ID: 1118725050

View in Genome Browser
Species Human (GRCh38)
Location 14:68623081-68623103
Sequence ACCTTCTTTTTCTCATAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725042_1118725050 20 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725050 14:68623081-68623103 ACCTTCTTTTTCTCATAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 382
1118725039_1118725050 27 Left 1118725039 14:68623031-68623053 CCACAGACCCAAGCTCACGGGAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1118725050 14:68623081-68623103 ACCTTCTTTTTCTCATAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 382
1118725044_1118725050 19 Left 1118725044 14:68623039-68623061 CCAAGCTCACGGGAGGCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1118725050 14:68623081-68623103 ACCTTCTTTTTCTCATAAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725050 Original CRISPR ACCTTCTTTTTCTCATAAGA GGG Intronic