ID: 1118725042

View in Genome Browser
Species Human (GRCh38)
Location 14:68623038-68623060
Sequence CCCTTGCCTCCCGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725042_1118725046 -7 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725042_1118725052 26 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725052 14:68623087-68623109 TTTTTCTCATAAGAGGGTGAAGG 0: 1
1: 0
2: 11
3: 25
4: 378
1118725042_1118725053 27 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725053 14:68623088-68623110 TTTTCTCATAAGAGGGTGAAGGG 0: 1
1: 1
2: 2
3: 18
4: 233
1118725042_1118725050 20 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725050 14:68623081-68623103 ACCTTCTTTTTCTCATAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 382
1118725042_1118725049 19 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725049 14:68623080-68623102 TACCTTCTTTTTCTCATAAGAGG 0: 1
1: 0
2: 2
3: 20
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725042 Original CRISPR CCCTTGCCTCCCGTGAGCTT GGG (reversed) Intronic
900420230 1:2553072-2553094 TCCTGACCTCCCGTGGGCTTGGG - Intergenic
901424285 1:9171558-9171580 CCCTTGTCTCTCTTTAGCTTTGG - Intergenic
901554340 1:10019656-10019678 CCCTTCCCTCCCAGGAGGTTGGG + Intergenic
902983271 1:20140262-20140284 AGCTTGTCTCCCGTGACCTTGGG + Intronic
904210943 1:28886885-28886907 CCCTTCCCTCCCCTGACCTCTGG + Intergenic
904575654 1:31503553-31503575 CCCTTCCCACCCTTGAGCTTCGG - Intergenic
910473398 1:87579274-87579296 CCCTTGCCTGCCCAGTGCTTTGG + Intergenic
922863718 1:228840911-228840933 CTCTTCCCTCCCCTGAGGTTAGG - Intergenic
1065696504 10:28385532-28385554 CCCTTGCCTTGCATGCGCTTAGG + Intergenic
1066336077 10:34479933-34479955 CCCTTGCCTCATGTGAGCAGAGG - Intronic
1070589928 10:77794439-77794461 CCGTTGCCTTCGCTGAGCTTCGG - Intronic
1070795130 10:79211819-79211841 CCTCTCCCTCCCGTGGGCTTAGG + Intronic
1072395522 10:95035896-95035918 CTCTTGCCTGCCATGACCTTAGG - Intergenic
1073381497 10:103081159-103081181 CCCATGCCACCAGGGAGCTTGGG - Exonic
1076204234 10:128582244-128582266 CCCTTCCCTCCGCTGTGCTTGGG - Intergenic
1079093138 11:17494548-17494570 CCCTGGCCTCCTGTGTGCTGTGG - Intronic
1079108606 11:17590543-17590565 CCCTTGACCGCCTTGAGCTTAGG + Intronic
1079182915 11:18209366-18209388 CCCCTGCCTCCCGGGAGACTGGG + Exonic
1082028252 11:47587869-47587891 CCCTTCCCAACCCTGAGCTTAGG - Intronic
1083105560 11:60355084-60355106 CCCTTGCCTCCACTGTGCTCTGG - Intronic
1083276640 11:61600630-61600652 CCCTTGCTTCCCCTGGGCCTCGG - Intergenic
1083831543 11:65236773-65236795 ATCCTGCCACCCGTGAGCTTTGG + Intergenic
1084168331 11:67387619-67387641 CCCTTGCCTTCACGGAGCTTCGG + Intronic
1085251384 11:75146146-75146168 CCCTTGCCTGGCGTGACCCTAGG - Intronic
1086451313 11:86919815-86919837 CCCTTGGCTCCCTTAAACTTGGG - Intronic
1087044326 11:93831504-93831526 CCCATACCTCCTGTGAGCTCAGG + Intronic
1089515585 11:119029759-119029781 CCCCTGCCTCCCCTGGGCTCAGG - Intronic
1090091883 11:123705260-123705282 CCCTTGACTTTAGTGAGCTTAGG - Intergenic
1096034730 12:48456570-48456592 TCCTCGCCTGCCGTGACCTTGGG + Intergenic
1101583865 12:106067440-106067462 CCTCTGCCTCTGGTGAGCTTGGG + Exonic
1104656831 12:130579837-130579859 CCCTTGCCTCCCTCGAGCTCTGG - Intronic
1106175336 13:27325486-27325508 CCCTTGCCTCGCATGGCCTTAGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1106403873 13:29456547-29456569 CCCTTGGCTCTGGTGTGCTTCGG - Intronic
1108715239 13:53072163-53072185 CCCTGGCCTTCTCTGAGCTTTGG + Intergenic
1111003593 13:82217695-82217717 CCCTCTCCTCCCTTTAGCTTGGG - Intergenic
1114524359 14:23359093-23359115 CCCTTGACTCCAGAGAGCTCTGG + Intronic
1115320665 14:32076844-32076866 CCCTCGTCTCCCGGGAGCCTGGG - Intronic
1117533909 14:56686373-56686395 CCCTTGTCTCCCGAGATCTCCGG - Intronic
1118725042 14:68623038-68623060 CCCTTGCCTCCCGTGAGCTTGGG - Intronic
1120022694 14:79548592-79548614 CCCTTTCCTTCCATGAGCTTAGG + Intronic
1124825019 15:33085035-33085057 CCCTTTCCTCTGGTGGGCTTTGG - Intronic
1127299612 15:57639838-57639860 CCCTTGGGTCCCCTGAGCTGTGG - Intronic
1128478364 15:68016504-68016526 CCCTTGGTTCCCGTGAGATCTGG + Intergenic
1129657350 15:77533145-77533167 CCCTTGCCGCCTCTGAGCCTTGG + Intergenic
1132249503 15:100324496-100324518 TCCTTGCCTCCAGAGAACTTAGG - Intronic
1133019623 16:2961624-2961646 CCCTTTCCTGCCGGGAGCTCTGG - Intergenic
1133332357 16:4982441-4982463 CCCTTGCCCTCCCTGAGCGTAGG + Intronic
1137551008 16:49437631-49437653 CCCTTCCCTCCCCAGAGCTTTGG + Intergenic
1138205401 16:55120678-55120700 CCCTTGCCTGCTCTGAGCTGAGG - Intergenic
1138226512 16:55300324-55300346 CACTTGCCCCCCCTGAGCCTTGG + Intergenic
1140655483 16:77135136-77135158 CCCTTGCCTCCCCAGAGCTCAGG - Intergenic
1141722275 16:85763140-85763162 TCCTGGCCCCCCGTGGGCTTTGG + Intergenic
1142118174 16:88371496-88371518 CCCTTCACTTCCCTGAGCTTTGG - Intergenic
1142144063 16:88485349-88485371 CCCTTACCTGCCGTGACCCTTGG - Intronic
1142780846 17:2180068-2180090 CCCTTGCATCCCAGGACCTTTGG - Intronic
1144870825 17:18369648-18369670 CCTTTGCTGCCCATGAGCTTTGG + Intergenic
1146320121 17:31840424-31840446 CCCATGCAGCCCTTGAGCTTTGG - Intergenic
1148778268 17:50108007-50108029 CCCCAGCCTCCCTTGAGCTGGGG - Intronic
1150886341 17:69090613-69090635 CCTTTGCCTCCACTAAGCTTTGG + Intronic
1156136435 18:34045198-34045220 CCACTGCCTGCCGTGAGCCTGGG + Intronic
1159902958 18:74065095-74065117 CCCTAGGTTCCCGTGAGCTATGG - Intergenic
1160696285 19:486168-486190 CCCTTCCTTCCTCTGAGCTTCGG - Intergenic
1167419779 19:49395982-49396004 TCCCTTCCTTCCGTGAGCTTTGG + Intronic
926070905 2:9889884-9889906 TGTTTGCCTTCCGTGAGCTTTGG + Intronic
926271883 2:11372837-11372859 CCCTTGCCATCCAAGAGCTTAGG + Intergenic
926742371 2:16123478-16123500 TCCTTGCCTCCCGTGGGATGTGG + Intergenic
927889423 2:26739005-26739027 CCCTCAGCTCCGGTGAGCTTAGG - Intergenic
929711311 2:44269688-44269710 CCCTTGCCTCCCCTCAGCCCAGG - Intergenic
930068675 2:47347757-47347779 CACTTGCCTGCCAGGAGCTTCGG + Intronic
933484200 2:82897175-82897197 CCCTTGCTTCCCTTGAGCTAAGG + Intergenic
933886247 2:86720913-86720935 CCCTTGCCTCCCCTGAGGCGCGG + Intronic
933923933 2:87075793-87075815 CCCTTGCCTCCCCTGAGGCGCGG - Intergenic
933983822 2:87574545-87574567 CACTTGCATCCCCTGAGCCTGGG - Intergenic
934537957 2:95152037-95152059 CACGTGCCTCCAGTGTGCTTGGG + Intronic
934707876 2:96497399-96497421 CCCTTGCCACCCTTGATTTTGGG - Intergenic
935902375 2:107806384-107806406 TCCTTGCCTCCCCTGAGTTTAGG + Intergenic
936310032 2:111376249-111376271 CACTTGCATCCCCTGAGCCTGGG + Intergenic
937220823 2:120342556-120342578 CCCTTGGCTCCCGTGGGCTGGGG + Intergenic
937366359 2:121264710-121264732 CCCCTGGTTCCCGTGCGCTTCGG + Intronic
938763325 2:134444178-134444200 CCCTTTCTTCCAGAGAGCTTTGG + Intronic
946606215 2:221408402-221408424 CCCTTGCCTCCCCTATGCTGTGG + Intergenic
946988395 2:225300756-225300778 CCCTTCCCTACCGTGAGATTAGG + Intergenic
948464135 2:238144195-238144217 CCCCAGCCTCCCGGGAGCTATGG - Intronic
1172977694 20:38919067-38919089 CCCTTGCTTCCCCTGAGCCCAGG - Exonic
1173614577 20:44394458-44394480 CCCTTGGCTCCTGGGAGCCTCGG + Intronic
1174642141 20:52053925-52053947 GCCTTGACTTCCCTGAGCTTAGG + Intronic
1175539427 20:59739057-59739079 CCTCTGCCTCCCGTGGCCTTGGG + Intronic
1179417569 21:41210431-41210453 CCCTTGCCTGGCGTGACCTGAGG - Intronic
1179570550 21:42276127-42276149 CTCCTGCCTCCCGTGGCCTTGGG - Intronic
1179957186 21:44748061-44748083 CCCTTGTCTGGCATGAGCTTAGG + Intergenic
1182424425 22:30264614-30264636 ACCTTGCCTGCAGTGATCTTGGG - Intronic
1183072241 22:35404479-35404501 CCCTTCCCCCCCGTGATTTTTGG + Intronic
1183646011 22:39127166-39127188 CTCTTGCCTCCCTTGGTCTTGGG + Intronic
1184323845 22:43766628-43766650 CCTCAGCCTCCCGAGAGCTTGGG + Intronic
1184504940 22:44894921-44894943 CCCTCCCCTCCCCTGGGCTTCGG + Intronic
951906825 3:27714796-27714818 CCCGCGCCACCCGTGACCTTGGG - Intergenic
953284116 3:41589495-41589517 CCCTGGCCTTCTGTGAGCTCTGG - Intronic
954095722 3:48326150-48326172 CCATTGCCCCCTGTAAGCTTAGG + Intronic
961150919 3:124637107-124637129 CCCTTCCCTGGCTTGAGCTTTGG + Intronic
961521313 3:127468844-127468866 CCCATGCCTCCCCTGAGCTCTGG - Intergenic
962234352 3:133694542-133694564 CCCTGGCCTCCCCAGAGCTTGGG + Intergenic
966677401 3:182604171-182604193 CCCTTACCTCCAGTGACTTTGGG - Intergenic
968640901 4:1713984-1714006 CCCTTGCCTGGCATGACCTTAGG - Intergenic
974351293 4:60750321-60750343 CCCTTGCCTGCCATGGTCTTAGG + Intergenic
982314523 4:154018773-154018795 CCTTTCCCTCCCCTGAGCTAGGG - Intergenic
985524762 5:396239-396261 CCCATGCCTCCCCTGAGGATGGG - Intronic
990147257 5:52776110-52776132 CCCTTGCCGCCTGGAAGCTTAGG + Intergenic
990877727 5:60505179-60505201 CCCTTGCCTTCATTGACCTTTGG - Intronic
991569492 5:68039536-68039558 CCCTTGCCTCTGATAAGCTTAGG - Intergenic
991622743 5:68562392-68562414 CCCTTTCCTGCCCTGAGGTTAGG - Intergenic
992781978 5:80136165-80136187 CCCCAGCCTCCCGAGGGCTTGGG - Intronic
997479731 5:134176430-134176452 CCCTTGGCTGTCGTGAGCGTGGG - Intronic
998353500 5:141516055-141516077 CTCATGCCTTCCCTGAGCTTTGG - Exonic
1001923868 5:175622092-175622114 CCCTTCCTTCCCCAGAGCTTGGG + Intergenic
1002058471 5:176612116-176612138 CCCTTGTCTGCCTTCAGCTTTGG - Intergenic
1004773415 6:18813009-18813031 CTCTTACCTCCCATCAGCTTAGG - Intergenic
1007330258 6:41101273-41101295 GCCTAGCCTCCCGCGAGCTAAGG + Intergenic
1011320057 6:86080917-86080939 CCCTTGCCTCACGGGATCCTTGG - Intergenic
1015924580 6:138296142-138296164 TCCTTGCCTACCCTGATCTTGGG - Intronic
1016418777 6:143861910-143861932 CTCTTCCCTCCAGTGAGTTTTGG - Intronic
1019274878 7:171046-171068 GCCTTGCCTCCCCTGGGCTGAGG + Intergenic
1022507476 7:30915864-30915886 CCCATCCCTCCCCTGAGCTCTGG - Intronic
1022896753 7:34757795-34757817 CCGATGCCTCCTCTGAGCTTTGG + Intronic
1024446661 7:49487826-49487848 CCCTTGCCTTGCATGATCTTAGG + Intergenic
1025279640 7:57617599-57617621 TCCTTGCCTCCATGGAGCTTAGG - Intergenic
1025305091 7:57847901-57847923 TCCTTGCCTCCATGGAGCTTAGG + Intergenic
1030341018 7:108380952-108380974 CCTTTGCCTCCTGAGAACTTGGG - Intronic
1032274825 7:130445250-130445272 CCCTTGCCTGCCTCCAGCTTAGG + Intergenic
1034610851 7:152366998-152367020 CCCTTGCCTCACCTGAGCCTGGG + Intronic
1035316982 7:158002582-158002604 CCCCTCCCTCCCTGGAGCTTAGG + Intronic
1036262747 8:7253382-7253404 CCCTTGCCTCCCTGGCTCTTAGG - Intergenic
1037330398 8:17738307-17738329 CCCGTGACTCCTGTGAGCTGAGG - Intronic
1039895089 8:41711497-41711519 CCCTTGCCTACTGTGGCCTTGGG - Intronic
1042184139 8:66120493-66120515 TCCTTGCCTCCCTGGAGGTTGGG - Intergenic
1047521875 8:125601249-125601271 CCCTTGCCTCCCATACTCTTTGG - Intergenic
1050169657 9:2802193-2802215 CCCTTCCTGCCCGTCAGCTTTGG - Intronic
1050744546 9:8859985-8860007 CCCTTGCCCCCTGTGACCTAAGG + Intronic
1051283531 9:15468661-15468683 CCCTTTCTTCCCTTGATCTTTGG + Exonic
1054857663 9:69918508-69918530 TCCATGCCTCTCTTGAGCTTTGG + Intergenic
1057382524 9:94581913-94581935 CCCTTGCCTGGCGTGGCCTTAGG - Intronic
1057476773 9:95409611-95409633 CCCTTACCAGCTGTGAGCTTAGG - Intergenic
1060220146 9:121760215-121760237 CCCTTGCCGCCCTTGGGGTTGGG - Exonic
1061058371 9:128237111-128237133 CCACTGCTTCCTGTGAGCTTGGG - Intronic
1185947006 X:4387979-4388001 CCCTTACCTGGTGTGAGCTTGGG + Intergenic
1194090633 X:89579545-89579567 CCCTTGCCTCCCATGGCCATTGG + Intergenic
1194899986 X:99498041-99498063 CCCTTGCCGCCCTTGAACTGTGG + Intergenic
1195614513 X:106901924-106901946 CCCTTGCCCACTCTGAGCTTTGG + Intronic
1200234810 X:154463158-154463180 CCCCTGCATCCCCTGACCTTGGG + Intronic
1200443285 Y:3235605-3235627 CCCTTGCCTCCCATGGCCATTGG + Intergenic