ID: 1118723788

View in Genome Browser
Species Human (GRCh38)
Location 14:68612452-68612474
Sequence CAGAGCTGGCCCATAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118723788_1118723793 15 Left 1118723788 14:68612452-68612474 CCTGGTCCTATGGGCCAGCTCTG 0: 1
1: 0
2: 2
3: 23
4: 171
Right 1118723793 14:68612490-68612512 TTGCCATCAAGGAATACAAGTGG 0: 1
1: 0
2: 7
3: 67
4: 789
1118723788_1118723795 22 Left 1118723788 14:68612452-68612474 CCTGGTCCTATGGGCCAGCTCTG 0: 1
1: 0
2: 2
3: 23
4: 171
Right 1118723795 14:68612497-68612519 CAAGGAATACAAGTGGCCAAAGG 0: 1
1: 0
2: 1
3: 36
4: 328
1118723788_1118723792 4 Left 1118723788 14:68612452-68612474 CCTGGTCCTATGGGCCAGCTCTG 0: 1
1: 0
2: 2
3: 23
4: 171
Right 1118723792 14:68612479-68612501 AAGATGACTCTTTGCCATCAAGG 0: 1
1: 0
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118723788 Original CRISPR CAGAGCTGGCCCATAGGACC AGG (reversed) Intronic
900657893 1:3769035-3769057 CAGAGGTGCCCCACAGGAGCTGG - Intronic
902785541 1:18730653-18730675 CTGAGCTGGCCCCGAGGGCCTGG - Intronic
904596943 1:31652748-31652770 CCTGGCTGGCCCATGGGACCCGG + Exonic
904632013 1:31849386-31849408 CAGCACTGGCCCATGGGACATGG - Intergenic
905243247 1:36595121-36595143 CAGAGCTGGCACCTAAGCCCAGG + Intergenic
905883661 1:41480301-41480323 CTGAGCTGGGCCCTGGGACCTGG + Intronic
906703040 1:47873533-47873555 CAGAGCAAGCTCACAGGACCAGG + Intronic
907511779 1:54966923-54966945 CAGAGTTGGTCCCTGGGACCAGG + Intergenic
914754179 1:150553704-150553726 CAGAGGTGGCCCCCAGAACCAGG + Exonic
917176114 1:172237392-172237414 CAGATCTGGCCCTCAGAACCTGG - Intronic
919907552 1:202088313-202088335 GAGAGCTGGCCCAGAGGAGAAGG - Intergenic
919916511 1:202142957-202142979 CAGAGCAGGCACATAACACCTGG - Intronic
922473118 1:225888770-225888792 CTGACCTGCCCCATGGGACCAGG + Intronic
923987206 1:239394844-239394866 TAGAAGTGGCACATAGGACCAGG - Intronic
924944141 1:248834503-248834525 CAGAGCAGGCACATAGTACATGG - Intergenic
1062774881 10:136058-136080 CAGGGCTGGCCCCGAGGCCCGGG + Intronic
1062809521 10:452061-452083 CACAGCTGACCCACAGGATCGGG + Intronic
1064436832 10:15318069-15318091 CAGGGGTGACCCATAGCACCTGG + Intronic
1067432772 10:46254764-46254786 CAGAGCTGACCCTGAGGCCCAGG + Intergenic
1075212782 10:120505211-120505233 AAGAGCTGGCCGCTAGAACCTGG - Intronic
1076414227 10:130273782-130273804 AAGAGCTGGGCCAGGGGACCTGG - Intergenic
1076872239 10:133199795-133199817 CACAGCTTTCCCATCGGACCTGG + Intronic
1078005223 11:7527375-7527397 CAGAACTGGCCCATTGGATCTGG + Intronic
1081978849 11:47253819-47253841 CAGAAGAGGCCCATAGGACTGGG + Intronic
1084858423 11:72003324-72003346 CGGAGCTGGCCCAGGGGGCCTGG - Exonic
1084948497 11:72651913-72651935 AAGAGCTGGGCCCTAGGACCAGG + Intronic
1085120678 11:73965522-73965544 CAGGGCTGGGCCATGGGACAGGG - Intronic
1085403304 11:76247206-76247228 CAGAGCTGGCCCATCTGCCCTGG - Intergenic
1087163412 11:94973579-94973601 CAGAGCTAGCGCCTACGACCCGG + Exonic
1089251035 11:117161888-117161910 CAGAGGTGGGCCATGGGAGCAGG + Intronic
1089261846 11:117229137-117229159 CAGAGCTGGACCATGAGCCCAGG + Intronic
1089496012 11:118909087-118909109 CAGAGAAGGGCCACAGGACCTGG + Intronic
1090225617 11:125070559-125070581 GAGAGCTAGCCCATAGGACAGGG - Intronic
1092015873 12:5157489-5157511 CAGAGCTGGGACAGAGGTCCAGG - Intergenic
1092058407 12:5525447-5525469 CAGGACTGGCCCATATGGCCAGG + Intergenic
1092275284 12:7056139-7056161 CACACCTGGCCCACAGGACATGG + Exonic
1104953487 12:132452964-132452986 CAAAGCTGGGCCAGAGGAACAGG - Intergenic
1104963055 12:132497382-132497404 CAGAGCTGGCCCAAGGTCCCAGG + Intronic
1105661779 13:22503932-22503954 CATAGCTGGACCATAGCACTTGG - Intergenic
1107592873 13:41926701-41926723 CCCAGATGGCCCATAGGGCCAGG + Intronic
1108319520 13:49275034-49275056 CAGAGCAAGTCAATAGGACCAGG + Intronic
1109868086 13:68292835-68292857 CAGAGCTGGCCTGTCGGCCCTGG - Intergenic
1111374050 13:87354890-87354912 CAGAGATGACCCATAGCACATGG - Intergenic
1113616875 13:111686390-111686412 CAGGGCTGGACCATACAACCAGG - Intergenic
1113622405 13:111771661-111771683 CAGGGCTGGACCATACAACCAGG - Intergenic
1113948911 13:114060402-114060424 CAGACCTGGCACAGTGGACCAGG + Intronic
1114410011 14:22492162-22492184 CAGAGCTGAGCCATGGGACCTGG + Intergenic
1118717309 14:68569610-68569632 CAGAGGTGTCCCATAGCAACTGG - Intronic
1118723788 14:68612452-68612474 CAGAGCTGGCCCATAGGACCAGG - Intronic
1120960799 14:90123015-90123037 CAGAGCTGGGACATAAGCCCAGG + Intronic
1121328075 14:93033444-93033466 CAGGGCTGGCCCAGAGGAGGTGG - Intronic
1122700391 14:103584422-103584444 CAGAGCTGCCCCATTCGAACAGG + Intronic
1122775132 14:104113662-104113684 CAGAGCTGGCCCTTGGCACCTGG + Exonic
1124964416 15:34422778-34422800 CAGAGCTGGCTCCTGGGACATGG - Intronic
1124981035 15:34569004-34569026 CAGAGCTGGCTCCTGGGACATGG - Intronic
1125336339 15:38630229-38630251 CAGATTTGGCCCATAGGCCATGG - Intergenic
1127683783 15:61322174-61322196 CAGAGCTACCCCACAGGACCAGG - Intergenic
1129362777 15:75034627-75034649 CTTAGCTGGCCGCTAGGACCTGG + Intronic
1129741905 15:77993404-77993426 CAGATCTGCCCCAGAGGAGCAGG - Intronic
1129843805 15:78759070-78759092 CAGATCTGTCCCAGAGGAGCAGG + Intergenic
1130258004 15:82334730-82334752 CAGATCTGCCCCAGAGGAGCAGG - Intergenic
1130596931 15:85255233-85255255 CAGATCTGCCCCAGAGGAGCAGG + Intergenic
1132613992 16:831454-831476 CACAGCAGGCCCACAGGCCCAGG - Intergenic
1132693163 16:1190683-1190705 CAGAGCTGCCCCACAGGCACAGG + Intronic
1132858507 16:2058159-2058181 CAGGGCTGGCCCCCAGGGCCTGG - Intronic
1134137708 16:11690296-11690318 CAGAGCTTGCCCCTGGGACTTGG - Intronic
1135467797 16:22702101-22702123 CATGGCTGGCCCATAGGACCAGG + Intergenic
1136020686 16:27437963-27437985 GAGAGCTGGCCCAGAGGGCAGGG - Intronic
1137036853 16:35575314-35575336 CAGAGCAGCCCCAAAGGGCCTGG - Intergenic
1138938750 16:61763210-61763232 CAGAACTGGCCCACTGGAGCTGG - Intronic
1141148999 16:81551433-81551455 CAGACATGGCACATGGGACCTGG + Intronic
1141254253 16:82386051-82386073 CAGAGCTGGTCCATCTGAGCTGG + Intergenic
1141690348 16:85593218-85593240 GAGAGCTGGCCCGTGGGACCAGG - Intergenic
1142901208 17:3013010-3013032 CAGAGGTGGAGCAGAGGACCGGG + Intronic
1143329362 17:6122043-6122065 CAGAGCAGGACCATGGGGCCTGG - Exonic
1144890004 17:18489123-18489145 AAGATGTGGCCCATAGGCCCTGG - Intronic
1144891315 17:18495914-18495936 CAGAGCTGGCTCCTCGGACCTGG + Intergenic
1145140908 17:20448403-20448425 CAGAGCTGGCTCCTCGGACCTGG - Intergenic
1145142212 17:20455194-20455216 AAGATGTGGCCCATAGGCCCTGG + Intronic
1147965196 17:44190928-44190950 CAGAGCTGGGCCCAAGGGCCGGG + Exonic
1148914219 17:50960920-50960942 CAGAGCCGGGCCACAGAACCAGG + Intergenic
1149993792 17:61396712-61396734 CACAGCGGGCCCATAGCACGGGG + Intergenic
1150849456 17:68690681-68690703 CAGAAGTGGACCACAGGACCTGG + Intergenic
1151225568 17:72645586-72645608 CAGAGCTGGTCCCTAGATCCTGG - Intergenic
1151786954 17:76279712-76279734 GGGGCCTGGCCCATAGGACCTGG - Intronic
1152093011 17:78257293-78257315 CAGGGCTGGCCCAGGTGACCCGG - Intergenic
1152783141 17:82235293-82235315 CAGAGCTGGCCCCTTGTCCCTGG - Exonic
1155638473 18:27983544-27983566 CAAAGCTTGCCCAGATGACCTGG + Intronic
1157165928 18:45358401-45358423 CAGAAGTGGCCTATAGGAGCAGG - Intronic
1161129058 19:2577418-2577440 CAAGGGTGGCCCATAGGAGCTGG - Intronic
1161456926 19:4374300-4374322 CAGAGCTGGCCCCTGGCCCCTGG - Intronic
1161597169 19:5156445-5156467 CAGAGCTGCCTCATGGGGCCAGG - Intergenic
1163360789 19:16844897-16844919 CAGGGCTGGCCCCTAGCACAGGG + Intronic
1164736706 19:30546377-30546399 CAGAGGTGGCCCTTAGGTCTAGG - Intronic
1166532607 19:43552150-43552172 CCGAGCTGGCCCAGAGGAGCTGG - Exonic
1167207307 19:48111303-48111325 CAGAGTTGGCCCTAAGGATCTGG - Intergenic
1167373464 19:49098584-49098606 CAGAGCTGTCCCACAGCCCCTGG - Intronic
926037472 2:9646701-9646723 CAGCACTGCCCCAGAGGACCAGG - Intergenic
926384055 2:12318380-12318402 CAGAGCTGGCCTATTGGAACAGG + Intergenic
927281871 2:21315851-21315873 CAGAGCTTGGCCAAAGGACAAGG - Intergenic
927844699 2:26465368-26465390 CAGAGCTGGCCCAGATCCCCAGG + Intronic
931990330 2:67783665-67783687 CAGGGGTGGCCCATAGGAGGTGG - Intergenic
932144415 2:69305794-69305816 CAGAGCTGTCCGAAAGGAGCTGG - Intergenic
933781862 2:85808016-85808038 CTGAGCTGGCACAGAGGTCCTGG + Intergenic
934319473 2:91959337-91959359 CAGAGCTGGCCTATTGAGCCTGG + Intergenic
935634551 2:105240062-105240084 CAGAGCAGGCTTAGAGGACCTGG - Intergenic
947139539 2:227008464-227008486 GAGGGCTGGCCCACAGGACCAGG - Intronic
948649740 2:239434227-239434249 CAGAGCTGGACCATAAGAACTGG + Intergenic
1172618795 20:36306683-36306705 CACAGCCGGCCCCTCGGACCCGG - Intronic
1172930219 20:38581186-38581208 CAGGGCTGCCCCATGGGACCTGG - Exonic
1173352528 20:42257953-42257975 GAGAGCTGGGACATAGGCCCTGG + Intronic
1175295700 20:57907459-57907481 AAAAGCTGGCCCATAGTCCCGGG + Intergenic
1175330143 20:58158049-58158071 CAGAGCAGGCCCAGGGGCCCTGG - Intronic
1175519115 20:59588409-59588431 CAGAGATGGCCCCAGGGACCAGG - Intronic
1181398019 22:22635003-22635025 CAGAGCTGGCCCCTTGTCCCGGG + Intergenic
1181672945 22:24434212-24434234 CAAGGCTGGCCCAGAGGATCTGG - Intronic
1182774034 22:32817881-32817903 GAGATCTGGCCCAGACGACCAGG - Intronic
1183309748 22:37103000-37103022 CAGACCCGAGCCATAGGACCTGG + Intronic
1183720002 22:39557264-39557286 CAGAGCAGGCACCTGGGACCCGG + Intergenic
1185082512 22:48717838-48717860 GGGTGCTGGCCCAGAGGACCTGG - Intronic
1185397764 22:50601265-50601287 CAGACCTGGCCGATAGGGCCCGG + Intronic
950904338 3:16524218-16524240 CTGAGCTGCCAAATAGGACCAGG + Intergenic
951961772 3:28333373-28333395 CAGAACTGGCCCACAGGTCCAGG + Intronic
952889646 3:38031410-38031432 CAGAGCTGGCACATGCAACCAGG + Intergenic
954428664 3:50457556-50457578 CACAGCTGGACCAGAGCACCTGG - Intronic
955419043 3:58718768-58718790 AAGAGCAGGCCAATTGGACCAGG - Intronic
957523738 3:81353526-81353548 CTGAGTTGACCCATAGGATCAGG - Intergenic
959497251 3:107065647-107065669 CAGAGCTGGCCCAGAGCAACTGG + Intergenic
960054052 3:113264159-113264181 CAGAGATGGCCCCAAAGACCAGG + Intronic
960140874 3:114150815-114150837 CAGTGCTGGCGCATAGGAGCAGG - Intronic
960934763 3:122891473-122891495 CAGGACTGGCCCAGAGGACAGGG + Intergenic
961465306 3:127077676-127077698 CAGAGCCAGCCCAGAGGCCCAGG + Intergenic
961494069 3:127277978-127278000 CAAAGCTGCCCTATAAGACCTGG + Intergenic
962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG + Intergenic
965733634 3:171798755-171798777 CAGAGCTGGGCCTTGGGACCTGG - Intronic
968619148 4:1595911-1595933 CAGTGATGGTCCACAGGACCGGG + Intergenic
969172592 4:5376114-5376136 CAGAGCACCCCCACAGGACCTGG - Intronic
972688977 4:41378163-41378185 CAGAGCTGGGACATAGCACATGG + Intronic
977309705 4:95370493-95370515 CACAGTTGGGCCTTAGGACCTGG + Intronic
985821488 5:2163698-2163720 CAGAGCTGGGTCACATGACCAGG + Intergenic
987101018 5:14591227-14591249 CAGAACTGGCCCACATGATCTGG + Intronic
989225330 5:39021326-39021348 CAGAGCTGGACCATGGGTACAGG - Intronic
990046144 5:51434201-51434223 CAGTGCTGGCTCCTAGGATCTGG - Intergenic
993968658 5:94389358-94389380 CAGAGCTGGCCCACAAGACATGG - Intronic
996283574 5:121762342-121762364 CAGATTTGGCCCATAGGCCGTGG - Intergenic
997436965 5:133882544-133882566 CAGAGCTGGGCCACAGGCCTGGG - Intergenic
997616173 5:135247633-135247655 GAGAGGTGGCCCAGAGGAGCAGG + Intronic
999126786 5:149251822-149251844 CTGAGCTTGCTCATAGGAGCTGG - Intronic
999262250 5:150245310-150245332 CAGAGCTGGCCCAGCGATCCTGG + Intronic
999697524 5:154199804-154199826 CAGAGCTGGGCCTGAGGATCAGG - Intronic
1001425505 5:171619554-171619576 CAGAACTGGCTCAAAGGACTGGG + Intergenic
1001528210 5:172444144-172444166 CACACCTGGCCCATAGGGTCAGG + Intronic
1002050046 5:176565497-176565519 CAGGGCTGGCCCATAGGAGCTGG - Intronic
1002096603 5:176834950-176834972 CATAGCTGGGCCAGAGGAGCTGG + Intronic
1002164548 5:177336330-177336352 CAGGGCTGGCACAGAGGCCCTGG + Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005893228 6:30156991-30157013 CAGAGCTGGGCCAGAGGATTCGG - Exonic
1007428022 6:41759726-41759748 CCGAGCTGGCTCCAAGGACCTGG - Intergenic
1007439125 6:41842703-41842725 CAGAGGTTGTCCATAAGACCTGG - Intronic
1007714887 6:43850300-43850322 CAGACCTGGCCCCTAGACCCTGG + Intergenic
1008550101 6:52620746-52620768 GGGAGCTGGACCATAGAACCAGG + Intergenic
1013367889 6:109448767-109448789 CAGAGCTAGCCCATCAGCCCAGG + Exonic
1014822955 6:126013621-126013643 CATATCTGGCCCATAGGCCGTGG - Intronic
1016893431 6:149030180-149030202 CAGTGCTGTCCCTTAGGACTTGG - Intronic
1019034816 6:169045546-169045568 CAGCACTGGCTCATAGCACCCGG + Intergenic
1019034823 6:169045597-169045619 CAGCACTGGCTCATAGTACCCGG + Intergenic
1022111519 7:27235377-27235399 GAGAGCGGGCGCATAGGGCCTGG + Intergenic
1022247909 7:28578485-28578507 CAGAGCTGGTCCTTTGGAACTGG + Intronic
1022525088 7:31031995-31032017 CAGTGCTGGGACATAGGAACTGG - Intergenic
1025914418 7:65854272-65854294 CACAGCTGGCCCACACAACCTGG - Intergenic
1027174163 7:75892853-75892875 CAGGGCTGGCTCAGAGGACGTGG + Intergenic
1028452828 7:91005064-91005086 CAGATCTGGCCCATAGCAGCAGG + Intronic
1029893074 7:103951966-103951988 CAAAGATGGCCCAGAGGGCCGGG - Intronic
1031055359 7:116987369-116987391 CACAGCAGGCCCAAAGGCCCAGG - Intronic
1033662114 7:143409186-143409208 CAGAGCTGGGTAATAGGGCCGGG + Intergenic
1035031857 7:155865988-155866010 CAGAGAGGGCCCAGAAGACCTGG + Intergenic
1035304181 7:157920009-157920031 CAGCGCTGTCCCATACAACCTGG + Intronic
1037938060 8:22928344-22928366 CGGAGCTGGCCCTTCGGAGCTGG - Intronic
1039117769 8:34111839-34111861 CAGAGCTGTCTCATTGCACCTGG + Intergenic
1039748785 8:40457598-40457620 CAGAGTTGTCCCATAGCAACTGG - Intergenic
1042784667 8:72535209-72535231 CAGAGCTGGAGCTTGGGACCAGG + Intergenic
1047516400 8:125558263-125558285 CAGAGCTGGACTATAAGCCCAGG - Intergenic
1047718707 8:127619394-127619416 GAGATCTGGCCCATGGGTCCTGG - Intergenic
1049070733 8:140353650-140353672 CAGACCTGGTCCATAGGCCACGG + Intronic
1049758218 8:144320227-144320249 CAGGGCTGGGCCAAAGGGCCAGG + Intronic
1050332373 9:4558266-4558288 CAGAGCTGGCCCCCAAGTCCAGG - Intronic
1053366008 9:37523024-37523046 CAGTGCTGGCAAATAGGACTTGG + Intronic
1057319022 9:93995158-93995180 CGGAGCTGGTCCATAGTTCCTGG + Intergenic
1059945153 9:119402067-119402089 CAGAGCTGGCACACAGGAGGTGG + Intergenic
1060939850 9:127536891-127536913 CAGGGCTGGCCCGCAGGTCCTGG + Intronic
1060996710 9:127878140-127878162 CAGAGCCTGCCCAGAGGCCCTGG + Intergenic
1062170754 9:135133444-135133466 GGGAGCTGACCCACAGGACCAGG + Intergenic
1186807527 X:13155060-13155082 CAGAGCTGGCCCACAGTCTCTGG + Intergenic
1192155712 X:68745017-68745039 CAGAGCTGGGACATGGAACCTGG - Intergenic
1197210452 X:123824065-123824087 TAGAGGTGGGACATAGGACCAGG + Intergenic
1199673724 X:150167069-150167091 CAGAGCTGGCGGCTAGGACCAGG - Intergenic
1200097510 X:153671117-153671139 CATAGCTGGCCCTCAGGATCTGG + Exonic