ID: 1118725046

View in Genome Browser
Species Human (GRCh38)
Location 14:68623054-68623076
Sequence GCAAGGGGAGAATAGCACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725044_1118725046 -8 Left 1118725044 14:68623039-68623061 CCAAGCTCACGGGAGGCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725034_1118725046 14 Left 1118725034 14:68623017-68623039 CCCAGATGTCCTAACCACAGACC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725035_1118725046 13 Left 1118725035 14:68623018-68623040 CCAGATGTCCTAACCACAGACCC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725039_1118725046 0 Left 1118725039 14:68623031-68623053 CCACAGACCCAAGCTCACGGGAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725042_1118725046 -7 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725033_1118725046 20 Left 1118725033 14:68623011-68623033 CCTGTGCCCAGATGTCCTAACCA 0: 1
1: 0
2: 3
3: 7
4: 160
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172
1118725036_1118725046 5 Left 1118725036 14:68623026-68623048 CCTAACCACAGACCCAAGCTCAC 0: 1
1: 0
2: 3
3: 18
4: 223
Right 1118725046 14:68623054-68623076 GCAAGGGGAGAATAGCACCACGG 0: 1
1: 0
2: 1
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725046 Original CRISPR GCAAGGGGAGAATAGCACCA CGG Intronic