ID: 1118725053

View in Genome Browser
Species Human (GRCh38)
Location 14:68623088-68623110
Sequence TTTTCTCATAAGAGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725044_1118725053 26 Left 1118725044 14:68623039-68623061 CCAAGCTCACGGGAGGCAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1118725053 14:68623088-68623110 TTTTCTCATAAGAGGGTGAAGGG 0: 1
1: 1
2: 2
3: 18
4: 233
1118725042_1118725053 27 Left 1118725042 14:68623038-68623060 CCCAAGCTCACGGGAGGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1118725053 14:68623088-68623110 TTTTCTCATAAGAGGGTGAAGGG 0: 1
1: 1
2: 2
3: 18
4: 233
1118725047_1118725053 -6 Left 1118725047 14:68623071-68623093 CCACGGACCTACCTTCTTTTTCT 0: 1
1: 0
2: 1
3: 32
4: 324
Right 1118725053 14:68623088-68623110 TTTTCTCATAAGAGGGTGAAGGG 0: 1
1: 1
2: 2
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725053 Original CRISPR TTTTCTCATAAGAGGGTGAA GGG Intronic