ID: 1118728088

View in Genome Browser
Species Human (GRCh38)
Location 14:68644595-68644617
Sequence CTTTAGGCAGAGATTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118728088_1118728092 2 Left 1118728088 14:68644595-68644617 CCTTCCTGAATCTCTGCCTAAAG 0: 1
1: 0
2: 2
3: 25
4: 217
Right 1118728092 14:68644620-68644642 CAGGAATATGTGAGAAGAAGTGG 0: 1
1: 0
2: 3
3: 37
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118728088 Original CRISPR CTTTAGGCAGAGATTCAGGA AGG (reversed) Intronic