ID: 1118716766

View in Genome Browser
Species Human (GRCh38)
Location 14:68565274-68565296
Sequence CAGGATGTGCTGCCTTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118716757_1118716766 19 Left 1118716757 14:68565232-68565254 CCGCAGCAGGCTCAGCTGTGAGG 0: 1
1: 1
2: 6
3: 45
4: 641
Right 1118716766 14:68565274-68565296 CAGGATGTGCTGCCTTATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118716766 Original CRISPR CAGGATGTGCTGCCTTATCA GGG Intronic
902268429 1:15285865-15285887 CAGAATGTCCTTCCTTTTCATGG - Intronic
902560509 1:17274402-17274424 CTGGCCCTGCTGCCTTATCACGG - Intronic
904566250 1:31429969-31429991 CAGCATGAGCTGCCTTCTCTCGG - Intronic
905859848 1:41342864-41342886 CAGGCTGTGCTTCCTTTTCTGGG - Intergenic
908180575 1:61600800-61600822 CAGAATTTGCTTCCTTTTCAAGG - Intergenic
910207241 1:84760065-84760087 AAGGTTGTGCTGCCTTCTCGGGG - Intergenic
910793059 1:91070846-91070868 CAGGTTGTTTTGCCTTTTCAGGG - Intergenic
911116939 1:94255652-94255674 ATGGATGTGATGCCTTATCCTGG - Intronic
911865516 1:103015713-103015735 CAGGACGTCCTGGCTTACCAGGG - Exonic
913999102 1:143677470-143677492 CAGAATGTATTGACTTATCAGGG + Intergenic
921418512 1:214918948-214918970 CAGGAGGAGCTGCCTCATCCAGG - Intergenic
923799861 1:237197965-237197987 CAGGATGTGCTGCTTAAGGAAGG + Intronic
924315285 1:242789125-242789147 TATGATGTGCTGTTTTATCAAGG + Intergenic
924941818 1:248817424-248817446 CAGTATGTGCAGCCTTGTGAGGG + Intronic
1063368356 10:5505024-5505046 CAGGAGGTGCTGGATAATCAGGG - Intergenic
1064000152 10:11657066-11657088 CAGGATGTTGTGCCTTTGCACGG - Intergenic
1072275262 10:93816540-93816562 CAGTATGTACTGCCTTACTAAGG - Intergenic
1072584043 10:96765667-96765689 CAGCATGTGCTGCATTAAAATGG + Intergenic
1074949108 10:118311638-118311660 CAGTGTCTGCAGCCTTATCAGGG - Intronic
1075596185 10:123731020-123731042 CAGGATGTCTTTCTTTATCAGGG + Intronic
1075640500 10:124060930-124060952 CAGGATGAGCTGCCATTTTATGG + Intronic
1076048504 10:127313746-127313768 CAGGATATGCTGCCTAATGCTGG + Intronic
1077150703 11:1071858-1071880 CAGGACGTGCTGCCTCCTGATGG - Intergenic
1078487482 11:11737285-11737307 CCAGATCTTCTGCCTTATCAAGG + Intergenic
1078783857 11:14467705-14467727 CAGAATTTCCTGCCTTATTAAGG - Intronic
1080393841 11:31871977-31871999 CAGGATGTGGGCCCTTACCATGG - Intronic
1083264989 11:61542471-61542493 CAGGCTCTGCTGCCGCATCAGGG + Intronic
1083328005 11:61883375-61883397 CAGGATGTCCTACCTTTTTAAGG + Intronic
1083576763 11:63797534-63797556 CAGGCTCTGCTGCCTTGGCATGG - Intergenic
1083733107 11:64663857-64663879 CAGGATGTCCTTCCTTTTTAGGG - Intronic
1085239004 11:75036398-75036420 CAGGAGGCCCTGCCTTACCAGGG - Intergenic
1087946178 11:104163498-104163520 CAGGATGCGGTGCCTCATCCCGG - Intronic
1093144344 12:15546236-15546258 CAGGAAGTTCTGTATTATCAGGG + Intronic
1093370405 12:18357921-18357943 CAGGATTTTCTTCCTTGTCAAGG + Intronic
1093566206 12:20607068-20607090 CAGGATGTCCTACCTAATCCTGG - Intronic
1095809176 12:46353829-46353851 CATGAGGTGCTGCCTTAACCTGG - Intergenic
1098996587 12:77127876-77127898 CAGAATTTGCTGCCTTTTTAAGG - Intergenic
1099044327 12:77697071-77697093 CAAGATGTGCTGACTTCTCTGGG - Intergenic
1102331528 12:112036066-112036088 CATGATGTGCTGTTTTATTAAGG - Intronic
1103192748 12:119016290-119016312 CAGCATGTGGTACCTTATTATGG + Intronic
1103969164 12:124659184-124659206 CAGAATGTCCTTCCTTTTCAAGG + Intergenic
1104179454 12:126364593-126364615 CAGAATCTGCTGCTGTATCATGG - Intergenic
1104775157 12:131386420-131386442 CAGGAGGTCCTGACCTATCAGGG - Intergenic
1107828344 13:44351115-44351137 CAGGATGTGTTCCCTTCTGAAGG - Intergenic
1108691965 13:52867231-52867253 CAGGATGTACAGCCTGGTCAGGG - Intergenic
1110182992 13:72639272-72639294 CATTATGTGCTCTCTTATCATGG - Intergenic
1111748985 13:92303684-92303706 GAGGATGTGAAGCCTTACCAAGG + Intronic
1112412777 13:99178356-99178378 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1113067290 13:106385249-106385271 CAGGAAGTGCGGCCTCTTCAAGG - Intergenic
1113245969 13:108395755-108395777 CCTGATGTTCTGCCTAATCATGG - Intergenic
1114183223 14:20382297-20382319 CAGGATGTGCTGCAGCAGCAGGG + Exonic
1116355405 14:43922304-43922326 CAGGATTTCCTGCTTTTTCATGG - Intergenic
1116969013 14:51045417-51045439 CAGGATGGGCTGCCTGAAGAGGG + Intronic
1118085504 14:62411259-62411281 CCGGATGTATTGCCTTCTCAAGG - Intergenic
1118716766 14:68565274-68565296 CAGGATGTGCTGCCTTATCAGGG + Intronic
1118753452 14:68822384-68822406 CAGGAAGTGCTGTGTTATAAGGG - Intergenic
1121093245 14:91197718-91197740 CAGAATGTCCTGCCTTTTTAAGG + Intronic
1123681539 15:22767833-22767855 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
1123761836 15:23439598-23439620 CAGGAGGTACTGCCTAATCCTGG + Exonic
1123772856 15:23546514-23546536 CAGAAAGTGGTGCCATATCAGGG + Intergenic
1124333754 15:28842290-28842312 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
1124571809 15:30871277-30871299 CAAGATATGGTGCCATATCAGGG - Intergenic
1128536631 15:68496193-68496215 CAGGATTTCCTTCCTTTTCATGG - Intergenic
1129283390 15:74503770-74503792 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1133404443 16:5511761-5511783 CACCATGTGATGCTTTATCAAGG + Intergenic
1136555121 16:31003092-31003114 CAGGCTGTGCTGGCTTTTCCTGG - Intronic
1140611605 16:76606426-76606448 CAGAATGAGGTGCCTTTTCAAGG - Intronic
1140671803 16:77286938-77286960 CAGTGTGTGATGCCTTATCTGGG - Intronic
1144769397 17:17751194-17751216 CAGGAAGTGGAGCCTCATCAAGG + Intronic
1145711938 17:26985781-26985803 CAGGATGTACTGCTTCATCTGGG + Intergenic
1146984485 17:37201833-37201855 AAGAATGTGCTTCCTTATAAGGG - Intronic
1147372780 17:40004916-40004938 CAGGCTGTGCTGCCTTCTTCCGG + Intergenic
1150994135 17:70296648-70296670 CAGGATTTCCTGCTTTTTCATGG - Intergenic
1151997459 17:77618909-77618931 CAGGCTGTGCTGGCTTCTCCTGG + Intergenic
1152289609 17:79432122-79432144 CAGGATTTCCTTCCTTTTCAAGG + Intronic
1156518750 18:37703396-37703418 CAGGATAGGCTGCTTTATGAAGG + Intergenic
1157310835 18:46551868-46551890 CAGGATGTCCTTCCTTTTTAAGG - Intronic
1158740998 18:60142122-60142144 CAGGATATCCTGCTTTATTAAGG - Intergenic
1158880935 18:61779152-61779174 CAGCATCTCCTGCCTTCTCAGGG + Intergenic
1159599335 18:70413781-70413803 CAGGATGTGCTGTGTGACCAGGG - Intergenic
1159921817 18:74233252-74233274 CAGTTTGTGCTACCTTATTACGG + Intergenic
1161371779 19:3916219-3916241 CAGAATGTCCTTCCTTTTCATGG + Intronic
1162023818 19:7882085-7882107 CAGAATTTTCTGCCTTTTCAGGG - Intergenic
1163268599 19:16235830-16235852 CAGGAAGTGCTGCCTGCTCTTGG + Intronic
1163797079 19:19343892-19343914 CATCATGTGCCGCCTTGTCACGG + Exonic
1164260778 19:23567105-23567127 CAGGTTGTGCTGCAGTTTCACGG + Intronic
1165932797 19:39371107-39371129 CAGGTCATGCTGCCTTACCATGG - Intronic
1168486211 19:56764654-56764676 CATGATGTGCTGGGTTAGCATGG - Intergenic
925273684 2:2633994-2634016 CAAGATGTCCTCCTTTATCAAGG + Intergenic
925895498 2:8468632-8468654 CAGAATGTGCTGTCTTCTTAAGG + Intergenic
926675636 2:15618178-15618200 CAGGATGGGCTTCTTTCTCAAGG + Exonic
927307398 2:21589115-21589137 CAGGCTGAGCTTTCTTATCAAGG - Intergenic
927650384 2:24909419-24909441 CAGGATGTGTGGCTTAATCATGG - Intronic
928128206 2:28630457-28630479 CAGCCTGTGCTGCCTTACCTAGG - Intronic
930006926 2:46905022-46905044 CAAGATCTGATGGCTTATCAGGG + Exonic
933999422 2:87695092-87695114 CAGGATGTACTGCATTCTTAGGG - Intergenic
936166327 2:110122841-110122863 TAAGATGTTCTGCCTTATCGGGG - Exonic
937340375 2:121087199-121087221 GAAGATGTGGTGCCTTTTCAGGG - Intergenic
944935892 2:204567538-204567560 CAGAATTTCCTTCCTTATCAAGG + Intronic
947231432 2:227891818-227891840 CAGTTTGTGCTACCTTATTATGG - Intronic
948446551 2:238038058-238038080 CAGGAGGTGCTGCCTGACCATGG + Intronic
1169317093 20:4601813-4601835 CAGGACCAGCTGCCTGATCATGG - Intergenic
1171208981 20:23302508-23302530 CAGGCAGTGCTGCCTCACCAGGG + Intergenic
1171521896 20:25782615-25782637 CAGAATCTCCTGCCTTTTCAAGG + Intronic
1171554929 20:26073268-26073290 CAGAATCTCCTGCCTTTTCAAGG - Intergenic
1178883971 21:36470602-36470624 CAGGTTGTGGTGCTTTGTCATGG + Intronic
1180038644 21:45264518-45264540 TAGGATGAGCTGCTTTATCAGGG - Exonic
1182850330 22:33468490-33468512 CAGAATGTGCTGCCTAAAGATGG - Intronic
1183333926 22:37236055-37236077 CAGGATGTCCTGGCTTCCCAAGG - Intronic
953200052 3:40770507-40770529 CAAGATGTTATGACTTATCAAGG - Intergenic
953876443 3:46669490-46669512 CAGGCTGTCCTCACTTATCAGGG + Exonic
962101771 3:132350312-132350334 TTGGATGTGCTGCCTTGTCTAGG - Intronic
962582512 3:136811046-136811068 CAGAATGTCCTTCCTTTTCAAGG + Intergenic
963063334 3:141242359-141242381 CAGGGTGTCCTGCCTTATATGGG - Intronic
967771756 3:193341543-193341565 CAGGATCTGCTGCCCTGTCCAGG + Intronic
969116785 4:4875249-4875271 CAGGAAATGCTGCCTGGTCAGGG + Intergenic
969371686 4:6735378-6735400 TAGGATGTGCTACCTTGCCAGGG - Intergenic
970278842 4:14431961-14431983 CATGAAGTGCTGCATAATCAGGG - Intergenic
971091768 4:23353860-23353882 CAGTCTGTGGTGCCTTGTCATGG - Intergenic
980177565 4:129365248-129365270 CAGGATGCGCAGGCTTCTCATGG - Intergenic
985169574 4:187134378-187134400 CCAGATTTGCTGCCTTATCTTGG - Intergenic
985789552 5:1918242-1918264 CTGGGTGTGCTGGCTTCTCAAGG + Intergenic
985891591 5:2720025-2720047 AAGGATGTCCTGGCTTCTCAAGG + Intergenic
986056622 5:4143542-4143564 CAGGAGGAGCTGTCTTTTCAAGG - Intergenic
986392531 5:7299829-7299851 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
988290926 5:29285377-29285399 TACCATGTGCTGACTTATCAAGG + Intergenic
992084358 5:73264710-73264732 CAGAATGTGCTTCCTTTTAATGG - Intergenic
993093569 5:83456915-83456937 CAGGATTTCCTTCCTTTTCAAGG - Intergenic
994159875 5:96545577-96545599 CAGGTAGTGATGCCATATCAGGG + Intronic
994746905 5:103689726-103689748 TAGGAAGTACTGCTTTATCATGG - Intergenic
995943046 5:117608041-117608063 CAGGAAGTGCTGACTATTCAGGG - Intergenic
996018030 5:118562712-118562734 TAGAATGTGTTGCCTTATTATGG - Intergenic
996872852 5:128211273-128211295 CAGGATTTGCTTCCTTTTTAAGG - Intergenic
998370141 5:141655603-141655625 CAGGGTGGGGTGCCTTACCAGGG + Exonic
999257326 5:150216831-150216853 CATGATGTGGTGCCTTCTCAGGG - Intronic
999874593 5:155788792-155788814 CAGGATGTTCTGCCTAGTGATGG - Intergenic
1000226026 5:159262980-159263002 CTGGGTGTGCTGCCTTTTCCAGG - Intergenic
1002163390 5:177330536-177330558 CACGATCTGCTACCTTTTCAAGG + Intergenic
1002414251 5:179110764-179110786 AAGGAGGTGCTGCCTTCACAAGG - Intergenic
1002596950 5:180329897-180329919 CAGTGTGTGCTCCCTTCTCAGGG + Intronic
1002638268 5:180618694-180618716 CAGGCTGGGGTGCCTGATCACGG + Intronic
1002909019 6:1474044-1474066 CAGGATTTCCTCCCTTTTCAAGG + Intergenic
1005818784 6:29579630-29579652 CAGGATATAGTGCCATATCAAGG + Intronic
1008555132 6:52666409-52666431 CAGGCTGGGCTGCCATAGCATGG + Intergenic
1010024848 6:71203300-71203322 CAGGATGAGCGACCTCATCAAGG - Intergenic
1011896671 6:92236172-92236194 CATGATGTGCTTCTTTATTATGG + Intergenic
1014172410 6:118293065-118293087 GAGGGTGTGCTGGCTTTTCAAGG + Intronic
1018904671 6:168068740-168068762 AAGGGAGTACTGCCTTATCAGGG - Intronic
1018923072 6:168189219-168189241 CAGGATGGGCTTCCTGACCAGGG - Intergenic
1019353521 7:566874-566896 CAGAATGTCCTTCCTTTTCAAGG - Intronic
1019353623 7:567688-567710 CAGAATGTCCTTCCTTTTCAAGG - Intronic
1022981903 7:35611998-35612020 CAGGATGTCCTGCCTTTTTTAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1029650140 7:101885976-101885998 CCAGATGTGCTGCCTGCTCATGG - Intronic
1034685114 7:152963741-152963763 CAGTATGTGCTGTATTCTCAGGG + Intergenic
1034827967 7:154284085-154284107 CAGGGGGAGCTGCCTCATCATGG + Intronic
1035173991 7:157037638-157037660 GAGGGTGTCCTGCATTATCAAGG + Intergenic
1037221944 8:16534286-16534308 GAGAATGTGCTGCCTTAGTAAGG + Intronic
1037873361 8:22521229-22521251 GAGGAAGTCCTGCCTTAACAGGG - Intronic
1039186484 8:34923126-34923148 CAGGATCAGCTGCAATATCAGGG + Intergenic
1039711246 8:40057893-40057915 CAGAATGTCCTTCCTTATCAAGG + Intergenic
1041469442 8:58192345-58192367 CAGGATGGGCTGACTTCTCCTGG + Intronic
1041556851 8:59167268-59167290 CAGGATTTTCTTCCTTTTCAAGG + Intergenic
1041591487 8:59590542-59590564 CAGGATCTGCTGTCTTCCCAAGG - Intergenic
1042200640 8:66276881-66276903 CATGATGTACTGTCCTATCAGGG - Intergenic
1044872640 8:96634575-96634597 CAGGATTTCCTTCCTTTTCAAGG + Intergenic
1045294026 8:100858620-100858642 CAGGATGGGTTGCCTGAGCAGGG - Intergenic
1045768404 8:105704740-105704762 TAAGATGTGCTGCCTCATAAGGG + Intronic
1045851187 8:106699775-106699797 CAGGAAGTGGTGCTTTCTCATGG + Intronic
1046223177 8:111241447-111241469 CAGAAGGTGCTGGCTTAACAGGG + Intergenic
1048928789 8:139294310-139294332 CAGGATTTGCTTCCTTCTTAAGG - Intergenic
1049367920 8:142249604-142249626 AAGCCTGTGCTGCCTTCTCACGG + Intronic
1051475932 9:17509236-17509258 CAGGAAATGGTGCCATATCAAGG - Intergenic
1052065234 9:24010246-24010268 CAGGATGTTTTGCCTTATTAAGG + Intergenic
1052482937 9:29055374-29055396 CAGGATTTACTTCCTTATTAAGG + Intergenic
1057368885 9:94451831-94451853 CAGGCTGGGCTGCCTGGTCAAGG - Intronic
1058651646 9:107180375-107180397 CAGGAAGTGTTTCCTAATCAGGG - Intergenic
1061661968 9:132136338-132136360 CAGGGTGTGCTGCCGGAGCAGGG - Intergenic
1186827734 X:13358061-13358083 CAGGATGGGCTGTCTTCACAAGG - Intergenic
1187757214 X:22541076-22541098 CAGGATGTGCTTCCATCTTATGG - Intergenic
1188724819 X:33569775-33569797 CAGGATCTGTTTCCTTCTCATGG - Intergenic
1192924572 X:75741871-75741893 CAGGATATGCTGCAGGATCATGG + Intergenic
1193432302 X:81423345-81423367 CTGGATGTACTGCATGATCATGG - Intergenic
1193609811 X:83616993-83617015 CAGGATCTGATTCCTTTTCATGG + Intergenic
1198059621 X:133032253-133032275 GGGGATGTGCTGCCTTATATAGG + Intronic
1200077528 X:153558748-153558770 CAGGACTTTCTGCCTTTTCATGG + Intronic