ID: 1118721397

View in Genome Browser
Species Human (GRCh38)
Location 14:68596835-68596857
Sequence TGCCAATGTCTGCCCCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118721397_1118721401 -3 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721401 14:68596855-68596877 GCAACACACCCAGAAGGTGGTGG 0: 1
1: 0
2: 3
3: 29
4: 259
1118721397_1118721399 -9 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721399 14:68596849-68596871 ACATTGGCAACACACCCAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
1118721397_1118721406 18 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721406 14:68596876-68596898 GGGGAGTGCAGCTGTCCTCCTGG 0: 1
1: 0
2: 1
3: 33
4: 283
1118721397_1118721400 -6 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721400 14:68596852-68596874 TTGGCAACACACCCAGAAGGTGG 0: 1
1: 0
2: 2
3: 25
4: 285
1118721397_1118721402 -2 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721402 14:68596856-68596878 CAACACACCCAGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 9
4: 183
1118721397_1118721403 -1 Left 1118721397 14:68596835-68596857 CCCGTCAGGGGCAGACATTGGCA 0: 1
1: 0
2: 1
3: 14
4: 114
Right 1118721403 14:68596857-68596879 AACACACCCAGAAGGTGGTGGGG 0: 1
1: 0
2: 0
3: 29
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118721397 Original CRISPR TGCCAATGTCTGCCCCTGAC GGG (reversed) Intronic
900480147 1:2894293-2894315 TGCCAATGTCTGTCCCTTTCAGG + Intergenic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
901124350 1:6918663-6918685 TGCACATCTCTGCCCATGACAGG + Intronic
902159416 1:14518042-14518064 GCCCAAGGTCTGCCACTGACTGG + Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
910759431 1:90719741-90719763 GGCCACTGTCGGCCCCTGCCGGG - Intergenic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
912719106 1:112004779-112004801 TGTCAGGGTCTGACCCTGACTGG - Intergenic
913003673 1:114607053-114607075 TGCCACTTTCTCCCCCTGGCTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
913693947 1:121306209-121306231 TGCCATTGTCTGCCCTTGTCGGG + Intronic
914143617 1:144973858-144973880 TGCCATTGTCTGCCCTTGTCGGG - Intronic
915957925 1:160238691-160238713 TGGCCATGTGTGCCCGTGACGGG - Exonic
916370429 1:164088134-164088156 TGTCAATGTCTGCTACTTACTGG - Intergenic
916410026 1:164537995-164538017 TGCCAACTTCTGCCTCTTACAGG - Intergenic
916764007 1:167842906-167842928 TAAAAATGTTTGCCCCTGACTGG + Intronic
918399744 1:184151756-184151778 TACCAGTGTCTGTCCCTGATGGG - Intergenic
920481272 1:206324588-206324610 TGCCATTGTCTGCCCTTGTCGGG + Intronic
920751850 1:208685784-208685806 AGCTGATGTCTGCCCATGACTGG - Intergenic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
922128796 1:222756283-222756305 TTCAAATGTCTTTCCCTGACTGG + Intergenic
922218840 1:223542546-223542568 GGCCAATGCCTCCCCCTGCCTGG + Intronic
1069517916 10:69094166-69094188 TTTCAATGTCTGCCCCTTACTGG - Intronic
1069926184 10:71852321-71852343 TGCCTGTGGCTGCCCCTGCCAGG + Intergenic
1071236803 10:83658427-83658449 TGCCAATTTCTCCTCCTAACAGG + Intergenic
1072690919 10:97571961-97571983 TGGCACTGTCTGGGCCTGACAGG + Intergenic
1073660486 10:105470689-105470711 TTCTAATGTATGTCCCTGACAGG - Intergenic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1075564295 10:123492455-123492477 TGCCAATCTCTGCCTTTAACTGG - Intergenic
1079378230 11:19913570-19913592 TGTCTATGTGTGCCCCTGCCCGG + Intronic
1083226957 11:61291291-61291313 TCCCAATGTCTGCTCCTGCCAGG - Exonic
1084534083 11:69746573-69746595 TGGCAATGTCGGCCCCTGAGAGG - Intergenic
1084566928 11:69935161-69935183 GGCCAATGCCTACCACTGACCGG - Intergenic
1086076709 11:82862447-82862469 AGCCTATGTCTGACCCAGACTGG - Intronic
1087728865 11:101756065-101756087 TGTCACTGTCTACCCCTGATAGG + Intronic
1088925880 11:114302101-114302123 TGACAATTTCTGCCTCTAACTGG + Intronic
1090154918 11:124427022-124427044 TGGCAATGTCTGGTTCTGACAGG + Intergenic
1091851029 12:3696982-3697004 TCGCGATGGCTGCCCCTGACGGG - Exonic
1096608821 12:52787784-52787806 TGCGAGTGTCTAGCCCTGACGGG + Intergenic
1100619804 12:96260001-96260023 TGAAAATGTCTGCCTCTGAAGGG - Intronic
1100636231 12:96437144-96437166 TGCCAGTGTCTGCAGATGACAGG + Intergenic
1105205112 13:18216717-18216739 TGCCACTGTCTGCACCAGCCAGG + Intergenic
1105623676 13:22092768-22092790 TGCAAATGTCTGTCCCTTACTGG - Intergenic
1105729831 13:23201465-23201487 TGCCTCTGTCTGCCCCTCACAGG - Intronic
1107339395 13:39389656-39389678 TGCCACTGTCTGCCACACACCGG - Intronic
1117726312 14:58677958-58677980 TGCCAAAGTATGCCACTGAAAGG - Intergenic
1118721397 14:68596835-68596857 TGCCAATGTCTGCCCCTGACGGG - Intronic
1119664785 14:76477574-76477596 TGCCCATCTCTGTCCCTTACGGG - Intronic
1127997552 15:64162619-64162641 TGCCAGTGTCGGCCCCAGATGGG + Intronic
1130105541 15:80925889-80925911 TGCCATTCTATGCCCCTGCCTGG - Intronic
1130226268 15:82060454-82060476 TGCCACTGTCAGACACTGACCGG + Intergenic
1134136383 16:11679230-11679252 TGCCAATGTCAGCGCCACACTGG - Exonic
1138510282 16:57504724-57504746 TGCCAATGTTTTCACCTGGCTGG - Intergenic
1138536613 16:57663671-57663693 TTCCAAAGTCTGCGGCTGACTGG - Exonic
1139572983 16:67824953-67824975 TGCCAATGTTTCCCCCTGTGGGG - Intronic
1140207999 16:72949160-72949182 TGCCCATGTCGGCCTCTGCCGGG - Intronic
1141596807 16:85102055-85102077 TGTCAATATCTGCCCCTGGGTGG - Intronic
1142263406 16:89052837-89052859 TGGCTATGTCTGCTCCTGACAGG - Intergenic
1142470682 17:161687-161709 TGCCACACTCTGCCCCTGTCAGG - Intronic
1147964288 17:44185777-44185799 TGCTTATGTTTGCCCCTGTCTGG + Intergenic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1150710753 17:67529099-67529121 TGCCAGTGTCTGCCCCGCGCCGG + Intronic
1151078809 17:71304771-71304793 TGCTTATGTCTGCCCCTATCTGG + Intergenic
1154352281 18:13594279-13594301 TGCCACTGTCTGCCACTGTAGGG + Intronic
1156404320 18:36770067-36770089 TGCCTCTGTCTGCCCCTCTCAGG + Intronic
1164487377 19:28670475-28670497 GGCCAATGTCTACACCTCACAGG - Intergenic
1165150728 19:33758711-33758733 TGCCCACGTCTGCCCCTGGAGGG + Intronic
1165222974 19:34332372-34332394 TGCCAATGAGTTCCCCTGAAAGG + Intronic
926839174 2:17059391-17059413 TCCCAATGTCTGCACTAGACTGG - Intergenic
935176052 2:100649500-100649522 TGCCAATTTCAGCACCTGAAAGG - Intergenic
936064290 2:109318816-109318838 AGCCAATGTCTGCCTCTGAGTGG - Intronic
936284649 2:111172892-111172914 AGCCAGGGTCTGCCCCAGACAGG + Intergenic
940540666 2:155011432-155011454 TGTCTATGTCTGCCACTTACAGG + Intergenic
941541892 2:166796227-166796249 TACCATTGTCTGCCTCTGAGTGG + Intergenic
942711411 2:178840313-178840335 TGTCATTGTCTGCCCCTGGAAGG - Intronic
944530383 2:200662222-200662244 TTCCAATGCCTGTTCCTGACAGG - Intronic
945647448 2:212516440-212516462 TTCCAGTCTCTGCCACTGACTGG + Intronic
945902593 2:215555653-215555675 TGCCAGTCTCTGCCCATGTCAGG - Intergenic
947125971 2:226868739-226868761 TGCCAGTGGCTGCCCGTGATGGG - Intronic
947822389 2:233081177-233081199 TGGGAATGTCTGTCTCTGACAGG + Intronic
948939407 2:241188613-241188635 TGCGAATGGCTGCCACTGCCTGG + Exonic
949018435 2:241726657-241726679 TGCCAGTGTCTGGGCCTGAAGGG + Exonic
1170491943 20:16886297-16886319 TGCCACTCCCTGCCCCAGACAGG + Intergenic
1170600430 20:17837400-17837422 TGACAATGCCTGCTCCTGGCTGG - Intergenic
1172181999 20:33009339-33009361 TGGCAATGTCTGTCCCTCCCTGG - Intronic
1172548201 20:35778413-35778435 TGCCAGTGACTGCCCCTTACAGG + Intronic
1172903209 20:38349767-38349789 TCCCACTGTCTGCCCCGGAGAGG - Intronic
1174580453 20:51567797-51567819 TTCCAATCTCTGCCACTTACCGG + Intergenic
1174767791 20:53270253-53270275 TGCAAGTGTGTGCCCCTGGCTGG + Intronic
1182181750 22:28356689-28356711 TGCCACTCTCCACCCCTGACAGG - Intronic
1183512587 22:38244800-38244822 TGCCCAGGTCTGCCCTAGACAGG - Intronic
1184504262 22:44891492-44891514 TTCCTATTTCTGCCCCTGGCAGG - Intronic
1184726477 22:46350170-46350192 TGTTGATGTCTGCCTCTGACAGG + Intronic
1184896248 22:47408592-47408614 TGCCAACGTCTCCACCTGGCGGG - Intergenic
949918583 3:8984256-8984278 TGCCAAGGACTGCCCCTCCCTGG + Exonic
962318304 3:134372283-134372305 TGCCAAGGTCATCCCATGACAGG - Intronic
968642894 4:1723193-1723215 TGCCCATGGCTCCCCCTGCCAGG + Intronic
972775555 4:42236715-42236737 TAGCAATGTCTGCCCCTGGGAGG + Intergenic
977149535 4:93492671-93492693 TGCCAAAGTCTTACCCTGAATGG - Intronic
995778800 5:115754316-115754338 AGCCAATGCCTGGCCCTGAGAGG + Intergenic
1003504649 6:6730087-6730109 TGCCATTTTCTGCCCATGAAGGG + Intergenic
1004420174 6:15462302-15462324 TGCCAATCTCTGCCCATTCCTGG - Intronic
1006449982 6:34100103-34100125 TGCCCCTGTCTGGCCCTGGCAGG + Intronic
1010226644 6:73495898-73495920 TGCTAATATCTGCCCTTCACAGG - Intronic
1011025139 6:82860499-82860521 TGCCAATCTCGTGCCCTGACAGG - Intergenic
1018414697 6:163590950-163590972 TACCAACGTTTGCCCCCGACGGG - Intergenic
1020599462 7:10253833-10253855 TGCCCCTGTCCTCCCCTGACAGG - Intergenic
1023537777 7:41231747-41231769 TGCCAATCCCTGCCCCAAACTGG - Intergenic
1023614000 7:41999981-42000003 TGGCAATGTCTTACCCAGACAGG + Intronic
1028868353 7:95738241-95738263 TGCCAATGTCTGCACAGGAAGGG - Intergenic
1030655567 7:112163500-112163522 TGCCAATGTCAGCCAATGAATGG + Intronic
1031595399 7:123644231-123644253 TGCCAATTCCTGCCCTTAACAGG - Intergenic
1033906633 7:146212883-146212905 TGCTAATATCTCCCCCTTACTGG + Intronic
1035857628 8:2993395-2993417 GGCTACTGTCTGCCCCTGTCCGG + Intronic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1042607055 8:70555886-70555908 TGCAAATGTCTGTTCCTGAGAGG - Intergenic
1043242719 8:77956458-77956480 TGCCACTGTGTTACCCTGACTGG - Intergenic
1044581338 8:93829219-93829241 TGCCTATTTCTGCCCTTGAATGG - Intergenic
1046195736 8:110860656-110860678 TCCCAATGTCTGCCCAAGTCTGG - Intergenic
1050676000 9:8053681-8053703 TGCCCTGGACTGCCCCTGACCGG - Intergenic
1052415791 9:28175411-28175433 TGCCACTGTCTGCCAATGAGAGG - Intronic
1054981845 9:71215912-71215934 TGGCAATGTCTGCCCCTGGTCGG + Intronic
1055274569 9:74599808-74599830 TGCTAATGGCTGCCCCAGAATGG + Intronic
1056332422 9:85532223-85532245 TCCCAATGCCAGCCTCTGACAGG + Intergenic
1056654483 9:88497825-88497847 TGCCACTGTCTGCCTCTGACAGG + Intergenic
1058088269 9:100774706-100774728 TAACAATGTCTGCCCATCACTGG - Intergenic
1062147644 9:134998836-134998858 TGCCAAGGAGTGGCCCTGACTGG - Intergenic
1062415289 9:136445928-136445950 TGCCTGTGTGTGCCCATGACAGG + Intronic
1192016433 X:67336510-67336532 TGCCAATGTCTTCCACTCTCTGG + Intergenic
1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG + Intronic