ID: 1118725042

View in Genome Browser
Species Human (GRCh38)
Location 14:68623038-68623060
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725042_1118725046 -7 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725042_1118725053 27 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725053 14:68623088-68623110 TTTTCTCATAAGAGGGTGAAGGG 0: 1
1: 1
2: 2
3: 18
4: 233
1118725042_1118725052 26 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725052 14:68623087-68623109 TTTTTCTCATAAGAGGGTGAAGG 0: 1
1: 0
2: 11
3: 25
4: 378
1118725042_1118725049 19 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725049 14:68623080-68623102 TACCTTCTTTTTCTCATAAGAGG 0: 1
1: 0
2: 2
3: 20
4: 345
1118725042_1118725050 20 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725050 14:68623081-68623103 ACCTTCTTTTTCTCATAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725042 Original CRISPR CCCTTGCCTCCCGTGAGCTT GGG (reversed) Intronic