ID: 1118716652

View in Genome Browser
Species Human (GRCh38)
Location 14:68564644-68564666
Sequence TGGTGGTGGGGAGCCCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 443}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118716652_1118716670 26 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716670 14:68564693-68564715 AGAGGGCTGGCTTTCAGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 339
1118716652_1118716669 21 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716669 14:68564688-68564710 CCAGGAGAGGGCTGGCTTTCAGG 0: 1
1: 0
2: 6
3: 43
4: 410
1118716652_1118716660 3 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716660 14:68564670-68564692 GGGCACCTTCCCAAGAGCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 218
1118716652_1118716666 13 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716666 14:68564680-68564702 CCAAGAGCCCAGGAGAGGGCTGG 0: 1
1: 0
2: 4
3: 58
4: 552
1118716652_1118716662 8 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716662 14:68564675-68564697 CCTTCCCAAGAGCCCAGGAGAGG 0: 1
1: 1
2: 1
3: 26
4: 357
1118716652_1118716663 9 Left 1118716652 14:68564644-68564666 CCTCACAGGGCTCCCCACCACCA 0: 1
1: 0
2: 8
3: 48
4: 443
Right 1118716663 14:68564676-68564698 CTTCCCAAGAGCCCAGGAGAGGG 0: 1
1: 0
2: 1
3: 46
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118716652 Original CRISPR TGGTGGTGGGGAGCCCTGTG AGG (reversed) Intronic
900711815 1:4119265-4119287 TGGTGGTGGGGGGGCTTGTTAGG + Intergenic
901059552 1:6465770-6465792 TGGTGGAGGGGAAACTTGTGAGG - Intronic
901844734 1:11974745-11974767 TGGTGGTGGGGAGCCCCTCATGG - Exonic
902925591 1:19693875-19693897 GGCTGTTGGGGAGCCCTGGGTGG + Intronic
904486040 1:30825013-30825035 TGGGGGTGGGGGGCTTTGTGAGG - Intergenic
904567405 1:31435878-31435900 TGGTAGTGGGGAGCCATGGAGGG + Intergenic
904964361 1:34360343-34360365 TGGGGTTGGGGAGGCCTGTGAGG + Intergenic
905144851 1:35880195-35880217 TGGTAGTGTGGAGCCAGGTGTGG + Intronic
905944407 1:41889681-41889703 AGAGGGTAGGGAGCCCTGTGGGG + Intronic
906075716 1:43050514-43050536 TGCTCTTGGGGCGCCCTGTGAGG + Intergenic
906128349 1:43441390-43441412 TGGTGGTGGTGTGCCCTGGGAGG + Intronic
907770058 1:57452600-57452622 TGGTGGTGGGGGGCGCGGGGTGG + Intronic
910230625 1:84983145-84983167 TGCTGGTGTGGAGACCTGGGAGG - Intronic
911257853 1:95652513-95652535 TGGGGGCGGGGAGCCATGGGGGG + Intergenic
911440524 1:97920827-97920849 GGGTGGTGGGGAGTGCTCTGCGG - Intronic
912073727 1:105846336-105846358 TGGAGATGGGGAGACATGTGTGG + Intergenic
913093359 1:115494806-115494828 TGATGCTGGAGAGCCCTGGGGGG - Intergenic
914283068 1:146195031-146195053 TGGGGGGGGGTGGCCCTGTGAGG - Intronic
914694675 1:150066796-150066818 TGATAGAGGGGAGACCTGTGTGG + Intergenic
914746448 1:150504929-150504951 AGGTGGTGGTCATCCCTGTGGGG + Exonic
915087362 1:153397717-153397739 TGGTGGGGGTGGGCCCTGAGGGG - Intergenic
918044551 1:180933912-180933934 AGGTGATGTGGAACCCTGTGTGG + Intronic
918055929 1:181022400-181022422 TGGTGGTGGGGGGCCCTTTTTGG - Intronic
919820831 1:201470863-201470885 TGGTGGGGAGGAGCCATGGGAGG - Intergenic
920257306 1:204664348-204664370 TGCAGGTGGGGAGCACGGTGAGG - Intronic
920515181 1:206580011-206580033 TGGTGATGGGAAGCCCTGTCTGG - Intronic
920637024 1:207713735-207713757 GGGTCGTGGGGACCCCTGTTTGG - Intronic
921165223 1:212502219-212502241 TGGTGGTGGGGAGGCAGTTGGGG - Intergenic
922146848 1:222954943-222954965 TGGTGGTGGGGTGGGGTGTGGGG + Intronic
923548307 1:234940990-234941012 TGGTGGCAGGGAGGCCTGTTAGG - Intergenic
1063399762 10:5731719-5731741 TGGTGGTGGGTAGGCTTTTGAGG - Intronic
1064280039 10:13943231-13943253 TGCTGGTGGAGAGGCCTGAGGGG - Intronic
1065741626 10:28802316-28802338 TGGTGGGGGGCACCCCTGGGAGG - Intergenic
1065852860 10:29805303-29805325 TGGCCTTGGGCAGCCCTGTGGGG + Intergenic
1066384204 10:34928452-34928474 TGGTGGTGGGGTGCTCTCTGAGG - Intergenic
1067064286 10:43095026-43095048 TGGGGGTGGGGAGAGCTCTGTGG + Intronic
1069793791 10:71039892-71039914 TGGTGGTGGGGAGGGTTTTGGGG + Intergenic
1070867915 10:79719235-79719257 TGGAGGTGGGGCGCACTGGGAGG - Intergenic
1071517773 10:86310417-86310439 TGGTGGTCCCCAGCCCTGTGTGG + Intronic
1071522822 10:86341507-86341529 CCGTGGCCGGGAGCCCTGTGGGG - Intronic
1071592749 10:86891162-86891184 TGGTGGTGGTGGGCTCTGCGTGG + Intronic
1071634827 10:87241436-87241458 TGGAGGTGGGGCGCACTGGGAGG - Intergenic
1073180889 10:101582570-101582592 TGGGGGTGGGGAGCTTTGGGAGG - Intronic
1073324597 10:102634947-102634969 AGGTGGTGGGGAGGCCGGGGTGG + Intergenic
1073349115 10:102806806-102806828 TGGTGGAGGGCAGCTTTGTGAGG + Intronic
1074437539 10:113446717-113446739 TGGTTTTGGGGAGCTGTGTGTGG + Intergenic
1075261182 10:120964992-120965014 TGGTGGTGGCCTGCTCTGTGAGG - Intergenic
1075558431 10:123449800-123449822 TGGTGATGTGGGGCCCTGAGGGG + Intergenic
1075911655 10:126130422-126130444 TGGTGATGAGGAACGCTGTGTGG - Intronic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076246215 10:128949610-128949632 AGTTGGAGGGAAGCCCTGTGAGG + Intergenic
1076340409 10:129741518-129741540 TGGAGGTGGTGAGTGCTGTGTGG + Intronic
1076487704 10:130835361-130835383 TGCTGGTGGGGTGCTCTCTGCGG - Intergenic
1076487789 10:130835630-130835652 TGCTGGTGGGGTGCTCTCTGCGG - Intergenic
1076700068 10:132266919-132266941 TGGGGGTGGGGAGGGCTGCGCGG + Intronic
1076741200 10:132486592-132486614 TGGTGCGGGAGAGCTCTGTGTGG - Intergenic
1076821773 10:132943230-132943252 GGGAGGTGGGGAGCCCCGGGGGG - Intergenic
1077108935 11:853648-853670 TGGTGGTGGGGGACCCGGTGGGG + Intronic
1077188206 11:1244854-1244876 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077189161 11:1248625-1248647 TGGTGGTGGTCAGCACTGTGGGG - Exonic
1077328513 11:1973877-1973899 TGGTGGGGGGCAGCCCGGGGGGG + Intronic
1077351169 11:2093818-2093840 AGGTGCTGGGGAACCCTGGGGGG + Intergenic
1077560360 11:3256649-3256671 CGGTGGTGGGGGGCACAGTGCGG + Intergenic
1077566257 11:3302466-3302488 CGGTGGTGGGGGGCACAGTGCGG + Intergenic
1078413455 11:11146769-11146791 GGGAGGTGGTGAGCCCAGTGGGG + Intergenic
1078669728 11:13354191-13354213 TGGTGGTGGGGGGCCGGGGGGGG - Intronic
1081575916 11:44318411-44318433 TGATAGTGGGGAGGCCTGTGGGG + Intergenic
1081813517 11:45926370-45926392 TGGTGGTGGGGGGCCATGGATGG + Intronic
1083256101 11:61496348-61496370 GGGTGGTGGGAGGCCCTGCGTGG + Intergenic
1084072034 11:66743119-66743141 TGGGGATGGGGAGCTCTGCGGGG + Intergenic
1084208741 11:67611230-67611252 TGGTGGGGGGGTGCGCAGTGGGG + Intronic
1084274581 11:68044858-68044880 TGGAGATGTAGAGCCCTGTGGGG - Intronic
1084302767 11:68262112-68262134 TGGTGGTGGTCACCACTGTGGGG + Exonic
1084611679 11:70207044-70207066 TGGGGGTGGGGAGACCTGGTTGG + Exonic
1085313677 11:75530871-75530893 GGGTGGAGGGGAGCCATGGGAGG + Intergenic
1085385306 11:76154348-76154370 AGGAGGTGGGAAGCCCTGGGAGG + Intergenic
1086385448 11:86302462-86302484 TGGTGGCGGGGAGGCTGGTGAGG + Exonic
1088026949 11:105197054-105197076 TGGGGCTGGGGAGCACTGAGCGG + Intergenic
1088506849 11:110535398-110535420 TGGTGGTGGGGAGGCGGGGGTGG + Intergenic
1089083959 11:115801020-115801042 TGGTGGTGGGGAGCAGAGAGAGG + Intergenic
1089261372 11:117226080-117226102 GGGAGGTGGGGAGCCATATGTGG + Intronic
1090658337 11:128862398-128862420 TGGTCCTGGGGAGCGCTCTGGGG + Intronic
1091311841 11:134580455-134580477 TGTGGGTGGGGAGCTCTGAGGGG + Intergenic
1202811491 11_KI270721v1_random:29056-29078 TGGTGGGGGGCAGCCCGGGGGGG + Intergenic
1091665871 12:2418232-2418254 GGGAGGTGGGGAGCACTGTGGGG - Intronic
1092103968 12:5907863-5907885 TGCTCCTGGGGAGCCCAGTGGGG + Intronic
1096216687 12:49801655-49801677 CGCTGGTGGGGAGCACTGGGAGG + Intronic
1096465460 12:51845997-51846019 GGGTGGTGGAGACCCCTGGGTGG - Intergenic
1096496879 12:52043794-52043816 TGGTCTCAGGGAGCCCTGTGGGG - Intronic
1096626470 12:52898969-52898991 TGGTGGTGGGGAGGACCCTGAGG - Intronic
1096657792 12:53102492-53102514 TCCTGGTGGGCAGCTCTGTGAGG - Intergenic
1096898477 12:54849904-54849926 GGGTGTAGGGGAGCCCCGTGGGG - Intronic
1097703208 12:62841139-62841161 TGGTGGTGGGGAGTTCTGAGGGG + Intronic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1102961839 12:117098547-117098569 CGGAGGCGGGGAGCCCTGGGAGG - Intronic
1103899867 12:124297839-124297861 GGGAGGTGGGGCGCCCTGTGGGG - Intronic
1103913847 12:124365951-124365973 TGGTGGTAGGTAAACCTGTGGGG - Intronic
1104521723 12:129481858-129481880 TGGTGGTGGGGGTGCCTGGGAGG - Intronic
1104730212 12:131101216-131101238 TTGTGGGGTGGAGACCTGTGTGG + Intronic
1104731270 12:131106761-131106783 CTGAGGTGGGGTGCCCTGTGAGG - Intronic
1104799921 12:131547518-131547540 CCGAGGTGGGGTGCCCTGTGAGG + Intergenic
1104848203 12:131857754-131857776 TGGTGGTGGTGGGTGCTGTGAGG + Intergenic
1104954385 12:132457310-132457332 TGGAGGTTGGAAGCCCAGTGTGG - Intergenic
1105343353 13:19549076-19549098 TTGTGGAGGGGAGCACAGTGGGG - Intergenic
1106488454 13:30193570-30193592 TGTTGATGGAGAGCTCTGTGAGG - Intergenic
1107004951 13:35599163-35599185 GGGTGGTGAGGAGCCTGGTGGGG - Intronic
1107840557 13:44452513-44452535 TGGTGGCATGGGGCCCTGTGAGG - Intronic
1108534038 13:51354857-51354879 AGGTGGGGAAGAGCCCTGTGTGG + Intronic
1108626172 13:52230752-52230774 TGGGGATGGGGAGACGTGTGGGG + Intergenic
1108659894 13:52575730-52575752 TGGGGATGGGGAGACGTGTGGGG - Intergenic
1112324481 13:98434246-98434268 GGGTAGTGGGGAGCTCTGAGAGG - Intronic
1112569804 13:100583683-100583705 TAGTGGTGGGGAGCCAGGTACGG - Intronic
1113853297 13:113430140-113430162 TGGTGGATGGGAGCCTAGTGGGG - Intronic
1113961881 13:114130805-114130827 TGGAGGTGGGTGCCCCTGTGGGG - Intronic
1115459890 14:33648876-33648898 TGGTGCTGAGGAGCACAGTGTGG + Intronic
1117341386 14:54795202-54795224 TGGTGCTGGGGTGCACTATGGGG - Intergenic
1118347099 14:64948343-64948365 TGCTGGTGCTGAGTCCTGTGTGG - Exonic
1118614957 14:67569029-67569051 TGGGGGTGGGCAGACCTGTGGGG - Intronic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1118756664 14:68849751-68849773 GGGTGGTGGGGAACACTGTGGGG + Intergenic
1118840514 14:69506646-69506668 TGACAGTGGGGAACCCTGTGGGG - Intronic
1119249090 14:73136718-73136740 TGGGGCTGGGGAACCCCGTGTGG + Intronic
1120756043 14:88245454-88245476 ACGTGGTGGGGGGTCCTGTGAGG - Intronic
1121053790 14:90836822-90836844 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121053806 14:90836867-90836889 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121414561 14:93770209-93770231 TGGAGGCTGGGAGCCCAGTGAGG - Intronic
1122162417 14:99793745-99793767 TGGCGGCGGGGAGCCCGGGGCGG - Intronic
1122414440 14:101542121-101542143 GGGTGATGGGGAGCCATGGGAGG - Intergenic
1123107039 14:105846491-105846513 TGGTGGTGGGCAGACATGGGTGG - Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1124800301 15:32826229-32826251 GGGTGGTGGGGAGACACGTGAGG + Intronic
1125744710 15:41990421-41990443 TGGTGGTGGGCAGCCCGAGGGGG - Intronic
1126143582 15:45456488-45456510 TGAAGGTGTGAAGCCCTGTGAGG + Intergenic
1126414776 15:48406306-48406328 TGGTAGGGGTGAGGCCTGTGGGG + Intergenic
1126506164 15:49406636-49406658 TAGTGGTGGGGAGTGCCGTGGGG + Intronic
1127674241 15:61225663-61225685 TGGTGGTACACAGCCCTGTGTGG + Intronic
1128232891 15:66047898-66047920 GGGTGGAGGGGAGGCCTGAGGGG + Intronic
1128528883 15:68431127-68431149 TGGAGCCGGGGAGCCCGGTGTGG + Intronic
1128698990 15:69790171-69790193 TGGTGGTGGTGAGAGCTCTGAGG - Intergenic
1128719096 15:69932918-69932940 TAGTGCTAGGGAGCCCTGGGTGG - Intergenic
1129028896 15:72604640-72604662 AGGTTGTGGGGAGCACTGTATGG + Intergenic
1129110554 15:73334661-73334683 TGGTGGTGGGGAGGCAGGTGTGG - Intronic
1129503516 15:76061456-76061478 TGGAGGTGGGGAGCCCTGAGGGG + Intronic
1129929626 15:79399555-79399577 TGGTGGTCAGGAGCCATGTGTGG + Intronic
1130357152 15:83144073-83144095 TAGTGGTGGGCAGCCTTGTCTGG - Intronic
1130608239 15:85336972-85336994 TGGGGGCAGGGAGCCCTGAGCGG - Intergenic
1131408350 15:92184976-92184998 TGGTGGTGGTGAGAGCAGTGTGG + Intergenic
1132575008 16:660213-660235 AGGTGCTGGGGAGCCCTGCGGGG - Intronic
1132590356 16:723820-723842 GGGTGTGGGGGAGGCCTGTGGGG - Intronic
1132656886 16:1045146-1045168 AGGTGGTGAGGAGCCTTGGGAGG - Intergenic
1132668107 16:1091041-1091063 TACTGGTGGGGGCCCCTGTGGGG + Intronic
1132929336 16:2450992-2451014 AGGTGGAGGGAAGCCCAGTGGGG - Intronic
1133240672 16:4412464-4412486 AGGAGGTGGGTGGCCCTGTGGGG - Intronic
1133769045 16:8857070-8857092 TGAGGCTGGGGAGCCCTGTTTGG - Intronic
1133998726 16:10766447-10766469 GGGGGCTGGGGAGCCCTCTGGGG + Intronic
1134648366 16:15888823-15888845 AGGCAGTGGAGAGCCCTGTGGGG + Intergenic
1135417888 16:22282878-22282900 TGTGGATGGGGAGCCCAGTGGGG + Intronic
1137365510 16:47856095-47856117 TGGTAGAGTGGAGCACTGTGGGG - Intergenic
1138280801 16:55771067-55771089 TGCTGCTGGGAAGTCCTGTGAGG - Intergenic
1138349162 16:56337357-56337379 GGGTGCTGGGGAGCAGTGTGTGG + Intronic
1138416271 16:56873122-56873144 AGGCAGTGGGGAGCCCTGGGAGG - Intronic
1138455021 16:57116146-57116168 AGGCAGTGGGGAGCCATGTGAGG - Intronic
1138473454 16:57256818-57256840 TGAAGCTGGGGAGCCCTGCGTGG - Exonic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1139946775 16:70647276-70647298 GGGTGTTGGGGAGCCCCGGGCGG + Intronic
1140436509 16:74951286-74951308 TGGTGGTGAAGAGCACAGTGAGG - Intronic
1141815404 16:86406035-86406057 TGGTGCTGGGGGGCATTGTGTGG + Intergenic
1141856507 16:86684856-86684878 TTGTGGTGAGGAGGCCTCTGAGG - Intergenic
1141886036 16:86893019-86893041 TGGTGGGAGGGAGCCCTGGAGGG - Intergenic
1142107039 16:88309736-88309758 TGGCGGGGGGGTGCCCTCTGAGG + Intergenic
1142148582 16:88502921-88502943 TGGGGGTGGCGAGCGCTCTGAGG - Intronic
1142372778 16:89692178-89692200 TGGGAGCGGGGAGCCCTGGGCGG + Intronic
1142502437 17:340444-340466 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502450 17:340480-340502 TGGACGTGGGGAGGCCTGGGTGG - Intronic
1142502463 17:340516-340538 TGGACGTGGGGAGGCCTGGGTGG - Intronic
1142502476 17:340552-340574 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502489 17:340588-340610 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502502 17:340624-340646 TGGATGTGGGGAGGCCTGGGAGG - Intronic
1142502515 17:340660-340682 TGGACGTGGGGAGGCCTGGGTGG - Intronic
1142502540 17:340732-340754 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502551 17:340768-340790 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502564 17:340804-340826 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502577 17:340840-340862 TGGATGTGGGGAGGCCTGGGAGG - Intronic
1142502590 17:340876-340898 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502603 17:340912-340934 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502615 17:340947-340969 TGGATGTGGGGAGGCCTGGGAGG - Intronic
1142502628 17:340983-341005 TGGATGTGGGGAGGCCTGGGTGG - Intronic
1142502640 17:341018-341040 TGGATGTGGGGAGGCCTGGGAGG - Intronic
1142502662 17:341088-341110 TGGATGTGGGGAGGCCTGGGAGG - Intronic
1142780768 17:2179490-2179512 GGGTCGTAGGGAGCCCTCTGAGG - Intronic
1143021909 17:3921368-3921390 TGGTGGGAGGGACCCCGGTGGGG - Intergenic
1143189594 17:5031856-5031878 AGGTGGGCGGGAGCCCTGCGGGG + Intergenic
1143270576 17:5672052-5672074 TCATGGTGGGGGGGCCTGTGGGG + Intergenic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1144053758 17:11520237-11520259 TGGTGGTGGTGAGACAGGTGGGG - Intronic
1144373749 17:14618662-14618684 TGGGTGTGGGGAGGGCTGTGTGG + Intergenic
1144959047 17:19034552-19034574 TGGTGGCAGGGAGGCCCGTGGGG - Intronic
1144976112 17:19139972-19139994 TGGTGGCAGGGAGGCCCGTGGGG + Intronic
1146594353 17:34156344-34156366 TGCTGGTGGAGAGCTCTGAGAGG - Intronic
1146681758 17:34813428-34813450 TGGCGATGGGGAGGCCTGCGTGG - Intergenic
1146793282 17:35764859-35764881 TGGGGGCGGGGAGCCCTCGGTGG - Exonic
1146911237 17:36649754-36649776 AGGTGGTGGGGGGCACTGAGGGG + Intergenic
1147017885 17:37506963-37506985 TGGTGGTGTGGAGCGCCGCGAGG + Intronic
1147503863 17:40994043-40994065 TGGTGGTGGCAGGCCCGGTGGGG + Exonic
1147504297 17:40999799-40999821 TGGTGGTGGCAGGCCCAGTGGGG + Exonic
1147603087 17:41757850-41757872 TGGAGGTGGGCAGTGCTGTGGGG - Intronic
1147669693 17:42169856-42169878 TAATGGTGGGGAGGCCTGAGAGG - Intronic
1147893450 17:43733886-43733908 TGGTGGTGGGGAGCCATAGAAGG + Intergenic
1147968190 17:44205541-44205563 TGGGGGTGGGGAGGCCTGGGGGG - Exonic
1148106503 17:45121509-45121531 GGGAGGAGGGGAGTCCTGTGAGG - Intronic
1148183208 17:45620984-45621006 TGGAGTTGGGGGCCCCTGTGGGG + Intergenic
1148205327 17:45776108-45776130 TGGTGAAGGGGAGCCCAGGGAGG - Intergenic
1148265642 17:46224707-46224729 TGGAGTTGGGGGCCCCTGTGGGG - Intronic
1148894471 17:50831804-50831826 TGCTGGTGGGGAGTCCTCTCAGG - Intergenic
1149994028 17:61397470-61397492 TGGCGCTGGGGAGGCCTGGGAGG - Intergenic
1150008314 17:61483254-61483276 TGGTGGCTGGGAGCTCTGAGCGG - Exonic
1150269580 17:63854939-63854961 AGGGGGTGGGGAGTCCTGAGTGG + Intergenic
1151209540 17:72534040-72534062 TGTAGCTGGGGAGCCCTGTGTGG - Intergenic
1151706771 17:75773402-75773424 TGGGGAGGGAGAGCCCTGTGAGG + Intergenic
1152091935 17:78252000-78252022 GGTTGGTGGGGAGCCCTGGAAGG - Intergenic
1152526187 17:80889508-80889530 TGCTGCTGGGGAGCCCTCAGGGG + Intronic
1152811162 17:82383411-82383433 CGGGGGTGGGGGGCCTTGTGGGG - Intergenic
1152931843 17:83113961-83113983 TGGTGGTGGGGGGCACAGAGGGG + Intergenic
1152932736 17:83118474-83118496 TGGATGTGGGGAGGCCTGGGAGG + Intergenic
1153752610 18:8248698-8248720 GGGGGGTGGGGTGCCCTGAGTGG - Intronic
1154223785 18:12481709-12481731 TGGTGGTGGGGAGCACTGAAAGG + Intronic
1154234852 18:12595147-12595169 TGGTGGTGGGGACCACTATAGGG + Intronic
1155249636 18:23942354-23942376 TGGTGCAGGGGTGCCCTGAGAGG - Intronic
1157580918 18:48773718-48773740 CGGGGGTGGGGCACCCTGTGCGG - Intronic
1160194704 18:76742945-76742967 TGGTGGTGGACATCACTGTGAGG + Intergenic
1160219947 18:76967715-76967737 AGGTGGTGGTGTGCTCTGTGAGG + Intronic
1160489449 18:79324988-79325010 TGGGGCTGGAGAGCCATGTGGGG + Intronic
1160562961 18:79771018-79771040 GTGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160562973 18:79771052-79771074 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160563137 18:79771511-79771533 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160797875 19:954114-954136 GGGTGCTGGGGGGCCCTGGGAGG + Intronic
1161396345 19:4046930-4046952 GGGTGGGGGGGCGCCCTGAGGGG + Exonic
1161576700 19:5058414-5058436 GGGAGGAGGGGAGCCCGGTGAGG + Intronic
1161627083 19:5333544-5333566 TTGGGGTGGGGGGTCCTGTGTGG + Intronic
1162013323 19:7830699-7830721 GGGGGATGGGGAGCCCTGAGGGG - Intronic
1162020566 19:7866579-7866601 TGGGGGTAGGGAGCACTTTGTGG - Intergenic
1162735822 19:12746468-12746490 TGGTGGTGTGCAGCACTGTGGGG - Intronic
1162793401 19:13074467-13074489 GGGTAGTGGGGACCCCTGAGGGG + Intronic
1162948887 19:14058990-14059012 TTGGTGTGGGGAGCCCTGGGCGG + Intronic
1162969212 19:14170024-14170046 TGGTAATGGGGAGACCAGTGAGG + Intronic
1163803341 19:19381283-19381305 GGTTGGCAGGGAGCCCTGTGGGG - Intergenic
1163847854 19:19647331-19647353 GGGTGGTGGGGAGGCAGGTGTGG + Intronic
1164462372 19:28459976-28459998 TGGTGGCTGGGAGCCCAGTGAGG + Intergenic
1164523336 19:28995492-28995514 TGGTGGAGGGCAGCCCTCAGGGG + Intergenic
1164574473 19:29397696-29397718 AGGTCGTGGGTAGCCCTGTGAGG + Intergenic
1164912876 19:32026687-32026709 TGGTGGTGGGGAGAACAGAGTGG - Intergenic
1166042564 19:40212739-40212761 TGGAGGCTGGGAGCCCAGTGGGG + Intronic
1166048953 19:40246854-40246876 TGGTGGAGGGGAGAGCTGGGAGG - Intronic
1166744014 19:45131339-45131361 AGGGTGTGGGGAGCCCTGGGTGG - Intronic
1167080757 19:47274866-47274888 TGGTGGGGGCGGGGCCTGTGCGG + Exonic
1167236999 19:48321316-48321338 CGGTGCTGCGGAGCCCTGAGAGG + Intronic
1167281059 19:48568825-48568847 TGGAGCTGGGGGGCCCTGAGCGG - Intronic
1167455498 19:49595337-49595359 GGGTGGTGGGGAGCCCTCCCCGG + Exonic
1167459458 19:49616644-49616666 TGATGGTGGGGTTTCCTGTGAGG + Intronic
1167659287 19:50786399-50786421 GGGTGCTGGGGAGCCATGAGAGG + Intergenic
1168307008 19:55441267-55441289 TGGGAGTGGGGAGACCCGTGAGG - Intronic
1168519539 19:57037484-57037506 TGGAGGTGGGGAGCCCCATGAGG - Intergenic
925142413 2:1559254-1559276 TGCTGGTGAGGGGCCCTGTGTGG - Intergenic
925152616 2:1625541-1625563 GGGTGCTGGGGAGGGCTGTGCGG + Intergenic
925160240 2:1678308-1678330 TGGTGATGGGGAGCCATGGGAGG - Intronic
925365985 2:3312519-3312541 TGGTGGGAGGGAGCCTTGGGAGG - Intronic
925388953 2:3482686-3482708 TGCTGGTCGGGGGCACTGTGTGG + Intronic
925911766 2:8578413-8578435 TGGGTTTGGGGACCCCTGTGGGG - Intergenic
927210223 2:20634585-20634607 CCGTGGAGGGGAGCTCTGTGGGG - Intronic
927807264 2:26159085-26159107 TGTTGGTGGGGAGCACTCTCCGG + Intergenic
930211799 2:48646911-48646933 TGCTGGTGGAGAGCCCCATGAGG - Exonic
932366425 2:71156267-71156289 TGGGGGTGGGGATCCTGGTGAGG + Intergenic
933148860 2:78890305-78890327 TGGTGGTGGGGGGTGATGTGGGG + Intergenic
934028065 2:88017287-88017309 CGGAGGTGGGGGACCCTGTGTGG + Intergenic
935356770 2:102208629-102208651 GGGTGGTGTGGATCCCTATGGGG + Intronic
935379612 2:102438363-102438385 TGGTCTTGGGGTGCTCTGTGTGG - Intronic
936045986 2:109188352-109188374 TGGAGGTGGTGATCACTGTGAGG - Intronic
937247970 2:120505759-120505781 TAGTGATGGGGAGCCATGAGGGG + Intergenic
937939927 2:127277221-127277243 TGCTGGTGGGGATCCCACTGGGG + Intronic
938279972 2:130056928-130056950 GGGTGGTTGGGAGCATTGTGGGG - Intergenic
938402565 2:131005370-131005392 TGCTGGAGGGCAGCCCTGTGTGG - Intronic
938809638 2:134841285-134841307 TGGTGGTGGGGAGGCTCTTGAGG - Intronic
941756926 2:169196721-169196743 TGTTAGTGGAGAGCACTGTGTGG - Intronic
942160990 2:173187015-173187037 TAGTGGTGGGGAGAACTGGGAGG - Intronic
942455675 2:176136752-176136774 AGCTGGTGGGGAGCCCGGCGAGG + Intergenic
944811222 2:203328743-203328765 TGGGGGTGGGGAGCTGGGTGAGG + Intronic
944939992 2:204613975-204613997 TGGTGGTGGTTTTCCCTGTGAGG + Intronic
945224671 2:207521362-207521384 TGGTGTTGGGGAGTTATGTGTGG + Intergenic
946403148 2:219479316-219479338 TGGAGGTGGAGAGCACTGTTAGG + Intronic
947218196 2:227768200-227768222 TGGGGGAGGGGAACCCTGGGAGG - Intergenic
947592775 2:231395052-231395074 TGGTGGTGGGGAGCCCTCAGAGG + Intergenic
947866730 2:233402998-233403020 TGGTGGTGGTTAGCCTTGGGAGG + Intronic
948221338 2:236272109-236272131 TGGTGGCAGTGAGCACTGTGAGG + Intergenic
948436980 2:237960565-237960587 AGGTGGTGTGGAGTGCTGTGAGG - Intergenic
948610505 2:239163521-239163543 TGGAGGTGGGTCCCCCTGTGAGG + Intronic
948866665 2:240778616-240778638 AGGGGGTGGGGAGCTGTGTGGGG - Intronic
948873765 2:240816990-240817012 TGAGGGTGGGGATCCCAGTGGGG + Intronic
1168793812 20:597802-597824 TGGTGGTTGAGAGCCCAGTGGGG + Intergenic
1170112641 20:12822321-12822343 TGGTGGGGGGGATACATGTGCGG + Intergenic
1171323057 20:24263877-24263899 TGGTGGATTGGAACCCTGTGAGG + Intergenic
1172699760 20:36845835-36845857 TGGGGGTGGGGGGCCCTGGGAGG + Intronic
1174298733 20:49567689-49567711 TGTGGGTGGGGAGCCGTGCGGGG - Intronic
1174398150 20:50260696-50260718 ATGGGGTGGGGAGCCCTGTGGGG - Intergenic
1175566605 20:59984880-59984902 TTGTAGTGGGGAACCCTCTGTGG + Intronic
1175857213 20:62128223-62128245 TGGTGGTGGCGGCACCTGTGGGG + Intronic
1175859566 20:62143141-62143163 TGGGGCTGGGGAGCCCAGAGAGG - Intronic
1176030453 20:63008846-63008868 CGCTGGTGGGGAGGCCTCTGAGG + Intergenic
1176100429 20:63361982-63362004 TGGAGGAGGGGCGCCTTGTGCGG + Intronic
1176167424 20:63681415-63681437 TGGCTGTGTGGAGCCCTGTGAGG + Intronic
1176195650 20:63835471-63835493 TGGTCCTGGGGAGGCCTGGGTGG - Intergenic
1177505152 21:22010676-22010698 TGGTGGCTGGGTGGCCTGTGGGG - Intergenic
1178495275 21:33080902-33080924 TGTTACTGGGGAGACCTGTGGGG + Intergenic
1180032998 21:45224707-45224729 TGGTTTCGGGGAGCCCTGGGCGG + Exonic
1180824807 22:18854953-18854975 TGCTGGTGGGGAGGTCTTTGGGG + Intronic
1181125227 22:20698104-20698126 TGCTGGTGGGGAGGTCTTTGGGG + Intergenic
1181397755 22:22633835-22633857 TAGGGATGGGGAGCCCTCTGGGG - Intergenic
1181398229 22:22635989-22636011 TGCTGGTGGGGAGGTCTTTGGGG - Intergenic
1181651183 22:24260071-24260093 TGCTGGTGGGGAGGTCTTTGGGG + Intergenic
1181651656 22:24262223-24262245 TAGGGATGGGGAGCCCTCTGGGG + Intergenic
1181705723 22:24648516-24648538 TAGGGATGGGGAGCCCTCTGGGG - Intergenic
1181706196 22:24650668-24650690 TGCTGGTGGGGAGGTCTTTGGGG - Intergenic
1181999554 22:26909122-26909144 GGGTGCTGGGGAGCCCCATGCGG + Intergenic
1182069464 22:27453354-27453376 TGGGGTTGGGGAGCCCTCTTTGG + Intergenic
1182347599 22:29677577-29677599 GGCCGGTGGGGAGCCCTTTGTGG + Intronic
1182355256 22:29719933-29719955 TGGGGGTGGGGAGCGCGGAGGGG + Intergenic
1182923047 22:34097711-34097733 TGGAGGTGGGGAGGGATGTGGGG + Intergenic
1183057272 22:35314652-35314674 TGATGGTGGGGACCACTGAGAGG + Intronic
1183726650 22:39593639-39593661 GGGTGATGGGGAGCCATGGGAGG + Intronic
1183866828 22:40710829-40710851 TGGCCGTGGGGAGCCAAGTGTGG - Intergenic
1184924076 22:47625236-47625258 CGGTGGTGGGAAGGGCTGTGAGG + Intergenic
1185234620 22:49704824-49704846 CTGGGGTGGGGAGCCCTGAGTGG - Intergenic
1185281526 22:49971941-49971963 TGGCTGTGGGGCGCCCAGTGGGG + Intergenic
949874802 3:8619197-8619219 TGGTGGTTGGGACCCCTTTAGGG - Intergenic
950688240 3:14634443-14634465 AGGTGCTGGGAAGCCCTGTCTGG - Intergenic
951113063 3:18828515-18828537 TGCTGGTGGGATGCCCTTTGAGG - Intergenic
951810199 3:26690000-26690022 AGGTGGTGGGGAACCAGGTGGGG - Intronic
953411492 3:42692861-42692883 TGGTCTGGGGGAACCCTGTGTGG + Exonic
953414865 3:42709784-42709806 TAGAGGTGGGCAGACCTGTGGGG + Exonic
953464208 3:43105421-43105443 GGGTGGTGGGGAGCCACGCGAGG - Intronic
953493602 3:43368982-43369004 TGGTGGCTGGAAGCCCCGTGAGG + Intronic
954121993 3:48504842-48504864 TGAGGGGGCGGAGCCCTGTGTGG - Intergenic
954321143 3:49832786-49832808 AGGAGGTGGGGAGCCCTGCCAGG - Intronic
954432837 3:50480468-50480490 GGGGGGTGGGGAGGCTTGTGGGG + Intronic
954808539 3:53234092-53234114 TGGCCTTGGGGAGGCCTGTGGGG + Intronic
954864799 3:53719073-53719095 TGCCGTGGGGGAGCCCTGTGCGG + Intronic
955071445 3:55575637-55575659 GGCTGGTGGGGAGCCCTCTGGGG - Intronic
955484869 3:59425280-59425302 TGGTGGTAAGGAGCTCTGGGAGG - Intergenic
956485214 3:69715573-69715595 TGGTCATGGGGAGCTCTTTGAGG + Intergenic
959229401 3:103629397-103629419 TTGTGCTCAGGAGCCCTGTGTGG + Intergenic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
961811363 3:129523622-129523644 TGGTGGGGCTGAGCCATGTGGGG + Intergenic
962345038 3:134612439-134612461 AGGTGGTGGGGAGTGCTGAGGGG + Intronic
962420375 3:135223299-135223321 TGGTGGTCTGGAGCCCTGCAAGG - Intronic
962642998 3:137407769-137407791 TGGTGGGCAGGAGCCCTGTCTGG - Intergenic
963055087 3:141179670-141179692 TGGTGGAGGTGAGCCTGGTGTGG - Intergenic
963259197 3:143176422-143176444 TGGTGGCGGAGACCCCGGTGGGG + Intergenic
963918382 3:150882046-150882068 AGGTGGTTGGGAGGCTTGTGGGG + Intronic
967892775 3:194374972-194374994 GGGTGGAGGAGAGCCCAGTGTGG - Intergenic
968231844 3:197009038-197009060 GGGGGGTGGGCAGACCTGTGGGG - Intronic
968430639 4:556359-556381 TGGAGGTGGGGAGGGCTCTGGGG - Intergenic
968881174 4:3300963-3300985 GGGTGGTGAGGAGCCACGTGAGG + Intronic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
969522059 4:7684105-7684127 TGGTGGTGGTGAGCTCCCTGCGG - Intronic
971451506 4:26805628-26805650 TGGAGGTGGGGAGCCCAGATGGG - Intergenic
973122460 4:46539201-46539223 TGGTGGTGGGGAGGGTGGTGAGG + Intergenic
973908085 4:55550712-55550734 TGGTGGTGGGGGGGCAGGTGGGG - Intergenic
974119242 4:57618952-57618974 CGGTGGAGGTGAGGCCTGTGAGG + Intergenic
976903027 4:90203339-90203361 TGGTGGTGGGGAGCTAGGAGAGG - Intronic
978291649 4:107149068-107149090 TGGTGGTGTTGATCCCTGTATGG - Intronic
978563964 4:110062418-110062440 TACTGCTGGGGAGCACTGTGGGG + Intronic
980104493 4:128574869-128574891 TGGTGGTGGGGAGCCAGGCATGG - Intergenic
982116453 4:152102539-152102561 TAGTGGCTGGGAGCTCTGTGAGG - Intergenic
982686753 4:158499694-158499716 GGGCGGTGGGGAACACTGTGAGG - Intronic
982994097 4:162318151-162318173 TGTTGGTCTGGAGACCTGTGAGG + Intergenic
985496317 5:208576-208598 GGGTCGGGGGGAGCCATGTGGGG + Intronic
985727763 5:1524715-1524737 TGGTGCTCAGGAGCCGTGTGAGG + Intergenic
986856474 5:11874537-11874559 TGGTGATGGGGTCCCCTGTTGGG - Intronic
987181406 5:15372352-15372374 TGGTGGTGGCGACCCGTCTGAGG + Intergenic
991510013 5:67365833-67365855 TGGTGGAGGGGACCCCACTGGGG - Intergenic
993903358 5:93598709-93598731 GGGTGGTGGGGAGGCCCGGGAGG + Intergenic
995285384 5:110383054-110383076 TGTTGGTGGGGAGACCTGGTGGG + Intronic
997331658 5:133067726-133067748 TGTTGGTTGGGAGCCATGAGTGG + Intronic
997587794 5:135054000-135054022 CTGTGGTGGTGACCCCTGTGAGG + Intronic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
999177387 5:149640873-149640895 TGGTTTTAGGGAGCCATGTGGGG + Intergenic
999249382 5:150173060-150173082 TGATGGGGGGGATCCATGTGGGG - Intronic
1000889035 5:166782360-166782382 TGGTGGGGGGGAGTCCTGGGGGG - Intergenic
1001580023 5:172791918-172791940 TCCTGGTGGGCAGCCCCGTGAGG - Intergenic
1002170808 5:177373132-177373154 TGGGGGTGAAGAACCCTGTGGGG + Intergenic
1002182610 5:177438727-177438749 TGGAAGTGGGGAGGCCAGTGAGG + Intronic
1002400738 5:178990542-178990564 GGGTGCTGGGGAGACGTGTGGGG + Intronic
1002450628 5:179316475-179316497 TGGGGCTGGGGAGCCCTAGGGGG - Intronic
1002471589 5:179438970-179438992 TGGTGGTTGTGAGGACTGTGTGG - Intergenic
1004334437 6:14751444-14751466 GGCTGGTGGGGACCCTTGTGGGG - Intergenic
1005381119 6:25235298-25235320 AAGTGCTGGGGAGCCATGTGTGG - Intergenic
1005559101 6:27019904-27019926 GGGTGGTGGGAATCCCTGGGAGG - Intergenic
1005883328 6:30075955-30075977 TGGGGCGGGGTAGCCCTGTGTGG + Intergenic
1006042610 6:31268693-31268715 TGGGGGTGGGGAAGGCTGTGAGG - Intergenic
1006114809 6:31769921-31769943 AGGTGGTGGGGAGCCCCAGGAGG + Intronic
1006301321 6:33194889-33194911 TGGGGGTGGGGAGTGCTATGAGG - Intronic
1006446898 6:34084685-34084707 GTGGGGTGGGGAGCCATGTGAGG - Intronic
1006572564 6:35017753-35017775 TGGTGGTGGGCAGGCCTGTGAGG - Exonic
1006865793 6:37208121-37208143 GTGTGGTGGGGAGCCCTGGCAGG + Intergenic
1006925253 6:37650391-37650413 TGATGGTGGGCGGCACTGTGGGG + Exonic
1007396098 6:41578688-41578710 TGGGGGAGGGGAGATCTGTGGGG + Intronic
1007400305 6:41599259-41599281 TGATGCTGAGGGGCCCTGTGGGG - Exonic
1007847113 6:44768454-44768476 TTCTGGTGGAGAGCTCTGTGGGG - Intergenic
1011089683 6:83583163-83583185 TGGTAGTGGGTAGCAGTGTGAGG - Intronic
1013286442 6:108686176-108686198 TGGTGGTGGGGTGCAGTCTGCGG + Intergenic
1015885091 6:137909726-137909748 TGGCAGAGAGGAGCCCTGTGAGG + Intergenic
1018089013 6:160329499-160329521 CCATGGTGGGGAGGCCTGTGGGG + Intergenic
1018741381 6:166731808-166731830 TGGTGGGTGGAAACCCTGTGTGG + Intronic
1019121172 6:169805348-169805370 TTGTGGTGTGGAGAACTGTGTGG - Intergenic
1019414848 7:922463-922485 TGGGCTGGGGGAGCCCTGTGGGG - Intronic
1019428807 7:989127-989149 AGGTGCTGGGGGGCCCTGGGGGG - Exonic
1019609155 7:1928236-1928258 GGGTGGTGGGGAGCAGTGTCTGG - Intronic
1019609184 7:1928359-1928381 GGGTGGTGGGGAGCAGTGTCTGG - Intronic
1019768016 7:2865577-2865599 CGGAGGACGGGAGCCCTGTGAGG - Intergenic
1020247810 7:6443691-6443713 TGGTGGTGAGGTGCACTGGGAGG - Intronic
1022983888 7:35630230-35630252 TGGGGGTGGGCAGCATTGTGGGG - Intergenic
1023540340 7:41257855-41257877 TGGTGTGGAGGAGCTCTGTGGGG - Intergenic
1024771717 7:52731477-52731499 TGATGGTGGGGGCCTCTGTGTGG - Intergenic
1025206405 7:56995830-56995852 TGGTGCTGGGTGGGCCTGTGGGG - Intergenic
1025611726 7:63080621-63080643 TGGTGGTGGGCAGGGATGTGGGG - Intergenic
1025842477 7:65163490-65163512 GGGTGGTTGGTAGCGCTGTGTGG + Intergenic
1025880568 7:65532479-65532501 GGGTGGTTGGTAGCGCTGTGTGG - Intergenic
1025892869 7:65670125-65670147 GGGTGGTTGGTAGCGCTGTGTGG + Intergenic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1028742262 7:94289147-94289169 TGCTGGTGGGAAGGCCTCTGAGG - Intergenic
1029653002 7:101906500-101906522 GGGTTCTGGGGAGCCCTGGGTGG + Intronic
1029695835 7:102212661-102212683 TGGTGGTGGGGTGGGGTGTGGGG - Intronic
1030093443 7:105877062-105877084 TGGTGGGGAGGAGCCGTGAGGGG + Intronic
1031122110 7:117733763-117733785 TGGTGGCGGGGAGAAGTGTGGGG - Intronic
1032074142 7:128828451-128828473 TGGAGGTGGGGGGAGCTGTGGGG - Intergenic
1033821096 7:145134736-145134758 TGGTGTATGGGAGCCCAGTGAGG - Intergenic
1034202247 7:149289930-149289952 TGGTGGTGGCCTGGCCTGTGGGG - Intronic
1034540411 7:151754718-151754740 AGGTGGTGGGGAGTCAGGTGCGG - Intronic
1034969758 7:155411498-155411520 TGCTGTGGGTGAGCCCTGTGGGG - Intergenic
1035546061 8:483259-483281 GGATGGTGGGAGGCCCTGTGAGG - Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037580310 8:20241556-20241578 GGGTGGTGGGTAGGGCTGTGAGG + Intergenic
1037642379 8:20758240-20758262 TGGAGGTGGGGAGGGGTGTGAGG - Intergenic
1039576685 8:38629283-38629305 TGGAGGTGGGAAGCCCTTGGAGG + Intergenic
1039607930 8:38898428-38898450 TGGGGGTGGGGGTCCCTCTGAGG + Intergenic
1040598355 8:48861309-48861331 GGGTGGTGGAGAGCACGGTGTGG + Intergenic
1041375217 8:57205200-57205222 TGGTGGTGGGGAACCCTCTCGGG + Intergenic
1041375447 8:57206556-57206578 TGGTGGTGGGGAACCCTCTCGGG + Intergenic
1041376210 8:57210935-57210957 TGGTGGTGGGGAACCCTCTCGGG + Intergenic
1041377157 8:57216335-57216357 TGGTGGTGGGGAACCCTCTCGGG + Intergenic
1041786887 8:61644844-61644866 TGGTGGTTGTCAGCCTTGTGGGG - Intronic
1044071200 8:87762442-87762464 TGATGGTGAGGAGCCCAGTGGGG + Intergenic
1044873506 8:96642625-96642647 TGGTGGTGTGGAGTCATGAGGGG + Intergenic
1045063312 8:98426451-98426473 TTCTGGTCGGGAGCTCTGTGTGG - Intronic
1045482384 8:102602412-102602434 TGGTGGTGGAGATACATGTGGGG - Intergenic
1046729248 8:117707655-117707677 TGGTGGCTGGGATCCCTATGGGG - Intergenic
1048550216 8:135427039-135427061 TGGTGGTGGGGAGTTGTGGGGGG - Intergenic
1048613412 8:136048698-136048720 TGGTGGTGGGGATCAGTGAGGGG - Intergenic
1048937242 8:139367438-139367460 TGGTGGTGGGGAGGGCGGTTGGG - Intergenic
1049284488 8:141767190-141767212 TGGTGGAGGGCAGGCTTGTGTGG + Intergenic
1049284916 8:141769395-141769417 TGGTGGGGGGGAGGCCTGTGTGG - Intergenic
1049417458 8:142501768-142501790 TGGTGGTAGGGATGGCTGTGTGG + Intronic
1049598155 8:143494119-143494141 TGGCCCTGGGGAGGCCTGTGGGG - Intronic
1049637651 8:143697637-143697659 TGGTGGTGAGGAGCCCATGGGGG + Intronic
1049771565 8:144384633-144384655 CGGTGGCTGGCAGCCCTGTGTGG - Intronic
1050041171 9:1495490-1495512 TGGTGGTGAGGAGAACAGTGGGG + Intergenic
1050928528 9:11296804-11296826 TGGTGGTTGGGAGCCGGGCGCGG + Intergenic
1053600450 9:39604015-39604037 CGGAGGTGGGGGACCCTGTGTGG - Intergenic
1053858099 9:42357871-42357893 CGGAGGTGGGGGACCCTGTGTGG - Intergenic
1053913244 9:42926289-42926311 TGGAGGGTGGTAGCCCTGTGTGG + Intergenic
1054253079 9:62738369-62738391 CGGAGGTGGGGGACCCTGTGTGG + Intergenic
1054567195 9:66772868-66772890 CGGAGGTGGGGGACCCTGTGTGG + Intergenic
1055428635 9:76220906-76220928 TGGTGGTGGGGAAGACTGGGGGG - Intronic
1056966870 9:91170055-91170077 TGGTGGCAGGGGGCCCTGGGTGG + Intergenic
1057200783 9:93138808-93138830 TGGAGGTGGGCAGCCCAGGGAGG - Intergenic
1057518520 9:95741519-95741541 TGGTGGTGAACAGCCCTTTGGGG - Intergenic
1060745755 9:126129803-126129825 AGGTGGTGAGGACCCCAGTGAGG + Intergenic
1061329898 9:129885856-129885878 AGGTGGTGGGGACCCCTGGCGGG - Intergenic
1061379508 9:130245624-130245646 TGGTTGTGGGGGGCCCCTTGGGG - Intergenic
1061612389 9:131755788-131755810 TGGCGCTGTGGAGCCCTGCGTGG + Intergenic
1061709562 9:132478296-132478318 TGGTGTTGGGGAGTCCTGAATGG + Intronic
1061861812 9:133472255-133472277 TGGTAGTGACCAGCCCTGTGGGG + Intronic
1062051358 9:134448698-134448720 TGGTGGCAGGGGGCCCTGGGTGG + Intergenic
1062270028 9:135704114-135704136 TGGTGGTGGGGGGAGCTCTGTGG + Intronic
1203414955 Un_KI270590v1:4411-4433 TGGTTGTTTGGAGCCCTTTGTGG - Intergenic
1203563107 Un_KI270744v1:74117-74139 TGGTGCTGGAGAGACCTGGGCGG + Intergenic
1203686623 Un_KI270757v1:71144-71166 TGGTTGTTTGGAGCCCTTTGTGG - Intergenic
1185446019 X:258380-258402 TGGGGGTGGGGAGCCCTTGAGGG + Intergenic
1185460449 X:330811-330833 CTGTTGTGGGGAGGCCTGTGGGG + Intergenic
1185736845 X:2501464-2501486 TGGTGGTGGGGATCCCTGCTGGG - Intronic
1185736924 X:2501706-2501728 TGGTCCTGGGGGGCCCTGGGAGG - Intronic
1186455920 X:9709710-9709732 TGCTGGTGGCGGGCCCAGTGGGG - Exonic
1187285422 X:17899227-17899249 TGGTGGTGGAGAGCTATGTGGGG + Intergenic
1187842649 X:23504929-23504951 TGGAGGTGGGGAGTCCTGGGGGG + Intergenic
1189167391 X:38874207-38874229 TGATGGTTGGGAGCTCTCTGAGG + Intergenic
1189306184 X:39988418-39988440 TGATGGTGGGGATACCTGGGAGG - Intergenic
1189821206 X:44872354-44872376 TGGCGGTGGGGAGCCATGGTCGG + Intergenic
1190708716 X:53050199-53050221 TGGTGGTGGGGAGCACTTCCAGG + Intronic
1192292110 X:69809065-69809087 TGGTGGTGGGGAGGTCCATGGGG + Intronic
1192908923 X:75582685-75582707 TGGCAGTGCGGAGCCCGGTGAGG + Intergenic
1194774441 X:97944821-97944843 GGGTGGTGTGGAGCGCTGGGAGG - Intergenic