ID: 1118725670

View in Genome Browser
Species Human (GRCh38)
Location 14:68627387-68627409
Sequence GTGTGTCCACAGTTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118725665_1118725670 26 Left 1118725665 14:68627338-68627360 CCAGGTTATTCAGCTATGAAGGA 0: 1
1: 0
2: 2
3: 10
4: 109
Right 1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 166
1118725666_1118725670 -6 Left 1118725666 14:68627370-68627392 CCATAAATTCCTCAGATGTGTGT 0: 1
1: 0
2: 1
3: 19
4: 227
Right 1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 166
1118725663_1118725670 29 Left 1118725663 14:68627335-68627357 CCACCAGGTTATTCAGCTATGAA 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118725670 Original CRISPR GTGTGTCCACAGTTGGAGCA GGG Intronic
900141417 1:1140741-1140763 GAGAGTCCACAGGTGGAGAACGG + Intergenic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
902066222 1:13690409-13690431 TTGTGTACTCAGTTGGAGTATGG - Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
904968848 1:34403074-34403096 GTGTGCCCAGAGGTGGAACATGG - Intergenic
905802599 1:40854778-40854800 GTGTGGCCAGGGATGGAGCAGGG + Intergenic
907762555 1:57375699-57375721 GTGTGCCCAGAGTTAGGGCAGGG - Intronic
907935591 1:59039236-59039258 GAATGACCACAGTTTGAGCAGGG - Intergenic
910106764 1:83639632-83639654 GTGTGTTCACTGTTGGAGATAGG + Intergenic
911372872 1:97015029-97015051 GTGTGGCCACATTTGGAGATGGG - Intergenic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
921179252 1:212618839-212618861 GCCTGTCCACATTTGGAGGAGGG - Intronic
921710938 1:218372389-218372411 ATGTGTTCACAGTGGCAGCAGGG + Intronic
923306973 1:232697341-232697363 GTGTGTCCACAGCTGAAGTACGG + Intergenic
923874261 1:238030276-238030298 GGGTGTCCACAGTGGCAACAAGG - Intergenic
924917762 1:248591624-248591646 GTGTTTCCAAGGTTGGAGTATGG + Intergenic
1064735265 10:18375745-18375767 CTGTGTCTACAGTTGAAGGATGG + Intronic
1065328008 10:24567708-24567730 GGGTCTCCACACTTGGAACATGG + Intergenic
1067095020 10:43294538-43294560 GTGTGTCCACAGGAGGAGCTGGG - Intergenic
1068286251 10:54939796-54939818 TTGTGTCCTCAGATGGTGCAAGG + Intronic
1070786045 10:79162803-79162825 GTGGGTCCTCAGGGGGAGCAGGG - Intronic
1071443555 10:85725703-85725725 GTGTTTCCTCAGTTTGAGCTTGG - Intronic
1072063688 10:91843324-91843346 GTGTGTCCTCCATTGGAACATGG + Intronic
1072563812 10:96600883-96600905 GTGTGTCCACAGATGCAGAAAGG - Intronic
1073963554 10:108962066-108962088 GTGTCTCTACAGTTGTAGCAAGG - Intergenic
1075177549 10:120179760-120179782 GTGAGTCCACAGAAAGAGCAAGG + Intergenic
1076579013 10:131494500-131494522 GTGTGCCCAGTGTTGGAGCAGGG + Intergenic
1079467464 11:20744787-20744809 TTCTGTCCACAGTGGGAGTAGGG + Intronic
1082225571 11:49702879-49702901 GTGTTGCCAGAGTTGGAGGAGGG + Intergenic
1085689361 11:78652911-78652933 GTGTGCCCAGTGGTGGAGCAAGG + Exonic
1088006562 11:104948148-104948170 GGGTATCCACAGTTCTAGCAGGG + Intronic
1089677496 11:120099566-120099588 GTGGGCACACGGTTGGAGCAGGG + Intergenic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1092131308 12:6114997-6115019 GTCAGTCCACAGCCGGAGCAGGG + Intronic
1096115883 12:49054741-49054763 GTGTGTCCACAGTGGGGGTCCGG - Exonic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1097477985 12:60083266-60083288 GGGTGTCCACAGTGGTGGCAAGG + Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1102035555 12:109768829-109768851 GCGTGCCTACAGTGGGAGCACGG + Exonic
1103975952 12:124702811-124702833 GGGTGTCCAAAATTGGAGGAGGG + Intergenic
1107300799 13:38963881-38963903 CTGTGTCCTCAGTTGGTGGAAGG - Intergenic
1110048228 13:70859036-70859058 GTTTGTCCTCAGTTAGAGGAAGG - Intergenic
1110359929 13:74613087-74613109 CTGGGTCTACAGTTGGTGCACGG + Intergenic
1110454805 13:75679533-75679555 GTGTGTCCAGGGTAGGAGCCAGG - Intronic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1113461470 13:110485165-110485187 GTGTGTCCATAGCTGGCGCAGGG + Intronic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114677967 14:24458177-24458199 GTGTGTCTACTGCTGGACCAGGG + Intergenic
1118305432 14:64651186-64651208 ATGTGTCCACAGGTTGGGCAGGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1120964968 14:90158905-90158927 GTGGGTCCCCAGTTGGAAGAGGG + Intronic
1121821724 14:96974039-96974061 GTGTGGCCATATTTGGAGTAAGG + Intergenic
1125539309 15:40460598-40460620 GTGTCTCAACAGCCGGAGCATGG - Intronic
1132032179 15:98447171-98447193 GTGTGACCACATTTGGAGATAGG - Intronic
1132615510 16:839532-839554 GTGGGTCCACACTGGGGGCAGGG - Intergenic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1133416791 16:5613126-5613148 GAGGGGCCTCAGTTGGAGCAGGG + Intergenic
1133657797 16:7883189-7883211 TTGTGCCCAAAGTCGGAGCATGG - Intergenic
1138267760 16:55672045-55672067 GTGTGGCCACAGTCGGTCCAGGG - Exonic
1138280460 16:55768948-55768970 GTGAGTCCACTGTTAGGGCAGGG - Intergenic
1138288024 16:55824675-55824697 GTGAGTCCACTGTTAGGGCAGGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1140217375 16:73019439-73019461 GTGTGTTCACACTTGGTGGAAGG - Intronic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1149978624 17:61291242-61291264 GTTTCTCCAGAGTTGGAGCCTGG - Intronic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1152702344 17:81825337-81825359 GTGTGTCCTCAGCTGGAGTGGGG - Exonic
1155178576 18:23323508-23323530 GTGTGACCAGACTTGGAGCCAGG - Intronic
1157439982 18:47703291-47703313 GTGTGTGCACAGGTGCACCAGGG + Intergenic
1157929740 18:51808572-51808594 GTGTGGCCACAATGGAAGCAGGG - Intergenic
1158300967 18:56052416-56052438 TGGTGTCCACAGTTGGACCAAGG + Intergenic
1160002868 18:75043825-75043847 ATATGTCCTCAGTTGGACCATGG - Intronic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1164712795 19:30369957-30369979 TTGTGTCCACAGTGGGGGGATGG + Intronic
1168431310 19:56283198-56283220 GTGTGTGTGCAGTGGGAGCAGGG - Intronic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
927895850 2:26781339-26781361 ATGTGGCCAGAGTAGGAGCAAGG + Intronic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
930171123 2:48252687-48252709 GTGTGACCGGAGTTGCAGCAGGG + Intergenic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
936427764 2:112434878-112434900 GTGTGCCCCCAGTGGGAGCTTGG - Intergenic
937290299 2:120777907-120777929 GTGTGGTCAGAGTGGGAGCACGG + Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938072640 2:128316713-128316735 GTGTGTGTACAGTTGGGGGAGGG + Intronic
943635443 2:190301800-190301822 GTGTGTCCACACATGGCACAAGG + Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
944905135 2:204254867-204254889 GTGGGTCTTCAGTTTGAGCAAGG + Intergenic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
1170142041 20:13134015-13134037 GTGTGTTCACAGTTTGAGCGTGG - Intronic
1172005368 20:31815848-31815870 GTGTCTGCACAGCTGGTGCAGGG + Intergenic
1176374480 21:6080333-6080355 GTGTGCCCCCAGTGGGAGCTTGG + Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1179748995 21:43457912-43457934 GTGTGCCCCCAGTGGGAGCTTGG - Intergenic
1179790531 21:43753676-43753698 GTGTGTCCACGCCAGGAGCATGG - Exonic
1180162644 21:46005247-46005269 CTCTGTCCACAGGTGCAGCATGG - Intergenic
1180226053 21:46393158-46393180 GTGTGTCCACAGGGGGAGTGCGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184397022 22:44248380-44248402 GTGTGTCTACACTGGCAGCATGG + Exonic
1184489860 22:44802317-44802339 GGGTGTCCACAGTTGGCCCTCGG - Intronic
1184773697 22:46612768-46612790 GTTTGTCTACAGCTGGGGCAAGG + Intronic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
950650201 3:14402502-14402524 GTGTGTCCGCACTTGGGGCGGGG + Intergenic
951389075 3:22080835-22080857 CTGTGTCCTCACGTGGAGCAAGG - Intronic
951707065 3:25554069-25554091 GTGTGTCTACCTCTGGAGCAGGG + Intronic
956411338 3:68983070-68983092 GTGTGTTCACAGGTGGGGCCTGG - Intronic
960004306 3:112766438-112766460 GTGTGTCCTCACATGGAGGAAGG - Intronic
965404629 3:168254021-168254043 GTTTGTCCTCAGGTGGTGCAAGG + Intergenic
968433367 4:572450-572472 GTGTGTCCACAGTGATAGGACGG + Intergenic
968592454 4:1465846-1465868 GGGTGCCCACAGTTAGAGGATGG - Intergenic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
971176060 4:24283781-24283803 GTGTGTACAGAGCTGAAGCAAGG - Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
978631208 4:110747488-110747510 GGGTGTTCACAGTTGGAGAATGG + Intergenic
978835279 4:113142011-113142033 GTTTGACCACACTTAGAGCAGGG - Intronic
981173878 4:141658054-141658076 GTGTCTCCATTGTTGGAGGAGGG + Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
984191743 4:176613925-176613947 GTGTGTCCACCATTGGACAATGG + Intergenic
985553381 5:544321-544343 GTGGGTTCACAGGTGGAGCCTGG + Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
986201888 5:5586652-5586674 GTGTGTCCTCACATGGAGGAAGG + Intergenic
986315035 5:6581545-6581567 GTATGTTGACAGTTGGAGAAGGG + Intergenic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
1002867309 6:1132854-1132876 GGGAGTCCACACTTGGAGGAAGG + Intergenic
1003537024 6:6984429-6984451 ATCTGTCCGCAGTTGGATCATGG - Intergenic
1003833461 6:10040817-10040839 CTGTGTCCTCACTTGGTGCAAGG + Intronic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1010427753 6:75745968-75745990 TTGAGTCCAGAGTTTGAGCATGG - Intergenic
1016523164 6:144969545-144969567 GAGTGTGCACAGTTGAAGCTGGG - Intergenic
1016536841 6:145116508-145116530 TAGAGTTCACAGTTGGAGCAGGG - Intergenic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1018191771 6:161315236-161315258 GTGAGTGCACACTTGGACCAGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019544509 7:1567056-1567078 GTCTGTCCCCAGCTGCAGCACGG + Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1019781944 7:2945711-2945733 GTGTGTCCTCAGTAGTGGCATGG - Intronic
1023007932 7:35894280-35894302 GTGTGCCCCAACTTGGAGCAAGG - Intronic
1023015212 7:35961838-35961860 GTGTGCCCCAACTTGGAGCAAGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023674620 7:42616855-42616877 GTGGGGCCACAGGTGAAGCAGGG + Intergenic
1024065735 7:45732854-45732876 GTGTGCCCCAACTTGGAGCAAGG + Intergenic
1027769116 7:82384248-82384270 GTGTGTCCGTATTTGGAGAAGGG + Intronic
1031125222 7:117765698-117765720 ATGTGTCCTCAGTTGGACCAGGG - Intronic
1035635263 8:1139463-1139485 ATGTGTCCTCACGTGGAGCAAGG + Intergenic
1035922614 8:3694186-3694208 ATGTGTCCATAGATGGGGCAGGG + Intronic
1037579945 8:20239137-20239159 TTCTGTCCACAGCTGTAGCAAGG + Intergenic
1038218824 8:25588233-25588255 GTGTGTGCACACTTGCATCAGGG + Intergenic
1040569390 8:48594365-48594387 GTGTGTCCACACCAGGAACACGG - Intergenic
1041480853 8:58318403-58318425 GTGTGTCCACGGGTGCAGAAGGG + Intergenic
1042229473 8:66541883-66541905 GTGCGGCTACAGCTGGAGCATGG + Intergenic
1042940464 8:74101938-74101960 GTGGCCCCACAGTGGGAGCATGG + Intergenic
1043221632 8:77673196-77673218 GTGTGTCCATAGGTGGAGGGAGG - Intergenic
1045375082 8:101564431-101564453 ATGTGTGCACAGTGGTAGCAGGG + Intronic
1047712938 8:127570011-127570033 CTGTCTCCACACTTGGAGGAGGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049731070 8:144178829-144178851 GTGTGTCCCCAGTTGAGGCAAGG + Intronic
1050248249 9:3714229-3714251 GTGTGTCCAGAGATGCAGCCTGG - Intergenic
1056019195 9:82423855-82423877 GTTTGTACACAGTTGAATCAGGG + Intergenic
1056145063 9:83720952-83720974 GTCTGTGCATAGTGGGAGCATGG + Intergenic
1058147525 9:101428513-101428535 TTGTATCCACAGTTAGACCAAGG - Exonic
1058207290 9:102124642-102124664 GTTTGTCCCCATTTGCAGCAGGG - Intergenic
1058383321 9:104404016-104404038 GTGTGTCCACCATTGGGGAAGGG - Intergenic
1058783041 9:108358266-108358288 GTGTCTCCACTGCTTGAGCATGG + Intergenic
1059058963 9:111014923-111014945 ATGTGACCACATTTGGAGCCAGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1062710299 9:137971763-137971785 GTGTGTCCAGAGCTGGAGGGTGG + Intronic
1187928167 X:24269486-24269508 GTGAGACCACAGTTTGAGAAAGG - Intergenic
1192538978 X:71952351-71952373 GAGTGTTTACAGTTGGAGAAGGG + Intergenic
1200119680 X:153784428-153784450 GTGCCTCCACCCTTGGAGCAGGG - Intronic
1200301908 X:154984877-154984899 GTGTGAGCACACTGGGAGCAGGG - Intronic