ID: 1118726103

View in Genome Browser
Species Human (GRCh38)
Location 14:68630146-68630168
Sequence GGCAAACTCGGCATTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118726103_1118726109 26 Left 1118726103 14:68630146-68630168 CCCCTAGGAATGCCGAGTTTGCC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1118726109 14:68630195-68630217 GTAAGTCACGTTCCATTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 66
1118726103_1118726110 27 Left 1118726103 14:68630146-68630168 CCCCTAGGAATGCCGAGTTTGCC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1118726110 14:68630196-68630218 TAAGTCACGTTCCATTGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118726103 Original CRISPR GGCAAACTCGGCATTCCTAG GGG (reversed) Intronic
910047988 1:82940500-82940522 GGCAAAGTCTGCATTCTGAGTGG - Intergenic
1067793174 10:49302735-49302757 GGCATACTCAGCTTTCCTAAGGG - Intronic
1086343651 11:85872783-85872805 GGTAAACTAGGCATGCCTATTGG - Intronic
1095050989 12:37554279-37554301 GGCACACTAAGCATTCATAGGGG - Intergenic
1107063701 13:36188925-36188947 GGCCAACTCTGCACTCCAAGAGG + Intronic
1114675903 14:24440278-24440300 GGCAAACTCAGCATTAGTGGCGG + Exonic
1118726103 14:68630146-68630168 GGCAAACTCGGCATTCCTAGGGG - Intronic
1122896194 14:104758324-104758346 GGCAAACTCTGCAAACCAAGTGG + Intronic
1131034082 15:89209828-89209850 GGCAAACGCAGCAGTCCTGGTGG - Intergenic
1133557291 16:6917720-6917742 GGGAACCTCGGCATTCCAAGTGG + Intronic
1141207950 16:81948369-81948391 GGCAAACTGGCCATTTCTGGAGG + Intronic
1142348241 16:89567933-89567955 CGCAAACTCAGCATTGATAGTGG + Intergenic
1145371605 17:22311106-22311128 GGCACACTAAGCATTCATAGAGG - Intergenic
1146920569 17:36707388-36707410 TGCAAAGTCTGCATTCCAAGTGG + Intergenic
1149452680 17:56762147-56762169 GGAAAACTCAGCATACCTAGTGG - Intergenic
1152686225 17:81695076-81695098 GCCACTCCCGGCATTCCTAGTGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165573059 19:36791664-36791686 GGCACACTAGGCCTTCATAGAGG + Intergenic
1165632381 19:37312672-37312694 GGCACACTAGGCCTTCATAGGGG + Intergenic
928290474 2:30032770-30032792 GGCAGATTGGGCATTCCTATTGG - Intergenic
947008188 2:225536416-225536438 TTCAAACTAGGCATTGCTAGTGG + Intronic
1171545520 20:25997733-25997755 GGCACACTAAGCATTCATAGGGG - Intergenic
1177965437 21:27720818-27720840 GGCAAAGTCTTCATTCATAGAGG - Intergenic
1179532369 21:42028688-42028710 TACAAACTCTGCATTCCTTGTGG + Intergenic
1179532520 21:42029635-42029657 GGCAAACTCTCCTTTCCTTGTGG + Intergenic
1180042890 21:45288806-45288828 GGCAAACCCGGCCTTCTGAGGGG + Intergenic
952626814 3:35415753-35415775 TACAAACTCTGCATGCCTAGAGG + Intergenic
965727556 3:171734914-171734936 GGCAAACTGGGCATCTCTCGAGG + Exonic
978311270 4:107387075-107387097 AGAAAACTTGGCATTCCTGGGGG + Intergenic
985088209 4:186336925-186336947 GGCAAACTGGACATGCGTAGGGG - Intergenic
986849494 5:11794615-11794637 TGAAAACTCAGCATTCCTTGTGG - Intronic
1003852614 6:10240656-10240678 GGCAAACCATGCCTTCCTAGAGG - Intergenic
1016454389 6:144215920-144215942 GGCAAAGTCGCCCTTCCTGGTGG - Intergenic
1025296927 7:57782791-57782813 GGCACACTAAGCATTCATAGGGG - Intergenic
1026623362 7:71970950-71970972 GGTTCACTCGGCATTCCCAGCGG + Intronic
1036884783 8:12543899-12543921 GGCAAACACGGGAAACCTAGGGG + Intergenic
1043130135 8:76449516-76449538 GGCAAACTATGAATTCTTAGTGG - Intergenic
1046601345 8:116320536-116320558 GGCATAATGGGCATTGCTAGTGG - Intergenic
1061069179 9:128298310-128298332 TGCAAAGTCAGGATTCCTAGAGG - Intergenic
1061786727 9:133033491-133033513 GGAAAATTTGGCATTCCTTGGGG - Intronic
1062052565 9:134455189-134455211 AGCAAACTGGGCATCTCTAGAGG - Intergenic
1189905692 X:45756928-45756950 GGCAAAATCAGCATTTCTTGGGG - Intergenic
1194236751 X:91394191-91394213 GGCAAAGTCCCCATTTCTAGTGG + Intergenic