ID: 1118728088

View in Genome Browser
Species Human (GRCh38)
Location 14:68644595-68644617
Sequence CTTTAGGCAGAGATTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118728088_1118728092 2 Left 1118728088 14:68644595-68644617 CCTTCCTGAATCTCTGCCTAAAG 0: 1
1: 0
2: 2
3: 25
4: 217
Right 1118728092 14:68644620-68644642 CAGGAATATGTGAGAAGAAGTGG 0: 1
1: 0
2: 3
3: 37
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118728088 Original CRISPR CTTTAGGCAGAGATTCAGGA AGG (reversed) Intronic
900594530 1:3474700-3474722 CTTGAGGCAGAGCGTCTGGATGG - Exonic
901596316 1:10388229-10388251 CTTTAGTCTGAGATTTAGCAAGG - Intergenic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
904448221 1:30592283-30592305 ATTTTGGAAGAGATTGAGGAGGG - Intergenic
905969635 1:42131731-42131753 CTTCAGGCAGGGAAACAGGATGG + Intergenic
907639621 1:56174283-56174305 CATTCGGTAGAGATTCAAGAAGG - Intergenic
908549067 1:65191319-65191341 CTTTAGGCAGAAATCCAGAATGG - Intronic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911724133 1:101223908-101223930 CTTTGGGAAGTGATTGAGGATGG + Intergenic
911924046 1:103804290-103804312 ATTTAGTCAGAGATTCAAGAAGG + Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912781921 1:112558753-112558775 CTTTGGGCCTATATTCAGGAGGG + Intronic
915579977 1:156807758-156807780 CTATAGGCAGAGATACTGGCGGG + Intronic
916736073 1:167608079-167608101 CTTTAGGCAGTGCTCCAGGGGGG - Intergenic
918502785 1:185217037-185217059 CGTTAGCAAGAGATTCATGAAGG + Intronic
919264851 1:195250181-195250203 CTACAGGCAGACATTCAGGAAGG + Intergenic
920425233 1:205869699-205869721 CTTTCTGGAGAGACTCAGGAAGG - Intergenic
922568381 1:226616974-226616996 CTTTGGTCAGGGATTCAAGAAGG - Intergenic
922788797 1:228298245-228298267 CTTTGAGAAGAGATCCAGGATGG + Intronic
922875059 1:228934038-228934060 CAGTAGGCTGGGATTCAGGAAGG - Intergenic
923152298 1:231244259-231244281 CTGTAGGAAGAGAATCAGGTTGG + Intronic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1065231442 10:23602666-23602688 CTTTAGGCAGAAATTCAACAGGG + Intergenic
1068963193 10:62886108-62886130 AGTTAGGCAGTGAGTCAGGAGGG + Intronic
1069372535 10:67763249-67763271 ATTTTGGCAGAGCTACAGGAGGG - Intergenic
1069851647 10:71409241-71409263 GTTTAGCCAGAGCTTCATGACGG - Intronic
1070545914 10:77452299-77452321 TTTGAGGCGGAGATTCAGGTGGG + Intronic
1072754401 10:98008937-98008959 CTTTAACCAGAGATTCTGGCAGG + Intronic
1073448625 10:103596010-103596032 ATTTAGCCAGAAACTCAGGAAGG + Exonic
1073462038 10:103671422-103671444 CTTTACGGAGAGATACGGGAAGG - Intronic
1075439707 10:122470123-122470145 CAGTAGGCAGAAAATCAGGAAGG - Intronic
1075794578 10:125109996-125110018 GTTCAGGCAGAGATTCAGCTTGG + Intronic
1075939802 10:126381308-126381330 CTTATGGCAGGGTTTCAGGAGGG - Intronic
1075946116 10:126434642-126434664 CTTTAGTAGGAGATTCAGGAAGG - Intronic
1076479700 10:130777067-130777089 ATTTAGGGAGAGAATAAGGAAGG + Intergenic
1077375859 11:2204864-2204886 CTTTAGGCAGCGGGACAGGATGG - Intergenic
1078154905 11:8791035-8791057 CTTTGGGAACAGATTCAGGAAGG - Intronic
1078504298 11:11920177-11920199 ATTCAGCCAGAGATTCTGGATGG + Exonic
1079543538 11:21605169-21605191 CTTTATGCAGGGATTTATGAAGG + Intergenic
1080191373 11:29553145-29553167 CCTCAGGCAGAGTCTCAGGAAGG - Intergenic
1080195831 11:29607650-29607672 ATTTAGACTGAGTTTCAGGAAGG + Intergenic
1080768160 11:35316148-35316170 ATTTAGGCAGAGATGCTGGCAGG + Intronic
1081691989 11:45084956-45084978 CTTTGGGGAGAGAATCAGAAAGG + Intergenic
1081717398 11:45260116-45260138 CTGGATGCAGAGATTCAAGAGGG - Intronic
1082738632 11:56885339-56885361 CTCAAAGCAGACATTCAGGAAGG - Intergenic
1084403174 11:68956449-68956471 CTTTAAGCAGACATAGAGGAGGG - Intergenic
1084487409 11:69456946-69456968 CTTTTGGCTGAGATTCAGCTGGG - Intergenic
1087472940 11:98600717-98600739 CTTCAGGGAGAGACTCAGGATGG - Intergenic
1088715245 11:112543337-112543359 CTTAAATCAGAGAGTCAGGAAGG - Intergenic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1092686291 12:11050800-11050822 CTTTACACAGAGATTTAAGACGG + Intronic
1092688523 12:11079289-11079311 CTTTACGCAGAGATTTAAGACGG + Intronic
1092691947 12:11122149-11122171 CTTTACACAGAGATTTAAGATGG + Intronic
1093356033 12:18168530-18168552 CTTTAGACACATATTCATGATGG - Intronic
1094317065 12:29146484-29146506 CTTTAGGCAGACAGTAAGGAAGG - Intergenic
1095238250 12:39824862-39824884 CTTCAGGCAGAGATCAAGGAGGG + Intronic
1096283191 12:50274731-50274753 CTTTAGGCAGTGATCAGGGAAGG + Intronic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1097971278 12:65635719-65635741 CTTAAGGCATAGAGTTAGGATGG + Intergenic
1098581240 12:72102017-72102039 CTTTAAGCAAAGATTCAGACAGG - Intronic
1098725113 12:73954646-73954668 CTTTATGAAGAGTTTGAGGAAGG - Intergenic
1099132516 12:78853388-78853410 CTCCAGGCAGAATTTCAGGATGG - Intergenic
1100250634 12:92819369-92819391 CTTTATGCAAAAATTCAGGCTGG - Exonic
1100897852 12:99204692-99204714 CTAAAGGCAGAGATGCTGGAAGG + Intronic
1101593331 12:106141140-106141162 CTTTACACAGAGACTCAGGCTGG - Intergenic
1101616693 12:106344881-106344903 ATTGAGGCAGTGATGCAGGAAGG + Intronic
1102765316 12:115427888-115427910 CTTTAGGCCCAGATCAAGGAGGG + Intergenic
1103139416 12:118535648-118535670 GTTTAGGGAGGGATTCAGTAGGG - Intergenic
1103262971 12:119604713-119604735 CTTGAGCCAGAGATTGAGGCTGG - Intronic
1107186960 13:37534451-37534473 GTATGGGCTGAGATTCAGGAAGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1110853533 13:80272581-80272603 CATTAGGCAGAAAATCAGTAAGG - Intergenic
1111202465 13:84957673-84957695 CTTAAAGCAGAGATTCAGAAAGG - Intergenic
1111808971 13:93074063-93074085 ATTTTGACACAGATTCAGGAGGG - Intergenic
1111830116 13:93318504-93318526 CCTTAGTGAGATATTCAGGAGGG - Intronic
1112746099 13:102528858-102528880 CTTTGGGCAGAGATGTGGGAAGG - Intergenic
1113291903 13:108916368-108916390 ATTTAGGCATAAATTCAGCAGGG - Intronic
1113365653 13:109673284-109673306 CTTTAGGCTGAAATTCAAGTTGG - Intergenic
1113420748 13:110169996-110170018 CTTGAGACAGAAATTGAGGAAGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118632372 14:67717564-67717586 CTTTAGGCCTACATTCTGGAGGG + Intronic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119802015 14:77454131-77454153 CTTTAGGGAGAGACCCAGAAAGG - Intronic
1119990176 14:79187906-79187928 CATAAAGCAGAGATTCAGAAGGG + Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1124463684 15:29917415-29917437 TTTTTGGCAGGGGTTCAGGAGGG - Intronic
1126730721 15:51679852-51679874 CAATTGGGAGAGATTCAGGATGG - Intergenic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128680429 15:69647570-69647592 CGTTAGGGAGAGGTTTAGGAAGG + Intergenic
1129786713 15:78314553-78314575 CTGGAGGTAGAGATTCAGAAGGG + Intergenic
1132076773 15:98828062-98828084 CTTTAGGGAGAGATTCCCGCTGG + Intronic
1134754648 16:16655931-16655953 ATTTAGGCAGAGACTCAGCTGGG - Intergenic
1134991413 16:18703111-18703133 ATTTAGGCAGAGACTCAGCTGGG + Intergenic
1135995147 16:27242218-27242240 CTTTAGATTGAGATTCATGAGGG - Intronic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1140999118 16:80291165-80291187 AAATAGGCAGGGATTCAGGAAGG + Intergenic
1141165506 16:81658066-81658088 CCCTAGGCAGAGACGCAGGAAGG - Intronic
1141412737 16:83846504-83846526 ATTTAGGCAGATACTAAGGAAGG - Intergenic
1141884272 16:86880991-86881013 CATGAGGGAGAGACTCAGGAAGG + Intergenic
1142673568 17:1499313-1499335 CTTTTAGTAGAGAGTCAGGATGG - Intronic
1144952472 17:19001717-19001739 CTGTAGCCAGAGACTCAGGGAGG + Intronic
1145021319 17:19433683-19433705 CTCAAGGCAGATATTCAGAAGGG - Intergenic
1146209989 17:30934785-30934807 CTTTAGTAAGAGATTGAGGCAGG + Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1148569286 17:48654911-48654933 CTTTAGACACAGATTCAGACTGG - Intergenic
1150911442 17:69391637-69391659 CTTTCGTCTGAGTTTCAGGATGG - Intergenic
1151977805 17:77492285-77492307 TTTTAGGAAGGGTTTCAGGAGGG + Intronic
1152562011 17:81083311-81083333 CTTCAGGCAGCCATTCAGGGAGG + Intronic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1155978919 18:32160706-32160728 CTTGGGGCAGAGGCTCAGGAAGG + Intronic
1156588019 18:38453977-38453999 CTTCAGGTATAGATTCTGGAGGG - Intergenic
1156828353 18:41461232-41461254 CTTTAAGCAACAATTCAGGAAGG + Intergenic
1157260679 18:46173689-46173711 CTTTCGGAAGGGCTTCAGGAGGG + Intronic
1157564346 18:48669563-48669585 GTTTAGGCAAAGAGGCAGGAGGG - Intronic
1157822602 18:50784644-50784666 CTGTGGCCAGAGATACAGGAGGG + Intergenic
1158854832 18:61532432-61532454 TTTTCTGCAGAGATTCAGGATGG - Intronic
1160348495 18:78153968-78153990 CTTTAGGAAGTGAGTCATGAGGG - Intergenic
1162683436 19:12363571-12363593 CATTAGTCTGAGAGTCAGGAAGG + Exonic
1165591733 19:36974365-36974387 GTTCAGGGAGGGATTCAGGATGG + Intronic
1167676126 19:50887220-50887242 CTTTCCGCAGAGGCTCAGGATGG + Intergenic
1168096046 19:54115451-54115473 CTTTAAGCAGGGATTCGGGGTGG - Exonic
1168491945 19:56818291-56818313 TTTTAAGTAGACATTCAGGATGG - Intronic
927323952 2:21781391-21781413 CACAAGGCAGGGATTCAGGATGG - Intergenic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
932106045 2:68943893-68943915 CTTCAGGCAGAGGTCCAGCAGGG + Intergenic
934111931 2:88752060-88752082 CTTTAGGCACACATACAGCAAGG + Intergenic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
935194120 2:100801455-100801477 GTTTAAGCAGAGATTTATGAGGG - Intergenic
936141528 2:109946210-109946232 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936178217 2:110244158-110244180 GTCTAGGCAGAGATGAAGGATGG - Intergenic
936203166 2:110425273-110425295 GTCTAGGCAGAGATGAAGGATGG + Intronic
937045308 2:118848057-118848079 CTTCAGGCCGGGACTCAGGAGGG + Intergenic
939024832 2:136999747-136999769 CTTTAGTCAGACATTAAGGGGGG - Intronic
944355029 2:198777688-198777710 CTTCAGACACAGACTCAGGAGGG + Intergenic
945404806 2:209432294-209432316 CTGTAGGCAGAGAAACAGGAAGG - Intronic
947037726 2:225878573-225878595 TTTTAGGCAAGCATTCAGGAAGG + Intergenic
947147567 2:227082272-227082294 CTTTAACAAGAGATTTAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1173344394 20:42185327-42185349 ATATAGGCAGAGATTCAGATAGG - Intronic
1174436667 20:50511485-50511507 TTTCAGGCAGGGACTCAGGAAGG + Intronic
1178117066 21:29428449-29428471 CTTTAGGAAGAGACTCAAGTGGG + Intronic
1178362282 21:31958555-31958577 GATGAGGCAGAGATTGAGGATGG + Intronic
1180125423 21:45786970-45786992 CTTTATGCAGAGTTGCAGCACGG - Intronic
1180165453 21:46023377-46023399 CTCTAGGGTGAGCTTCAGGATGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1183044950 22:35212035-35212057 CTTAAGGAAGAGATTTTGGAGGG - Intergenic
950349049 3:12328745-12328767 CGTTAGTCAAAGATACAGGAAGG - Intronic
954098325 3:48349013-48349035 ACTTTGGCAGAGATTCAGTAAGG + Intergenic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954973714 3:54673722-54673744 CTTGAAGCTGAGATTCAGGATGG - Intronic
956349325 3:68317389-68317411 CTTTAGCCTTAGATTTAGGAAGG - Intronic
961488600 3:127235007-127235029 CATTAGGCATAGAGCCAGGAAGG - Intergenic
962586509 3:136847643-136847665 CTGCAGGCAGTCATTCAGGAAGG + Intronic
964925863 3:161955920-161955942 TGTCAGGCAGGGATTCAGGAAGG + Intergenic
967086856 3:186103025-186103047 CTTGAGGTAGAGCTTCAAGAAGG - Intronic
967243352 3:187463181-187463203 CTTAAGGCAGAGATTTTGAAAGG - Intergenic
967371949 3:188756583-188756605 CTTTAGGGAGAGATTCAGAATGG - Intronic
967952811 3:194853671-194853693 CTTTAGGGGGAACTTCAGGAGGG - Intergenic
968089793 3:195892879-195892901 CTCTTGGCAGTGATTCAGAAAGG - Intronic
968685265 4:1953710-1953732 CTTTAGGGTGATATTTAGGATGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970391723 4:15618863-15618885 CTTTTGGCAGAGCTTGAGAAAGG - Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
975092182 4:70417050-70417072 TTTTAGGCAGAGATTTTGGATGG - Intergenic
975188425 4:71430985-71431007 CTTTAAGAAGAGAGTTAGGAAGG + Intronic
976121410 4:81786801-81786823 CTTGAGGCAGAGCTTTAGCAAGG + Intronic
977017405 4:91708629-91708651 CTTTAGGCTGTGACTCTGGAGGG - Intergenic
978493331 4:109332726-109332748 CTATAGGCAGAGATCCAGACAGG + Intergenic
979217514 4:118183149-118183171 CTACAGGCAGAGATCCAGGAGGG + Intronic
979746439 4:124219570-124219592 TTTTAGGCAGAGCTTCAGAGAGG - Intergenic
979826237 4:125236319-125236341 CTCTATGACGAGATTCAGGAAGG + Intergenic
980779430 4:137478287-137478309 CTTAAAACAGAGATTAAGGAAGG - Intergenic
983820832 4:172192363-172192385 TTTTAAGAAGAAATTCAGGAGGG + Intronic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
988463675 5:31466437-31466459 TTTGAGGCTGAGAGTCAGGATGG + Intronic
988682157 5:33494154-33494176 CCTGAGGCAGAAAGTCAGGAGGG + Intergenic
989096477 5:37786302-37786324 CTAGAGTCAGAGAATCAGGATGG - Intergenic
990032504 5:51278654-51278676 CTTTTGGCTCACATTCAGGATGG + Intergenic
990281539 5:54256512-54256534 CTTTTGGCATAGTTTCAGTAGGG - Intronic
990806802 5:59672235-59672257 CTTTAGGCAGGAGTTCAGAATGG - Intronic
990973180 5:61532247-61532269 CATTAGGCACAGATTCATCAAGG + Intronic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
993175905 5:84484966-84484988 TTTTAGGCAGAGATTGATGCTGG + Intergenic
994635894 5:102343958-102343980 ATTTAGGCCAAGACTCAGGAGGG + Intergenic
994760106 5:103841368-103841390 CTTTAGGGAGAGATGCACGAGGG - Intergenic
995942655 5:117602524-117602546 CATTAGCCAGAGATTCACAATGG - Intergenic
998371076 5:141661862-141661884 TTTTAGGCACAAATGCAGGATGG + Intronic
998414545 5:141936779-141936801 TCCCAGGCAGAGATTCAGGAAGG + Intronic
999634626 5:153609024-153609046 CTTTAGGCTGGGACTCAGAAGGG - Intronic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1003787989 6:9508557-9508579 CCATACGCAGAGATTGAGGAAGG - Intergenic
1003973077 6:11317507-11317529 CCTGAAGGAGAGATTCAGGATGG + Intronic
1004753550 6:18587626-18587648 ATTTAGGGAGAGAGTAAGGAGGG + Intergenic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1005610218 6:27516702-27516724 GTTTAGGCAGGGATTGAAGATGG - Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006277802 6:33020039-33020061 GTTTGGGCAGAGAGTCAGGCTGG + Intergenic
1007941834 6:45788901-45788923 CTTTGGACAGAGGTTCATGAGGG - Intergenic
1011379213 6:86724551-86724573 TTTTAGGCACAGATTCTTGAAGG + Intergenic
1013580478 6:111529387-111529409 CTTTGAGTAGAGAATCAGGAAGG - Intergenic
1013968355 6:115983734-115983756 CTCTAGGCAGAGAAACAGCAAGG - Intronic
1014020895 6:116588066-116588088 GTTTAGTCATAGATTTAGGATGG + Intronic
1014142228 6:117956796-117956818 ATTTAGGCAAATATCCAGGAGGG + Intronic
1014248976 6:119096717-119096739 GTCTAGGCTGAGATTCAGTATGG + Intronic
1015154276 6:130074566-130074588 CTTCAGGCAGATAATCAGGAAGG - Intronic
1015846725 6:137528111-137528133 CTTTGGGATGAGATTCAGGTGGG - Intergenic
1016379476 6:143460208-143460230 CTTGAGGCTGAGATTAAGAAGGG + Intronic
1016926842 6:149359532-149359554 CATAAAGCAGAGATTCTGGAAGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019303457 7:321393-321415 CTTTGGGGAGAGATCCAGGGAGG - Intergenic
1020004627 7:4775784-4775806 CCCTAGGGAGAGATGCAGGAAGG - Intronic
1020454396 7:8354876-8354898 CTTTAAGCTGAGATTAAGAAGGG - Intergenic
1023150405 7:37196422-37196444 GTTTAGCTTGAGATTCAGGAAGG + Intronic
1025734834 7:64137690-64137712 CTTTAGGCCAAGCTTCAAGAGGG + Intronic
1025992289 7:66505174-66505196 CTTGAGGCTGAGCTGCAGGATGG + Intergenic
1026461134 7:70616056-70616078 CTTTTAGCAGAGATAAAGGAGGG + Intronic
1028519651 7:91716032-91716054 CTTTATGGAGAGATTAAGGAGGG + Intronic
1033430484 7:141284873-141284895 CTTTATGCAGGGATTCAGTAGGG + Intronic
1034055233 7:148027451-148027473 CTTAAGGCAGACATCCAGGATGG + Intronic
1035546770 8:487533-487555 CTTTAGGCAGGAATGCAGGGAGG - Intergenic
1035585099 8:766806-766828 CTTTTGGCCGAGCCTCAGGATGG - Intergenic
1038560725 8:28576930-28576952 CTTTCTGGAGACATTCAGGAAGG - Intergenic
1040020625 8:42737610-42737632 CTTTAAGCTAAAATTCAGGAAGG - Intergenic
1041008628 8:53519871-53519893 CTTTAGAGAGTGATTCATGAGGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042590261 8:70391322-70391344 TTTTAGGCTCAGATTAAGGAGGG - Intronic
1045345443 8:101289546-101289568 CTTTAGGCGTCAATTCAGGAAGG - Intergenic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1049636870 8:143693771-143693793 CTTTAGGAAGGGCTTCAGGCTGG + Exonic
1050681215 9:8114006-8114028 AATTAGGCAGAGTTTCATGAAGG + Intergenic
1055131195 9:72777207-72777229 ATTTAGGCAGAGTATCAGGTAGG - Intronic
1055343975 9:75314407-75314429 CCTTGGGCAGAGATCCAGCAGGG + Intergenic
1056968782 9:91185779-91185801 CTTTAGGCAAAGAAGCAGGAAGG - Intergenic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1059318400 9:113446848-113446870 AGTTGGGCAGAGACTCAGGAAGG + Intronic
1186906364 X:14115213-14115235 CTTCAGGTAGAGATTCCAGAGGG + Intergenic
1189245732 X:39561826-39561848 TTTTAGGCAGTGATTAAAGATGG + Intergenic
1190969397 X:55334199-55334221 CTCTATACAGAGATCCAGGAAGG + Intergenic
1195125361 X:101803687-101803709 CTTTAGCAAGAGATCTAGGAAGG + Intergenic
1196872627 X:120127198-120127220 CTCAAGACAGAGATCCAGGAAGG - Intergenic
1198268923 X:135035771-135035793 CTTAAGGCAGAGATGTAGTAAGG + Intergenic
1199374718 X:147094151-147094173 TTTTAGGAAGAAATCCAGGATGG + Intergenic
1200371858 X:155735495-155735517 TTTTAGGCACAGATACATGAAGG + Intergenic