ID: 1118725052

View in Genome Browser
Species Human (GRCh38)
Location 14:68623087-68623109
Sequence TTTTTCTCATAAGAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 11, 3: 25, 4: 378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725047_1118725052 -7 Left 1118725047 14:68623071-68623093 CCACGGACCTACCTTCTTTTTCT 0: 1
1: 0
2: 1
3: 32
4: 324
Right 1118725052 14:68623087-68623109 TTTTTCTCATAAGAGGGTGAAGG 0: 1
1: 0
2: 11
3: 25
4: 378
1118725044_1118725052 25 Left 1118725044 14:68623039-68623061 CCAAGCTCACGGGAGGCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1118725052 14:68623087-68623109 TTTTTCTCATAAGAGGGTGAAGG 0: 1
1: 0
2: 11
3: 25
4: 378
1118725042_1118725052 26 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725052 14:68623087-68623109 TTTTTCTCATAAGAGGGTGAAGG 0: 1
1: 0
2: 11
3: 25
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725052 Original CRISPR TTTTTCTCATAAGAGGGTGA AGG Intronic