTGGAGGAGGCAGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142246655 16:88973272-88973294 CAGAGGAAGATTTGGGAGGGAGG + Intronic
1142247420 16:88976396-88976418 CAGAGGCAGATGCTGGAGGCCGG - Intronic
1142251140 16:88992628-88992650 CAGAGGAAGGCCAAGCAGGCCGG - Intergenic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1142466428 17:140017-140039 CAGAGGCAGCGGTATGAGGCGGG + Intergenic
1142716845 17:1751821-1751843 AAGAGGGAGGTGTGGGAGGGTGG + Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143383422 17:6510328-6510350 CGGAGGGAGGTGTGGGAAGCAGG - Intronic
1143476751 17:7207524-7207546 CGGAGGTAGGGGGAGGAGGCGGG + Intronic
1143563554 17:7708761-7708783 CAGAGGAAGCTGGGGAAGGCAGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143614177 17:8039641-8039663 CACAGGAAGGGGTAGGGGACTGG + Intronic
1144123941 17:12183489-12183511 CACAGAAAGGTGTGGGAGGGTGG - Intergenic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1146912967 17:36659859-36659881 CAGAGGAGGGTGTCTGGGGCGGG + Intergenic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1147794707 17:43034159-43034181 CTGAGGAAGGTGTGGGGGGAGGG + Intergenic
1147847552 17:43415457-43415479 CAGTGGAGAGTGTAGGAGGCAGG + Intergenic
1148027614 17:44599665-44599687 CAGAGCAGGGTTTAGAAGGCAGG + Intergenic
1148150008 17:45391378-45391400 CTGAGGAGGGTGTAGGGGGCAGG + Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148675347 17:49441663-49441685 GAGAGGAAGGTGGAGGGGGAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148778642 17:50109749-50109771 GAGAGGGAGGGGGAGGAGGCTGG - Intronic
1148892642 17:50819287-50819309 CAAAGTAACGTGTGGGAGGCTGG + Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149663734 17:58351675-58351697 GAGAGGAAGGAGTGGGAGGGTGG - Intronic
1149775732 17:59355582-59355604 AGGAGGGAGGTGTAGGAGGAGGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151545688 17:74791500-74791522 CAAAGGAAGTTGATGGAGGCCGG + Intronic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1152356864 17:79811709-79811731 CAGAGGAAGGTGGTGGAAGCGGG + Intergenic
1152408255 17:80109442-80109464 CAGAGGAGGAGGTGGGAGGCAGG + Intergenic
1152586643 17:81192334-81192356 GAGAGGCAGGCGTGGGAGGCCGG - Exonic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152657644 17:81527407-81527429 CTGAGGCAGGTGCAGGAGCCAGG + Intergenic
1152818857 17:82425359-82425381 CAGAGGAGGCTGGAGAAGGCTGG + Intronic
1152920566 17:83064490-83064512 CAGAGGGAGGGATCGGAGGCTGG + Intergenic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153997232 18:10453881-10453903 AAGGGCACGGTGTAGGAGGCAGG - Intergenic
1154463280 18:14617921-14617943 TAGGGGAAGGTGTAGGTGGTGGG - Intergenic
1154493100 18:14936352-14936374 GGGAGGAAGGTGGAGGAGGGAGG - Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155377589 18:25177322-25177344 GAAAGGAAGGTGTGGGAGGCAGG + Intronic
1156479071 18:37424878-37424900 CACAGGAAGGAATAGCAGGCAGG - Intronic
1156675989 18:39528092-39528114 CAGAAGGGGGTGTGGGAGGCAGG - Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157322910 18:46647786-46647808 CAGAGGAAGCTGTAGAAGCCAGG - Intronic
1159247278 18:65823822-65823844 CAGAAGTAGATGCAGGAGGCAGG + Intronic
1159604012 18:70456482-70456504 AAGAGGAAGGTATCTGAGGCAGG + Intergenic
1160211274 18:76882188-76882210 CAGAGGAAGAGGTAGAAGGAAGG - Intronic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160522665 18:79517401-79517423 CAGAGGATGGTGGAGTAAGCTGG + Intronic
1160608059 18:80066982-80067004 CAGAGGAGGGTGCTGGAGGGAGG + Intronic
1160665659 19:326846-326868 CAGAGGCTTGTGAAGGAGGCCGG + Intronic
1160930074 19:1566417-1566439 CAGAGAAAGGTGTGGGGGGCTGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162835988 19:13318368-13318390 AAGAGGAAGGTGGTGAAGGCAGG + Intronic
1163063632 19:14777134-14777156 CAGGGGAAGGTGTGGCAGCCGGG + Intronic
1163666175 19:18605147-18605169 CAGGCGAAGGTGTAGGGGGTGGG - Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164438786 19:28255606-28255628 CAGCCAAAGGTGTAGGAGACAGG + Intergenic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1166764415 19:45244481-45244503 CAGAGGCGGGTGTTGGAGCCAGG - Intronic
1166831316 19:45641450-45641472 CAGTGGAAGGTCTGGGAGGGCGG - Intronic
1167154734 19:47731036-47731058 GAGAGGAAGGGGTAAGAGGAAGG + Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167694817 19:51009248-51009270 CCGAGTAAGGTGGAAGAGGCCGG + Exonic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925022192 2:580150-580172 CAGAGGGATGTGCAGAAGGCCGG + Intergenic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925435281 2:3831920-3831942 AAGAGGAAAGTGAAGAAGGCAGG - Intronic
925521127 2:4747004-4747026 GAGAGGTAGGTGTGGAAGGCTGG + Intergenic
927642866 2:24856521-24856543 CAGAGGGGGCTGTGGGAGGCAGG + Intronic
928190995 2:29168034-29168056 CCTAGGAAGGTGGAGGACGCAGG - Intronic
928398942 2:30964342-30964364 CACAGGGAGGTGGAGGTGGCTGG - Intronic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929420934 2:41788874-41788896 CAGGGGAAGATGTAGGATCCTGG - Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
931366640 2:61624939-61624961 CAGAAGAAGCTGTAGGATTCTGG + Intergenic
931690859 2:64833837-64833859 CAGAGGAAGGGATAGGGGTCTGG + Intergenic
932002242 2:67895667-67895689 CAGAGGAAGGGGTTGGGGGTTGG - Intergenic
932143109 2:69296955-69296977 CAGAGGAGGGGGTACCAGGCCGG - Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933271250 2:80235482-80235504 CTGAGGAAGTTGTGGGAAGCAGG + Intronic
933729654 2:85447088-85447110 CAGTGGTAGATGTAGGAGGCTGG + Intergenic
934986019 2:98885055-98885077 CATAGAAAGGTGTAGGAGTGTGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935473182 2:103484168-103484190 CAGAGAAACTTGTAGGAGGTAGG + Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937132465 2:119523893-119523915 CAGAGGAAGGGGTCGGTGGTGGG + Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
938145723 2:128833514-128833536 CAGAGGAAGGCGTGGGAGGAGGG + Intergenic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
940141769 2:150499376-150499398 CAGGGGAAAGGGTGGGAGGCAGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942761513 2:179404108-179404130 CAGAGGAAGGGGTAGGATATGGG - Intergenic
942944243 2:181656502-181656524 CCGGGGAAGGTCTCGGAGGCGGG + Intronic
943151160 2:184115390-184115412 CAGAGCAAGATGAAGCAGGCTGG + Intergenic
943570289 2:189565603-189565625 GAGAGGCAGGTGAAAGAGGCAGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
946149492 2:217754621-217754643 CAGAGCAATGTGTCTGAGGCTGG + Intronic
946693304 2:222326326-222326348 AAGATGCAGGTCTAGGAGGCTGG + Intergenic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
1168843068 20:922103-922125 CAGAAGAAGGTATAGGATGGGGG + Intergenic
1168952177 20:1810071-1810093 CAGAACAAGTTGTAGAAGGCAGG - Intergenic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169287946 20:4325273-4325295 CAGAGGGTGGTTTAGGAAGCAGG + Intergenic
1170271202 20:14528883-14528905 TGGAGGAAGGTATATGAGGCTGG + Intronic
1172887142 20:38239072-38239094 CAGCTGAAGGTGTAGGGGACTGG - Intronic
1173071893 20:39776172-39776194 GAGATGAAGGTGTAGGAGATGGG - Intergenic
1173284673 20:41659460-41659482 CAGAGGTATCTGTAGGAGACTGG + Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173656623 20:44704196-44704218 CAGGGGATGGTGGAGGAGCCTGG + Intergenic
1173687279 20:44932413-44932435 CACAGGAAGGTCTAGGTGGCTGG - Exonic
1173748115 20:45453530-45453552 GAGAGGAGGGGGTAGGAGGTAGG + Intergenic
1175715106 20:61250276-61250298 CAGAGGAGGGTGCAGAGGGCAGG - Intergenic
1175745204 20:61451706-61451728 AGGAGGAGGGGGTAGGAGGCTGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175759122 20:61549479-61549501 CAAAGGGAGGTTTAGGGGGCAGG + Intronic
1175766871 20:61598293-61598315 CAGGGGCTGGTGTTGGAGGCAGG - Intronic
1176811245 21:13540452-13540474 TAGGGGAAGGTGTAGGTGGTGGG + Intergenic
1177012491 21:15745129-15745151 GGGAGGGAGGTGTGGGAGGCAGG + Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177329310 21:19635656-19635678 CAGGGGAAGGGGTACGAGGTGGG + Intergenic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1177759432 21:25386489-25386511 CAGAGGAAAGTGTTGCAGCCAGG - Intergenic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1179653548 21:42830964-42830986 CACAGGAAGGTGCTGGAGCCAGG - Intergenic
1179987118 21:44928065-44928087 CAGAGGAAGGCAGAGGAGGGAGG - Intronic
1180007860 21:45031566-45031588 CAGAGGACGGGGTCAGAGGCTGG + Intergenic
1181088591 22:20456915-20456937 CAGAGGATGGTATGGGGGGCAGG - Intronic
1181412987 22:22738001-22738023 TGGAGGATGGTGCAGGAGGCGGG + Intronic
1182663685 22:31942869-31942891 AAGAGGAAGGCCTGGGAGGCAGG + Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183061837 22:35340889-35340911 CAGGGCAAGGTGGAGGACGCTGG + Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184523948 22:45010363-45010385 CAGAGGGAGGCGGAGGAGGGGGG - Intergenic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184726619 22:46351021-46351043 CGGAGGGAGGTGTAGGACCCTGG + Intronic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
950544131 3:13628879-13628901 CAGAGGCAGGTGTAGGTGACAGG - Intronic
950614401 3:14147656-14147678 CAGAGGCAGGTGTGGGCAGCAGG + Intronic
950809840 3:15640986-15641008 GGGAGGAAGGTGGAGAAGGCAGG - Intronic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
952331336 3:32367032-32367054 CAGAGGAAGGGGTAGGGGAAAGG - Intronic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953791908 3:45954088-45954110 CAGAGGAAGGTGTTCCAGGAAGG - Intronic
953958799 3:47251267-47251289 CAGAAGGTGATGTAGGAGGCTGG + Intronic
954099213 3:48356453-48356475 CAGAGGAAACTGCAAGAGGCTGG + Intergenic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
954701899 3:52454950-52454972 CGAAGGAAGGTGTAGGTGGATGG - Intergenic
955148196 3:56341206-56341228 TGGAGGAAGGTGGAGGGGGCAGG - Intronic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
956860741 3:73321324-73321346 TAGAGCAACTTGTAGGAGGCTGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960119327 3:113931224-113931246 CAGAGGATGGTGATAGAGGCAGG + Intronic
960239360 3:115322441-115322463 CAGAGGAAGATCTAAGAGCCAGG - Intergenic
960261497 3:115573614-115573636 CACAGGAAGGCTTAGAAGGCAGG + Intergenic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
960545192 3:118906273-118906295 GAGAGGAAGCTGCAGAAGGCAGG + Intronic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961139862 3:124546773-124546795 GAGAAGCAGGTGGAGGAGGCTGG + Intronic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961521260 3:127468588-127468610 CACAGGAATATGGAGGAGGCAGG + Intergenic
962478441 3:135778120-135778142 CACAGGAAGGGGTAGGAGATGGG + Intergenic
962495889 3:135938415-135938437 CAGAGCAAGGGCTAGCAGGCTGG - Intergenic
962653659 3:137520604-137520626 CAGTGGAATGTTTTGGAGGCTGG + Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963488487 3:145967824-145967846 CAGAGGAAGCTTTAGGAGTTAGG - Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964526739 3:157622751-157622773 CAGAAGAATGTGTACCAGGCAGG + Intronic
964668663 3:159201744-159201766 CTGAGGCAGGTGAATGAGGCAGG - Intronic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966227755 3:177616403-177616425 CAGAGGGAAATCTAGGAGGCAGG + Intergenic
967406463 3:189120902-189120924 CAGAGGAATGTGCAGGAAGTGGG + Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967813987 3:193783639-193783661 GGGAGGAAGGAGTAGGAGGGAGG - Intergenic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969465088 4:7351636-7351658 GAGAGGAAGGGATAGGAGGAGGG - Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969924597 4:10574458-10574480 CAGAGGAAGGTGGCAGAGGAGGG - Intronic
970092555 4:12426887-12426909 AAGAGGAAGGTGCAGGCGGTGGG + Intergenic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
971885856 4:32446695-32446717 TAGAGGAAGCTGTAGGATGTGGG + Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
972734892 4:41830810-41830832 CAGAGGTGGGTGTGGGAGGAAGG + Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
972810015 4:42573427-42573449 GGGAGGAGGGTGGAGGAGGCAGG + Intronic
973801351 4:54481844-54481866 CACAGGAAGGTGTCAAAGGCAGG + Intergenic
974096909 4:57373865-57373887 CAGGGCAAGGTGTAGGGGGTAGG + Intergenic
975669471 4:76766427-76766449 CAGAGGATGAGGTGGGAGGCAGG + Intronic
976384111 4:84435281-84435303 TAGATGAAGGGGTAGAAGGCTGG + Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
976849643 4:89530304-89530326 AATAAGAAGGTCTAGGAGGCAGG + Intergenic
977295487 4:95204376-95204398 CAGAGGCATGTGAAGTAGGCAGG + Intronic
977371107 4:96137399-96137421 CATAGCAATGTGTAGGAGACAGG + Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978153960 4:105468650-105468672 GAGATGAATGGGTAGGAGGCTGG + Intronic
978314224 4:107418001-107418023 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
978418993 4:108509738-108509760 CAGAGGAAGGTATGGGAGGAGGG + Intergenic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
979566201 4:122156911-122156933 CAGATAAATTTGTAGGAGGCAGG + Intronic
980295759 4:130914035-130914057 GAGAGGAAGGTGAAGGATACAGG - Intergenic
981716340 4:147756296-147756318 TAGAGGAAGGTGTGGGTGGTGGG + Intronic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
982895668 4:160920649-160920671 GAGAGGAAGTTGTAAGAGGGAGG - Intergenic
983001024 4:162413877-162413899 GAGAGAAAAGTGGAGGAGGCGGG + Intergenic
983195406 4:164800703-164800725 CAGAGAAAGCTGTAGAGGGCTGG - Intergenic
984159844 4:176238427-176238449 CAGAGGAAAGGGTAGTTGGCAGG + Intronic
985273838 4:188219021-188219043 CAGAAGAAGGTGCAAGCGGCTGG - Intergenic
985282630 4:188302081-188302103 TAGAAGACAGTGTAGGAGGCGGG + Intergenic
985293229 4:188407299-188407321 CACAGGCAGGTGCAGGAGCCAGG - Intergenic
985423149 4:189804115-189804137 CACAGGAAGGTACATGAGGCAGG + Intergenic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985644213 5:1077501-1077523 CAGAGAAAGATGTGGCAGGCAGG + Intronic
985844507 5:2334402-2334424 CAGCGGAACGTGCAGAAGGCAGG + Intergenic
985887921 5:2694556-2694578 CAGAGGCAGGGGTAGGAGCAAGG + Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986250014 5:6046679-6046701 GAGAGGAAGGGGTTGGGGGCTGG - Intergenic
986679799 5:10222337-10222359 AAGAGGCGGGGGTAGGAGGCAGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
987499368 5:18687506-18687528 CAGAGGATGAAATAGGAGGCTGG - Intergenic
988598507 5:32617643-32617665 GAGAGGAGGGTGTAGTAGGCAGG + Intergenic
988798874 5:34677983-34678005 GATAGGAAGATGCAGGAGGCCGG - Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989536739 5:42572865-42572887 GAGAGGTGGGGGTAGGAGGCAGG + Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
993608788 5:90029160-90029182 CAGAGGGAAGTGTGGGAGGTGGG + Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995803919 5:116029768-116029790 CAGAGGCAGATATAGGAGGTGGG + Intronic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
997836223 5:137195519-137195541 CAGAGGAAGATGTGGGAGCTGGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
999391869 5:151199178-151199200 CAGAGGAAGGGTTAGGACTCTGG - Intronic
1000277402 5:159750515-159750537 GAGAGGTAGGTCTGGGAGGCGGG - Intergenic
1000598868 5:163248297-163248319 CAGAAGAAGGTGGAAGAAGCTGG + Intergenic
1001209653 5:169798198-169798220 CCGAGGAAGTTGCAGGAGGAAGG - Intronic
1001254740 5:170175030-170175052 CAGAGGAAGGTGGTGCAGGAGGG + Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002039266 5:176500038-176500060 CAGGGGAAGGTTCAGGGGGCAGG - Exonic
1002584052 5:180230301-180230323 CAGAGGAAGGTTCAGGAGACAGG + Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003450207 6:6223780-6223802 CAAAGGGAGGGGTTGGAGGCTGG - Intronic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004207027 6:13600970-13600992 GAGAGGGAGATGTGGGAGGCAGG + Intronic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005450907 6:25971324-25971346 CAGAGTCATGTGTGGGAGGCAGG - Intronic
1005529535 6:26689168-26689190 TGGAGGAAGGTGAAGAAGGCTGG + Intergenic
1005541261 6:26812479-26812501 TGGAGGAAGGTGAAGAAGGCTGG - Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1006012891 6:31057125-31057147 CAGAGGAAGCTGTGAGAGACAGG + Intergenic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007778755 6:44238958-44238980 CAGTGGAAAGTGCAGGGGGCAGG - Intergenic
1007864710 6:44955721-44955743 CAGGGGAAAGGGTAGGAGGGGGG + Intronic
1007988965 6:46234998-46235020 CAGAGAAATGTGTTGGTGGCTGG + Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1009012067 6:57854547-57854569 TGGAGGAAGGTGAAGAAGGCTGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011325754 6:86148863-86148885 CAGAAGAAGATGTAAGTGGCTGG - Intergenic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1013290731 6:108717030-108717052 CAGAGGAAGGGGTAGCGGCCAGG + Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1015802953 6:137078925-137078947 CCGGGGAAAGTGTAGGAGGTGGG - Intergenic
1015872886 6:137794800-137794822 AGGAGGAAGGTGGGGGAGGCAGG + Intergenic
1016495048 6:144651962-144651984 CAGGGGAAAGTGTGGGAGGGGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017645261 6:156534144-156534166 GGGAGGTAGGTGGAGGAGGCTGG - Intergenic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019604104 7:1899892-1899914 CAGAGGAAGATGGAGGACGCGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1021024539 7:15648503-15648525 CAGAGGAAAGGATAGCAGGCCGG + Intronic
1024175075 7:46831269-46831291 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024323119 7:48089098-48089120 CAGAGGAAGGTGGGGGCGGGCGG + Intronic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1024932736 7:54680733-54680755 AAGAAGAAGGTGTGGGAGGTAGG - Intergenic
1028334029 7:89629083-89629105 TAGAGGAAGGTGCAGGTGGTGGG - Intergenic
1029110739 7:98211974-98211996 CAGAGGAAGATCTAGGGGTCAGG + Intronic
1029551475 7:101239191-101239213 CAGAGGAGGAGGTAGGAGGAAGG + Intergenic
1029639709 7:101813169-101813191 CAGAGCACGGTGTGAGAGGCAGG - Intergenic
1030107271 7:105997607-105997629 CAGAGGAAGGTGATGGCTGCAGG + Intronic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1030678152 7:112406303-112406325 CAGAGAAAGGTGTCGGGGGAAGG + Intergenic
1030682925 7:112451337-112451359 CAGGCGAAGGCGTCGGAGGCGGG + Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032154852 7:129459383-129459405 CAGAGGAAGGTCTAGGGTACTGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1033537338 7:142324033-142324055 CAGAGGAGGGTGTAGGGGCTGGG + Intergenic
1033961083 7:146913900-146913922 CAGGGGAAAGGGTAGGAGGGTGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034882879 7:154775924-154775946 CAGAGGGACGTAAAGGAGGCCGG - Intronic
1035603989 8:917015-917037 GAGAAGAAGGTGTGAGAGGCAGG + Intergenic
1036131905 8:6123282-6123304 CAGAAGAAGGTGGAAGAAGCAGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036523524 8:9514359-9514381 CAGAGGCAGGTAGAGAAGGCTGG + Intergenic
1036560049 8:9894098-9894120 CTGAGGTAGGAGTAGAAGGCTGG + Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037991348 8:23323408-23323430 AAGAGGACAGTGCAGGAGGCAGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038223460 8:25632545-25632567 CTGAGGAAGATGGAGAAGGCAGG + Intergenic
1039344991 8:36693626-36693648 GAGGGGGAGGTGTGGGAGGCAGG + Intergenic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039466153 8:37786800-37786822 CCGAGCAAGGTGGAGGAGCCGGG + Intronic
1039470027 8:37807710-37807732 CAGTGGCAGGTGTTGGAGACAGG + Intronic
1039476500 8:37841765-37841787 CAGAGTCAGGTGTGCGAGGCGGG + Exonic
1039486765 8:37916249-37916271 CAGAGGAAGGTATGGAAGGTGGG - Intergenic
1040571601 8:48616285-48616307 CAGGGGAAAGTGTGGGAGGTGGG + Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041573710 8:59368755-59368777 CAGTGGAAGGTGTACGAAACAGG - Intergenic
1041738218 8:61133285-61133307 CACAGGAGGGTAGAGGAGGCAGG + Intronic
1041869891 8:62620713-62620735 TAAAGAAAGTTGTAGGAGGCTGG - Intronic
1042542654 8:69922472-69922494 CTGAGGCTGGTGTGGGAGGCAGG - Intergenic
1043395002 8:79827494-79827516 CATAGGAAGATGTGGGAGGGCGG - Intergenic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045775475 8:105797569-105797591 GAGAAGAGGCTGTAGGAGGCAGG - Intronic
1045878418 8:107009989-107010011 CAGAGGAAAGGGTGGGAGGGGGG + Intergenic
1047347186 8:124039741-124039763 CAGAGGAGGGTGGATGTGGCTGG + Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047749423 8:127868646-127868668 CTGTGGGAGGTGTAGGAGGGTGG - Intergenic
1048181080 8:132194903-132194925 CAGTGGAGGATGTAGCAGGCTGG - Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048693386 8:136994105-136994127 CAAATGAGGTTGTAGGAGGCTGG + Intergenic
1048851594 8:138650528-138650550 AAGAGGCAGGTGGATGAGGCAGG - Intronic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1049277042 8:141725160-141725182 CACAGGAAGGGGTGGGTGGCGGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049371980 8:142272324-142272346 AAGAGGAAGGTGTAGACGGGCGG - Intronic
1049414001 8:142487229-142487251 CAGGCGAAGGGGTGGGAGGCTGG - Intronic
1049479934 8:142817803-142817825 CCGAGGCTGGTGTAGGAGGGAGG + Intergenic
1049620496 8:143596288-143596310 CAGAGGCAGGTCTAGGAGCCTGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1050135688 9:2461368-2461390 CAGTGGAAGGTGGTGGAGTCAGG + Intergenic
1050400851 9:5252619-5252641 GAGATGAAAGGGTAGGAGGCTGG - Intergenic
1050730539 9:8704238-8704260 CAGAGGATGGAGTGGGAGGGGGG - Intronic
1052081376 9:24210011-24210033 CAGGGGGAAGTGTGGGAGGCAGG + Intergenic
1053022753 9:34707313-34707335 GATAGGATGGTGTAGGAGGCAGG + Intergenic
1053110689 9:35457298-35457320 TAGAGGCAGATGTAGGCGGCAGG + Intergenic
1054991469 9:71331945-71331967 AAGAGAAAGGTGGAGGAGGGAGG + Intronic
1055796169 9:79977077-79977099 CAGGGGTAGGTGTAGGAGGGTGG - Intergenic
1056225731 9:84493379-84493401 CAGAGGAGGATGGAGCAGGCAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057287341 9:93768571-93768593 TAGAGAAAGGTGTAGCAGTCTGG - Intergenic
1057430363 9:94988382-94988404 CAGAGGAAGGCATATGAGGATGG + Intronic
1057547141 9:96027216-96027238 AAGAGGTGGGTGTTGGAGGCGGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057901457 9:98952039-98952061 CATAGGAAGTTCTATGAGGCAGG + Intronic
1057948781 9:99353135-99353157 CAGAGGCTGGTGGAAGAGGCTGG + Intergenic
1058720702 9:107760911-107760933 AGGATGAAGGGGTAGGAGGCTGG + Intergenic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1061048535 9:128180625-128180647 TAGAGGCAGGTGTGGGAGGCAGG - Intronic
1061087015 9:128405295-128405317 CAGAGGACTGTCTAGGAGGCAGG - Intergenic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062028119 9:134349888-134349910 GAGAGGAAGGTGTCACAGGCAGG - Intronic
1062276335 9:135733276-135733298 CAGGGGCAGGTGTGGGGGGCAGG - Intronic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1062460370 9:136660307-136660329 CAGAGGCAGGTACAGGAGGTGGG - Intronic
1185721343 X:2384308-2384330 AGCAGGGAGGTGTAGGAGGCAGG + Intronic
1185812736 X:3125696-3125718 CCGAGGAAGGAGTGGAAGGCTGG + Intergenic
1186137596 X:6535017-6535039 CAGAGGAATCTGTAGGAGAGAGG - Exonic
1186266790 X:7842341-7842363 CAGAGGAATTTGTAGGAGAGAGG + Intronic
1186298268 X:8171166-8171188 CAGAGGAATTTGTAGGAGAGAGG - Exonic
1186324529 X:8464909-8464931 CAGAGGAATTTGTAGGAGAGAGG + Exonic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1189007181 X:37008876-37008898 GAGAGGAAGCTGGAGGACGCAGG + Exonic
1189218696 X:39351097-39351119 CAAGGGAAAGTGTGGGAGGCGGG - Intergenic
1189340292 X:40199974-40199996 CGGAAGAAGGTGCAGGGGGCCGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191067236 X:56362554-56362576 CAGGGGAAAGTGTGGGAGGGTGG - Intergenic
1191254142 X:58272600-58272622 CAGGGGGAGGTTTAGGAGGCTGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191255784 X:58279016-58279038 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256396 X:58281419-58281441 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1194945219 X:100058748-100058770 CAAAGGAGGGTGGAGAAGGCTGG + Intergenic
1195537274 X:106023175-106023197 CCAAGGAAGGTAAAGGAGGCAGG - Intergenic
1195647535 X:107249627-107249649 CAGGTGCAGGTGTAAGAGGCTGG - Intergenic
1196362446 X:114879601-114879623 CAGGGGAAAGGATAGGAGGCGGG - Intronic
1196814291 X:119652840-119652862 GACAGTAAGGTATAGGAGGCAGG - Exonic
1196911445 X:120488321-120488343 GAAAGGAAGGGGTGGGAGGCAGG + Intergenic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1198216707 X:134562044-134562066 CAGGTGAAGATGTAGGAGGAGGG - Intergenic
1199023046 X:142904733-142904755 TAGGGGTAGGGGTAGGAGGCTGG + Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199861331 X:151802498-151802520 CAGAGGAAGGTGCTGGCTGCTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1201255822 Y:12107422-12107444 CACAGGATGGGATAGGAGGCTGG - Intergenic
1201438947 Y:13986966-13986988 CAGAGGAATTTGTAGGAGAGAGG - Intergenic
1201445626 Y:14055742-14055764 CAGAGGAATTTGTAGGAGAGAGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201672862 Y:16543828-16543850 CAGAGTGAGGGGTAGGAGGAAGG - Intergenic
1201902432 Y:19057336-19057358 CAGAACAAGGTGTGGGTGGCAGG + Intergenic