ID: 1118728393

View in Genome Browser
Species Human (GRCh38)
Location 14:68648966-68648988
Sequence GATTGTGCACACTGGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118728393_1118728396 -6 Left 1118728393 14:68648966-68648988 CCAAGAGTCCAGTGTGCACAATC 0: 1
1: 0
2: 2
3: 9
4: 108
Right 1118728396 14:68648983-68649005 ACAATCCTGGCTGTCTCCAGAGG 0: 1
1: 0
2: 3
3: 25
4: 207
1118728393_1118728399 19 Left 1118728393 14:68648966-68648988 CCAAGAGTCCAGTGTGCACAATC 0: 1
1: 0
2: 2
3: 9
4: 108
Right 1118728399 14:68649008-68649030 ACCCTCGCATGTCATAGCAATGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118728393 Original CRISPR GATTGTGCACACTGGACTCT TGG (reversed) Intronic
902532128 1:17097311-17097333 GAATGTGATCTCTGGACTCTGGG - Intronic
907104685 1:51871916-51871938 GATCGCGCCCACTGCACTCTAGG - Intronic
908509608 1:64840995-64841017 GTGTATGCACACGGGACTCTGGG - Intronic
911893254 1:103399153-103399175 GAATGTGCTCACTGGTCTGTGGG - Intergenic
919859517 1:201730104-201730126 GATTCATCACACTGGACTCTGGG + Intronic
921666788 1:217882101-217882123 GATTGAGCACACTGGAACCAGGG + Intergenic
922602701 1:226869416-226869438 GATTGCGGCCACTGCACTCTAGG + Intergenic
923584628 1:235256920-235256942 GATTGTGTACACTGCACTTGGGG - Intronic
924798026 1:247306831-247306853 GCTTGTGAGCACTGGACTCTGGG + Intronic
1063788433 10:9411052-9411074 GATTGTGCCCACTAGACTACGGG - Intergenic
1063847492 10:10147159-10147181 TATTGTGCACAGTAGACACTTGG + Intergenic
1064350833 10:14574925-14574947 GATGGGGCACACTGTACCCTAGG - Intronic
1067554333 10:47257586-47257608 TATTGTCTACACTAGACTCTGGG - Intergenic
1068182252 10:53535618-53535640 GATGATGAACCCTGGACTCTTGG - Intergenic
1069681022 10:70285298-70285320 GAGTTTGCTCACTGGACACTGGG + Intergenic
1069844742 10:71363096-71363118 GTCTGTGCACACTTGAGTCTTGG - Exonic
1070236034 10:74627434-74627456 GATTGTGCACACTCCAGCCTGGG + Intronic
1074892080 10:117744127-117744149 GAATGTGCAACATGGACTCTGGG - Intergenic
1075541485 10:123317904-123317926 GAATTTGCAGACTGGGCTCTGGG - Intergenic
1078712577 11:13808992-13809014 CATTGTTCACACTGGAGTGTGGG - Intergenic
1079090555 11:17477120-17477142 GTGTGGGCACACTGGAGTCTGGG + Intergenic
1082701495 11:56437258-56437280 TATTGTCCAAACTGAACTCTTGG - Intergenic
1083268727 11:61559790-61559812 GAGTGTGCCCACTGGACTCTGGG - Intronic
1089906583 11:122046386-122046408 GAATATGCACAGTGTACTCTGGG + Intergenic
1090608337 11:128448355-128448377 GAATTGGCACATTGGACTCTGGG + Intergenic
1091324522 11:134676473-134676495 GATTGTGCATAAGGGTCTCTAGG + Intergenic
1091726364 12:2849171-2849193 GATTGAGAACACTGGAGCCTGGG + Intronic
1092963502 12:13618554-13618576 CAGTGTCCACAATGGACTCTGGG - Intronic
1095987793 12:48010978-48011000 GATTTTGCACCCAGGATTCTGGG - Intergenic
1096595984 12:52695813-52695835 GAGTGTCCACCCTGGACTCCAGG + Exonic
1096624950 12:52889029-52889051 GAGTGTGCATGGTGGACTCTGGG - Intergenic
1100155621 12:91796782-91796804 GATTGTGAAATCAGGACTCTAGG - Intergenic
1104535427 12:129613915-129613937 GATTCTGCAGACAGTACTCTGGG - Intronic
1105407474 13:20144207-20144229 GAATGCCCACACTGGATTCTAGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107377077 13:39815623-39815645 GATTGGGAACACTGGACTCTTGG + Intergenic
1108297424 13:49038100-49038122 GATTGTCCCCACTGAACTCTTGG + Intronic
1110582280 13:77144495-77144517 TATTGTGCAAATTGGACTCCAGG - Exonic
1111533192 13:89567646-89567668 GATAGTCCACATTGGACTTTAGG + Intergenic
1115812514 14:37125340-37125362 GATTGTAGACTCTGGACCCTTGG - Intronic
1118728393 14:68648966-68648988 GATTGTGCACACTGGACTCTTGG - Intronic
1120189967 14:81431727-81431749 GATATTGCGCACTGCACTCTAGG + Intronic
1131936153 15:97507965-97507987 GTGTGTGCAAACTGGACTCCAGG - Intergenic
1132469715 16:95614-95636 GATTTTACACACTGCAGTCTGGG - Intronic
1137600178 16:49751080-49751102 AGTTGTGTGCACTGGACTCTGGG - Intronic
1140099465 16:71903033-71903055 GATCATGCCCACTGCACTCTAGG - Intronic
1145373111 17:22323533-22323555 GAATGTGCTCACTGGTCTGTGGG - Intergenic
1145849252 17:28075673-28075695 GAGGGTGCACATTTGACTCTGGG - Intronic
1152058628 17:78051896-78051918 TATTGTCCTCACTGGACACTTGG - Intronic
1155109162 18:22696978-22697000 GAGAGAGCACACTGGACTCTTGG - Intergenic
1160226207 18:77013292-77013314 CTGTGTGCACACTGGGCTCTGGG + Exonic
1161604750 19:5208391-5208413 GATTGGGCTCTCTGCACTCTAGG - Exonic
1162969307 19:14170505-14170527 GAGTGTGGACACTGGTGTCTGGG + Intronic
1165122772 19:33572412-33572434 TATTGAGCATATTGGACTCTTGG - Intergenic
925290880 2:2748064-2748086 GAGTGTGCACACAGCATTCTTGG - Intergenic
925419166 2:3697530-3697552 GACTGAGGACACTGGACTTTCGG + Intronic
926973397 2:18489188-18489210 TATTATGAACACTGGGCTCTTGG - Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
931537273 2:63292710-63292732 GATTCTGAACACTGATCTCTGGG + Intronic
934050807 2:88209104-88209126 GATTCTTCAAACTGGACTCTGGG + Intergenic
934110586 2:88738652-88738674 TTTTGTGCACTCTAGACTCTTGG - Intronic
937404979 2:121619080-121619102 CATTGTGCACACTGGAGTGAGGG - Intronic
942517214 2:176766875-176766897 GAGGGTGGACCCTGGACTCTGGG + Intergenic
943671023 2:190660866-190660888 TATTGTGTACATTTGACTCTGGG - Intronic
947985055 2:234440621-234440643 TATTGTCCAAACTGGACACTTGG + Intergenic
1172853101 20:37980959-37980981 GATAGTGCCCACTGCAGTCTTGG + Intergenic
1174702143 20:52619972-52619994 GATTGTTGACAGTGGACTGTGGG - Intergenic
1178834979 21:36089282-36089304 GATTGTGTCCACTGTACTCTAGG - Intergenic
1179018250 21:37613884-37613906 CATTGTAAACAATGGACTCTGGG + Exonic
1180941940 22:19665431-19665453 TAGTGTGCACTGTGGACTCTGGG + Intergenic
951153040 3:19315164-19315186 GATTGTGCAGACTTGAAACTGGG + Intronic
955077349 3:55626062-55626084 TATTGTGCAAGATGGACTCTGGG - Intronic
955820343 3:62889797-62889819 CCTCCTGCACACTGGACTCTTGG - Intergenic
962605113 3:137026403-137026425 GACTGTGGACACAGGACTTTTGG - Intergenic
962960779 3:140309412-140309434 GATTTTGCAGGCTGGACACTGGG + Intronic
963186776 3:142427284-142427306 GATTGTACCCACTGCACTCCAGG + Intronic
965732653 3:171789052-171789074 GTTTGTGCACAGTAGACTTTTGG - Intronic
965926918 3:173992361-173992383 GAAGCTGCACACAGGACTCTAGG + Intronic
966307394 3:178551924-178551946 GCTTGTGCACACTGGTACCTAGG - Intronic
969029902 4:4203552-4203574 GAAGGTCGACACTGGACTCTGGG + Intronic
973318789 4:48788774-48788796 GACTCTGCACTCTAGACTCTAGG + Intergenic
973895071 4:55404088-55404110 GATTGTGCCCACTGCACTCCAGG - Intronic
977514769 4:98007225-98007247 GATTGTGTAGACTGACCTCTAGG - Intronic
979505287 4:121488102-121488124 TATTGTGCACTCTGGACTCAGGG + Intergenic
984735918 4:183107847-183107869 GATTATGCACACTAGATTGTAGG - Intronic
986453726 5:7893506-7893528 GATTGTGGACACTTTACACTTGG + Intronic
991996701 5:72394811-72394833 GAATGTGCCCACTGCACTGTAGG + Intergenic
993447333 5:88029487-88029509 GATTTTTCAAACTGGACTCTAGG - Intergenic
998737809 5:145162766-145162788 GATTTTGCACCTTGGACTTTTGG - Intergenic
999670816 5:153957903-153957925 GACTGTGCTCACTGGTCTCAGGG + Intergenic
1001967973 5:175926674-175926696 GATGCTGCAAACTGGCCTCTTGG + Intronic
1002504001 5:179666237-179666259 GGTTGTGAACACTGTACTCCTGG + Intergenic
1008888932 6:56463011-56463033 GAATGTTAAGACTGGACTCTGGG + Intronic
1010475892 6:76286792-76286814 GATTGTGCACACCTGATTTTTGG + Intergenic
1013821436 6:114157786-114157808 GGTTGTATAGACTGGACTCTTGG - Intronic
1014005351 6:116411423-116411445 CATTGTGCAGGCTGCACTCTGGG + Intronic
1017916706 6:158836862-158836884 GATCCTCCACACAGGACTCTGGG - Intergenic
1019061153 6:169259218-169259240 GAATGCGCACACAGGACACTGGG + Intergenic
1020072041 7:5233532-5233554 GAATGGGCTCAGTGGACTCTGGG + Exonic
1021133527 7:16939449-16939471 GATTGGGCACATTGGGATCTTGG - Intergenic
1022609627 7:31856548-31856570 TATTGTGCAGAGTGTACTCTGGG - Intronic
1029470020 7:100748392-100748414 GATGGTGGACACTGGGCCCTCGG + Exonic
1030268198 7:107642625-107642647 GCTTGTGTCCAGTGGACTCTAGG - Intergenic
1031714652 7:125093518-125093540 GATTTCGCACACTGTCCTCTTGG + Intergenic
1032161594 7:129514975-129514997 TATTGTGCTCACTGGACCCCTGG + Intergenic
1034418492 7:150977430-150977452 CAGTGTGCGCGCTGGACTCTCGG + Intronic
1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG + Intergenic
1035783593 8:2247174-2247196 GATCGTGGACACTGGCCCCTAGG - Intergenic
1038979823 8:32747618-32747640 GCTTGTGTACACTGGACCCAAGG + Intronic
1039453143 8:37691696-37691718 GATTTAGCACACTGCACTCAGGG - Intergenic
1045608156 8:103802348-103802370 GAGTGTGCATAGTGGACTGTGGG + Intronic
1053877459 9:42558632-42558654 GATAGTGCAGCCAGGACTCTTGG - Intergenic
1054234236 9:62543090-62543112 GATAGTGCAGCCAGGACTCTTGG + Intergenic
1055583272 9:77730551-77730573 GATTGGGGACAATGGACTTTTGG - Intronic
1057030159 9:91769251-91769273 GGATGTGGACACTGGACACTGGG + Intronic
1057801507 9:98193862-98193884 CATAGTGCACACTGGGCTTTGGG - Intergenic
1062406240 9:136397927-136397949 GTGTGTGTACACTGGGCTCTAGG - Intronic
1188958677 X:36464612-36464634 TACTGTGCAGAGTGGACTCTGGG - Intergenic
1193630319 X:83877430-83877452 GATTGTAGACACTGGAAGCTAGG - Intronic
1194704481 X:97158367-97158389 GTTTGTGCAAACTGGACTTGAGG + Intronic