ID: 1118728530

View in Genome Browser
Species Human (GRCh38)
Location 14:68649984-68650006
Sequence GGCTCCTGAGAGCCACCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118728521_1118728530 16 Left 1118728521 14:68649945-68649967 CCAAGGGCTGCCTCGCTATGGTG 0: 1
1: 0
2: 0
3: 16
4: 102
Right 1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG 0: 1
1: 0
2: 1
3: 36
4: 241
1118728525_1118728530 6 Left 1118728525 14:68649955-68649977 CCTCGCTATGGTGGTGGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG 0: 1
1: 0
2: 1
3: 36
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118728530 Original CRISPR GGCTCCTGAGAGCCACCTCT TGG Intronic
900032287 1:380634-380656 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
900052837 1:608820-608842 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
900790332 1:4675683-4675705 GGCTCCTGGAAGGCATCTCTGGG - Intronic
900898306 1:5499033-5499055 GTCCCCTGAGAGTCACCACTTGG - Intergenic
901441212 1:9279652-9279674 GCCTCCTGTGAGCAACCTTTCGG - Intergenic
903058630 1:20654207-20654229 GCCTCCTGGCAGCTACCTCTGGG + Exonic
903193200 1:21668187-21668209 GCCTCCTGAGAGCCTCATATGGG + Intronic
904772042 1:32886167-32886189 GGCTCAGGAGAGAGACCTCTTGG + Intronic
908242102 1:62196232-62196254 GCCTCCTCAGATCCACCTCTGGG + Intronic
909021315 1:70434371-70434393 GGCCCCTGAGAGCCTCCTCCTGG - Intronic
915036896 1:152935309-152935331 GGCTCCTGGGACCCACACCTGGG + Intergenic
917956230 1:180101745-180101767 GGCTCCCAAGATCCACCTTTGGG + Intronic
920697474 1:208192222-208192244 GGCTCCTCTGGCCCACCTCTGGG + Intronic
1062834922 10:629248-629270 GGATCCTCACAGCCGCCTCTTGG - Intronic
1062950277 10:1494272-1494294 GTCTCCTGAGAGGCAGCTTTGGG + Intronic
1069887110 10:71630850-71630872 GGCTCCTGAGAGCCAATGGTTGG - Intronic
1070610811 10:77931186-77931208 GCCTCAAGAGATCCACCTCTTGG + Intergenic
1073043064 10:100620573-100620595 AGCTCCTGAGAGCCAGCTCTGGG + Intergenic
1073071134 10:100793865-100793887 AGCTCCTGAGAGTCACATCCCGG - Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1075382530 10:122030936-122030958 GCCTCCTGTGATCCCCCTCTTGG + Intronic
1076431938 10:130410166-130410188 GGCTCATGTGAGCCTCCCCTGGG + Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1077051163 11:567744-567766 TCCTCCGGAGGGCCACCTCTGGG - Intergenic
1077142760 11:1031606-1031628 GGGTCCTGACAGCCACCTCATGG - Exonic
1077148942 11:1059906-1059928 GACGGCTGAGAGCCACCTCCTGG - Intergenic
1077148955 11:1059953-1059975 GACGGCTGAGAGCCACCTCCTGG - Intergenic
1078423994 11:11234518-11234540 GACTCCTCAGAGCCACCTGTGGG - Intergenic
1084231532 11:67757125-67757147 GGCTCCTGTGCCCCACCTCTGGG - Intergenic
1084326921 11:68405867-68405889 GGCTCCTGAGAGTCCCAGCTAGG - Intronic
1084957387 11:72698501-72698523 GCCTCCTGAGAGTCAGCCCTCGG - Intronic
1088604117 11:111512514-111512536 GGGTCGAGAGAGCCAGCTCTAGG + Intergenic
1089284008 11:117394216-117394238 GGCTCCCTAAAGCCAGCTCTTGG - Intronic
1089515648 11:119030137-119030159 GGCCCCACAGAGCTACCTCTGGG + Intronic
1089738024 11:120563348-120563370 GGCTCCAGAGAACAACTTCTGGG + Intronic
1089922783 11:122226697-122226719 AGCTGCTGAGAGCCAGCTCCAGG + Intergenic
1091091026 11:132771540-132771562 GGCTCCTGAGAGCCCCCACGAGG + Intronic
1091307192 11:134543816-134543838 GCCTCATGGGAGCCAGCTCTTGG + Intergenic
1091821899 12:3481614-3481636 GGCTTCTGAAAGCAACCTCGAGG + Intronic
1094225389 12:28039658-28039680 AGACCCTGAGAGCCACCACTTGG - Intergenic
1097876249 12:64646842-64646864 GGTTACTGAGGGCCTCCTCTGGG + Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1099627240 12:85090439-85090461 AGCCCATGAGAGCAACCTCTGGG + Intronic
1099712473 12:86244826-86244848 TGCTCCTGAAACTCACCTCTGGG - Intronic
1102243977 12:111343345-111343367 GTCTCCTCAGAGCCAGCCCTGGG - Intronic
1102580384 12:113882671-113882693 CGCTCCTTGGAGCCACCCCTGGG - Intronic
1102584277 12:113912220-113912242 GGCTCCGGAGAGCATTCTCTGGG - Intronic
1103883276 12:124182786-124182808 GGCCCCTGAGTGCCGTCTCTTGG - Intronic
1106342384 13:28842903-28842925 GGCTCCTTAGAACCCCCTCTGGG + Intronic
1106836674 13:33642543-33642565 GGCTCCTGGGAGTCACCCCTTGG - Intergenic
1106929526 13:34648753-34648775 GGATCCTGAAAGCCACTCCTAGG - Intergenic
1109092986 13:58072199-58072221 GGCTCCAGAGGGCCACCTCCAGG - Intergenic
1109819852 13:67638712-67638734 GCCTCCTGAGAGCCTCTACTAGG + Intergenic
1110959790 13:81607306-81607328 GGCTCCTCTGAGCCATTTCTTGG + Intergenic
1113627332 13:111856752-111856774 GGCAGCTGAGAGCCTCCGCTTGG - Intergenic
1115381552 14:32745785-32745807 GACTCCTGGAAGGCACCTCTTGG - Intronic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1118729521 14:68656613-68656635 GGACCCTGAGAGCGAGCTCTGGG - Intronic
1118739832 14:68731332-68731354 GGCTCCTCAGAGCCCACTCCAGG - Intergenic
1121649466 14:95547107-95547129 GGTTCCTGAGAGCCACCGACAGG + Intergenic
1121976287 14:98406918-98406940 GGCTCCTGATGGCCACACCTTGG + Intergenic
1122325184 14:100877525-100877547 GTCTCCTGAAGGCCACCCCTGGG - Intergenic
1122337619 14:101004370-101004392 TGCTCCTGAGAGCCCGCTCATGG + Intergenic
1122890186 14:104728670-104728692 GGCTCCTGGGCCCAACCTCTTGG - Intronic
1202852574 14_GL000225v1_random:30673-30695 GGATCATGAAAGCCACCTTTGGG - Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1128147504 15:65340175-65340197 GCCTCCTGAGAGCCAGATCTAGG + Intronic
1128158948 15:65410611-65410633 GCCTCCTGAGAGCCCCCTAAGGG + Intronic
1129206850 15:74042320-74042342 GCCTCCTGAAGGCCACATCTAGG - Intronic
1129671691 15:77611172-77611194 GGCTTCTCAGAGCCACTTCTGGG - Intergenic
1132628986 16:907546-907568 GGTTCCTCAGAGCCATCTCAGGG - Intronic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133328422 16:4956505-4956527 GTCTCCTGAGAGAGACCTCCAGG + Intronic
1135198958 16:20420135-20420157 GGCCCCTGAGAGGCTCCTTTTGG - Intronic
1135219732 16:20603537-20603559 GGCCCCTGAGAGGCTCCTTTTGG + Intergenic
1135935429 16:26775744-26775766 GGATCCTGAGAGCAAACCCTAGG + Intergenic
1136692104 16:32039701-32039723 GGGTCCTGAGGGCCCCCTCGTGG - Intergenic
1136792647 16:32983139-32983161 GGGTCCTGAGGGCCCCCTCGTGG - Intergenic
1136877209 16:33870915-33870937 GGGTCCTGAGGGCCCCCTCGTGG + Intergenic
1137593478 16:49708203-49708225 GGCTCCAAAGATCAACCTCTTGG + Intronic
1137665811 16:50248280-50248302 TGCTCCTGACCCCCACCTCTTGG + Intronic
1137671186 16:50280651-50280673 GGCCCCAGAGAGCTACTTCTAGG - Intronic
1139211913 16:65086330-65086352 GGCTCTTTAAAGCCACCTCAAGG + Intronic
1140027554 16:71304368-71304390 GGCTGGAAAGAGCCACCTCTGGG + Intergenic
1141997712 16:87645803-87645825 GGCTCCTGCCAGCCACAGCTTGG - Intronic
1142059314 16:88019441-88019463 GGCTCTGGAGAGTCACCTCAGGG + Intronic
1142354462 16:89595848-89595870 GGCTCCTGGGATCCACCACGCGG + Intronic
1142814385 17:2413835-2413857 GGCTCGTCTGACCCACCTCTAGG - Intronic
1143588902 17:7868060-7868082 GGATCCTGAAAGACAGCTCTGGG + Intronic
1143777630 17:9209836-9209858 GGCTCCTGAGAGCCAGACCCTGG + Intronic
1144753803 17:17667751-17667773 GGCCCCTGAGAGTCATCTGTGGG - Intergenic
1146654587 17:34627427-34627449 GGGTCCAGAGAGCAGCCTCTTGG + Intronic
1147243987 17:39108818-39108840 GTCTCCAGTGAGCCACCCCTGGG + Intronic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1149151448 17:53569345-53569367 GGCCCCAGTGACCCACCTCTGGG + Intergenic
1149574504 17:57702182-57702204 GGCTGCTGGGAACCACTTCTGGG - Intergenic
1150368937 17:64619015-64619037 GGATACTAAGAGCCACCTCATGG + Intronic
1151412520 17:73940811-73940833 GGCCACTAAGAACCACCTCTGGG - Intergenic
1152218095 17:79046036-79046058 GGCTCCTGGCTGCCACCTCGCGG - Intronic
1152545986 17:81000330-81000352 GGGCCCTGACGGCCACCTCTGGG + Intronic
1153508603 18:5829369-5829391 GGCTCCTGAGGGACACCACCGGG - Intergenic
1153910739 18:9704694-9704716 GATTCCTGAGAGCCAGCACTGGG - Intergenic
1154092561 18:11378957-11378979 GGCTCCTGGGGGCCACTTCCTGG - Intergenic
1154269376 18:12906239-12906261 GGTTCCTGAGAGCCACAGCATGG - Intronic
1157544894 18:48540252-48540274 GGCTCTGAAAAGCCACCTCTGGG + Intronic
1158396322 18:57080986-57081008 GGCTCCAGAGGGCAGCCTCTCGG + Intergenic
1160444246 18:78914677-78914699 TGCTCCTGATAGCCACGTCTTGG + Intergenic
1160498000 18:79386445-79386467 GGGACCTGAGAGCCTCCCCTGGG - Intergenic
1160528344 18:79549874-79549896 GTCTCCTGGGAGCTCCCTCTCGG - Intergenic
1160662766 19:308717-308739 GGCGCCTGGGCGGCACCTCTTGG - Intronic
1161494707 19:4580845-4580867 GGGTCCTGAGAGCCAAGTCGAGG - Intergenic
1161626306 19:5328982-5329004 GGCTCCTGGGAGCTACCGCCTGG - Intronic
1162105842 19:8369155-8369177 GGCTCCTGAGACCCCCCCCAGGG + Intronic
1163343180 19:16723094-16723116 GGCTGCAGTGAGCCACCACTGGG - Intronic
1164756756 19:30695483-30695505 GGGTCCTGAGAACCGCTTCTAGG + Intronic
1164781388 19:30896399-30896421 GGCTCCTGGGAGCAGCCTCCTGG - Intergenic
1164823787 19:31269301-31269323 GGCTCCTGAAAGCCTCATCAGGG - Intergenic
1166428244 19:42698773-42698795 GCCTCCTGAAAACCACCTCAAGG + Intronic
1167034454 19:46985972-46985994 GGCTTCCGAGAGCCACGTGTTGG - Intronic
1167264305 19:48475900-48475922 TGCTCCAGAGAGACACATCTGGG + Intronic
925369465 2:3333951-3333973 GGCTTCTGAGACACACCTTTCGG - Intronic
926152332 2:10432210-10432232 GGCTTCTGAGAGGGACCTCGTGG + Intergenic
926414416 2:12634827-12634849 AGCTCCTGGGCCCCACCTCTAGG + Intergenic
927139114 2:20117925-20117947 TGCTCCTGACCTCCACCTCTGGG - Intergenic
927139133 2:20118009-20118031 TGCTCCTGACCTCCACCTCTGGG - Intergenic
927150169 2:20191044-20191066 GACTGCTGAGCGCCAGCTCTGGG + Intergenic
927180978 2:20446774-20446796 GGCTCCAGACAGCCAGCTCCCGG + Intergenic
927499208 2:23571065-23571087 GCCTCCTGAGGGCAACCTCAAGG - Intronic
928127262 2:28625389-28625411 GGCTCTGGGAAGCCACCTCTTGG - Intronic
929789239 2:45011437-45011459 GGGTCCTTAGATCCAACTCTGGG - Intergenic
930018084 2:46984544-46984566 GCCCCCCGACAGCCACCTCTAGG + Intronic
931114094 2:59145640-59145662 GGCTTCTGAGAGAGACCTCTGGG + Intergenic
931788846 2:65645592-65645614 GGCTCCTGTGTGCCCCTTCTTGG - Intergenic
933362253 2:81303099-81303121 AGGACCTGAGAGCAACCTCTAGG - Intergenic
933690310 2:85174671-85174693 AGCACCTGAGAGCCTCCTCATGG + Intronic
937038413 2:118801753-118801775 GGATCCTGACATCCTCCTCTGGG - Intergenic
937228290 2:120382312-120382334 GGCTCAGGAGAGACAGCTCTGGG - Intergenic
938108523 2:128549374-128549396 CCCTCCTGAGAGCAACCCCTTGG - Intergenic
938449161 2:131401030-131401052 GGCTCCTGAGTGTCCCCTCCTGG - Intergenic
940621710 2:156121586-156121608 GGCCCCTTTGAGCCACCACTGGG - Intergenic
940738553 2:157480711-157480733 GGCTGCTGGGTGGCACCTCTGGG + Intronic
942509901 2:176686848-176686870 GGCTCCTCAGAGCAAGCTCGTGG + Intergenic
942552853 2:177137799-177137821 GGCTCCAGAGAGCCAGCTGCGGG - Intergenic
942565774 2:177264205-177264227 GGCTCCGGAGTCCCAGCTCTCGG + Intronic
942631755 2:177957676-177957698 GGCTGCTCACAGCCACCTTTGGG + Intronic
944668139 2:201973363-201973385 TGCTCCAGTGAGCCACCTCTAGG - Intergenic
946254939 2:218435428-218435450 GGGACCTGAGAGTTACCTCTTGG - Exonic
948381280 2:237551457-237551479 GGCTCCTGAGAGCTGACTGTGGG - Intronic
948770726 2:240250203-240250225 GGCTCCTGTGGGACAGCTCTGGG + Intergenic
948873456 2:240815424-240815446 GGCTCCTGAAATGCAGCTCTAGG - Intronic
1168849812 20:968853-968875 GGCTCCTGGGTGCCAATTCTGGG - Intronic
1169217651 20:3802751-3802773 GGCAACTGAGAGGCACCTCTTGG - Intronic
1169815777 20:9654693-9654715 GGCTCCTGGGGACCACCCCTTGG + Intronic
1170152596 20:13241025-13241047 GGCTTCTGTGACACACCTCTTGG - Intronic
1170892779 20:20390290-20390312 GGTTCCTAAGAGCCACATGTTGG - Intronic
1171199498 20:23230027-23230049 GGCTCCTCAGGGCCACCAGTCGG - Intergenic
1171285094 20:23930376-23930398 GTCTCCTGTGCTCCACCTCTTGG - Intergenic
1171333383 20:24360928-24360950 GGCTGCAGAGAGCCAGCACTGGG + Intergenic
1171418433 20:24999731-24999753 GACACCTGAGAGGCAGCTCTGGG + Intergenic
1173328986 20:42058678-42058700 GGCTTCTGAGAGGCACCTAGAGG + Intergenic
1173731674 20:45333234-45333256 GGCTCCTCAGACCCACCCCCTGG + Intronic
1173793345 20:45841941-45841963 AGCCCCCGAGAGCCACCTGTGGG + Exonic
1178035722 21:28580417-28580439 GGATCCAGAGAGCCACTTGTTGG - Intergenic
1178422445 21:32453126-32453148 GGCTCCTGTGCCCCACCTCTGGG + Intronic
1178847848 21:36188322-36188344 GGCTGCCGAGAGCCATCTCAGGG - Intronic
1179451904 21:41473632-41473654 GGCTCCTGGGGGTCTCCTCTTGG + Intronic
1180661589 22:17472144-17472166 GACTCCTGGGATCCATCTCTTGG + Intronic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181130130 22:20726379-20726401 GGCTCCTCAGAGCCTCCTCAGGG - Intronic
1181575451 22:23791637-23791659 GGCGCCTGGGGGCCACCTCAAGG + Intronic
1182477203 22:30582789-30582811 GGCCCCTGACAGGCACATCTGGG + Intronic
1182667585 22:31970819-31970841 GGCTCCACAGCGCCACCTCGAGG - Intergenic
1183547709 22:38463665-38463687 GGCTCCCTAGAGCTTCCTCTAGG - Intergenic
1184757221 22:46523874-46523896 GGCTCCTTGGAGCCTTCTCTGGG - Intronic
1185346044 22:50311265-50311287 CGTCCCTAAGAGCCACCTCTGGG - Exonic
949570231 3:5285456-5285478 GGGTCCTCAGAGGCACCTCTGGG + Intergenic
950503742 3:13380441-13380463 CGCTACTGAGAGCCACATTTTGG + Intronic
950620334 3:14200416-14200438 GGCCCCTGGGAGCCACGCCTTGG + Exonic
951537762 3:23755090-23755112 GTTTCCTGAGATCAACCTCTTGG + Intergenic
954133469 3:48571405-48571427 AGCTCCTGTGAGCCAATTCTTGG - Intronic
957048074 3:75391974-75391996 GGCTCCTGTGCCCCACCTCTGGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
959227002 3:103599069-103599091 GACGGCTGAGAGCCACCACTTGG + Intergenic
960154982 3:114290615-114290637 AGATCCTCAGAGCCACCTCACGG + Intronic
961180476 3:124872530-124872552 GCCTCCCGTGAGCCATCTCTTGG + Intronic
961559988 3:127722129-127722151 GGCTGCTAAGAGCCACTTCTTGG - Intronic
961880143 3:130056084-130056106 GGCTCCTGTGTCTCACCTCTGGG - Intergenic
962923653 3:139972824-139972846 TACTACTGAGAGCCACCTGTGGG - Intronic
963355664 3:144206863-144206885 TGCTCCTGAGAAACAGCTCTTGG - Intergenic
964078036 3:152715726-152715748 GGCTCCTAATAGCCAAATCTGGG - Intergenic
964318196 3:155466015-155466037 GACTCCTGGAAGGCACCTCTGGG + Intronic
967398919 3:189039229-189039251 GCCTACAGAGAGCCAGCTCTGGG - Intronic
967875486 3:194265697-194265719 AGGCCCTGGGAGCCACCTCTCGG - Intergenic
968992533 4:3924431-3924453 GGCTCCTGTGCCCCACCTCTGGG - Intergenic
969512797 4:7629309-7629331 GGCTCCGGAGAGCCCCTTCCCGG - Intronic
969822821 4:9733191-9733213 GGCTCCTGTGCCCCACCTCTGGG + Intergenic
970199738 4:13591505-13591527 GGATTATGAGAGCCACATCTGGG + Intronic
970569463 4:17365612-17365634 GGCTCCTGAGAGCTGACTGTGGG - Intergenic
976213078 4:82691614-82691636 GGCCCATGAAAGTCACCTCTAGG - Intronic
978370701 4:108027127-108027149 GGCTCCTTGGAGCCACTCCTCGG - Intronic
981810675 4:148770556-148770578 GGGTTCTGAGAGCCACCTGGTGG + Intergenic
984653032 4:182289884-182289906 GGGTCCTGAGCGTCATCTCTAGG - Intronic
985369054 4:189265778-189265800 GGCTCCTGCTTGCCACTTCTAGG - Intergenic
985976543 5:3422694-3422716 GGCACCTGAGAGTCACTTCTGGG + Intergenic
993975128 5:94469984-94470006 GGATGCTGAGAGCCACCACTGGG - Intronic
994800434 5:104366904-104366926 GGCTCCTGGTGGCTACCTCTTGG + Intergenic
997358460 5:133279490-133279512 GGCTCCTGGGCCCCACCTGTTGG - Intronic
997409732 5:133681843-133681865 GACTGCTGAGAGCCACCCTTTGG + Intergenic
1002741533 5:181438234-181438256 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1002769497 6:278689-278711 TTCTCTTGAGAGCCACCTCCAGG - Intergenic
1003171440 6:3724634-3724656 CCCTCCTGGGAGCCACCTCGGGG + Intronic
1006133222 6:31880959-31880981 GGCTCCTGAAAGCCAGCCCTGGG + Intronic
1011388437 6:86823086-86823108 AGAGCCTGAGAGCCATCTCTTGG - Intergenic
1012215403 6:96576557-96576579 AGCTCTTGAGGGCCAACTCTGGG - Intronic
1012976585 6:105786720-105786742 GTCTCCAGGGAGCCAGCTCTGGG - Intergenic
1015019538 6:128455822-128455844 GGTACCTGATAGCCATCTCTAGG - Intronic
1015163179 6:130175337-130175359 AGCTCCCGACAGCCACTTCTGGG + Intronic
1016003436 6:139066192-139066214 GGGTCCCCAGAGCCACCCCTTGG + Intergenic
1017565896 6:155686287-155686309 GGCTCCACAGAGACAGCTCTAGG + Intergenic
1018661668 6:166093102-166093124 GGCTCCTCTGAGCCCGCTCTCGG + Intergenic
1019246669 6:170713999-170714021 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1019272535 7:158441-158463 GGGCCATGAGAGCCGCCTCTTGG + Intergenic
1019543846 7:1563526-1563548 GGCTCCTGAGAGCCAGGCCTGGG - Intergenic
1020315184 7:6900787-6900809 GGCTCCTGTGCCCCACCTCTGGG - Intergenic
1020552035 7:9619749-9619771 CGATCCTTAAAGCCACCTCTTGG + Intergenic
1021813732 7:24427715-24427737 GGGTCCTGGCAGACACCTCTGGG - Intergenic
1022273350 7:28831979-28832001 TGGTCCAGGGAGCCACCTCTAGG - Intergenic
1023364138 7:39446180-39446202 GGCTTCTGCGAGACCCCTCTGGG + Intronic
1023670087 7:42567049-42567071 TGCTGCAGAGATCCACCTCTGGG + Intergenic
1026539018 7:71264074-71264096 GCCTGCTGAGAGCCACCTCCAGG - Intronic
1027055460 7:75046518-75046540 GGCTCCTGGGAGCCAGCCCTAGG + Intronic
1032429576 7:131849802-131849824 TGTTCCTGGTAGCCACCTCTTGG - Intergenic
1034540051 7:151752082-151752104 GGCTCCTGCTGGCCACGTCTAGG + Intronic
1035459297 7:159029439-159029461 GGCTGCTGAGCGCCAGCTCTGGG + Exonic
1035501471 8:93962-93984 GGGTCCTGAGGGCCACCCTTCGG + Intergenic
1037523664 8:19703890-19703912 GGCTCCTGAGAGCTGCGTGTAGG - Intronic
1039159670 8:34603270-34603292 GGGTCCTGAGAGACAGATCTTGG + Intergenic
1039846915 8:41331993-41332015 AGCTCCTGAGGGCAACATCTGGG - Intergenic
1040548527 8:48420741-48420763 TGCTGCTGACAGCCTCCTCTGGG - Intergenic
1041043344 8:53868397-53868419 GGCTCCCCAGACCCACCTCCTGG - Intronic
1041458393 8:58084814-58084836 GGCACCTGACAGCAGCCTCTAGG - Intronic
1042435852 8:68763919-68763941 GGCTCCAGAGAGATACATCTTGG - Intronic
1042526568 8:69770694-69770716 GCTTCTTGAGAGCCACCTCTCGG - Intronic
1045017905 8:98014769-98014791 GACTCCTCAGAACCACCTTTGGG - Intronic
1048396900 8:134022507-134022529 GGATCCTAGGAGCCAGCTCTAGG + Intergenic
1049232162 8:141490042-141490064 GGACTCTCAGAGCCACCTCTTGG + Intergenic
1049578116 8:143398801-143398823 GGCTTCTAGGAGCCTCCTCTGGG + Intergenic
1049660828 8:143819019-143819041 GGCTCCTGAGCTCCTCCCCTGGG - Intronic
1049672413 8:143875893-143875915 GGCCCCTGTGACCCACCTCCTGG - Intronic
1049789449 8:144466134-144466156 GGCTCCCGCGACCCTCCTCTCGG - Exonic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1055108127 9:72533466-72533488 GGTTGCTGGGAGACACCTCTGGG - Intronic
1056709125 9:88976461-88976483 GGCTCCTGAGTGCCAGGTCCTGG + Intergenic
1056954928 9:91074151-91074173 GGCTCCGGAAGGCCACCTCTGGG - Intergenic
1057040495 9:91844303-91844325 GGTTCCTGGGGGCCTCCTCTGGG + Intronic
1057312480 9:93951018-93951040 GGCTGCTGAGTTCCACCTCTGGG - Intergenic
1057914529 9:99045621-99045643 GGATTCTGAGAGTCACTTCTTGG - Intronic
1057943069 9:99301803-99301825 GGCTCCTGTAAACCACTTCTGGG + Intergenic
1058828994 9:108798711-108798733 TCCTCCTGAGAACAACCTCTGGG - Intergenic
1059343584 9:113613307-113613329 GGCCCCCGAGAGCCAGCTCCAGG + Intergenic
1059497690 9:114723141-114723163 TGATCCTGAGAGCCTGCTCTGGG - Intergenic
1060596686 9:124852992-124853014 GGCTCCTGAGGGGGCCCTCTTGG + Intergenic
1061145232 9:128793789-128793811 GGCACCTGAGAGCTGCCCCTTGG - Intronic
1061241911 9:129379274-129379296 GGGGCCTGAGAGCCATCTGTGGG - Intergenic
1062176379 9:135165439-135165461 GGTTGCTGGGAGCCACCGCTTGG - Intergenic
1062447142 9:136599773-136599795 GCCTCCTGAGACCCACGGCTGGG + Intergenic
1062716353 9:138012178-138012200 GGCTTCTGACAGCCACAGCTGGG + Intronic
1203607445 Un_KI270748v1:69450-69472 GGGTCCTGAGGGCCACCCTTCGG - Intergenic
1187316884 X:18204683-18204705 GGCTCCTGAGCTCAGCCTCTTGG - Intronic
1190381735 X:49845718-49845740 GGCTCCCGAGAGCCAATTGTGGG - Intergenic
1193368271 X:80660685-80660707 GCTTCCTGAGGGCCAACTCTGGG + Intergenic
1195502163 X:105613866-105613888 GGCTTCTGAATGACACCTCTGGG + Intronic
1196014120 X:110919358-110919380 GGTTCAAGAAAGCCACCTCTGGG - Intergenic
1196793317 X:119483215-119483237 GGATCCTGAGAGTCTCCTTTGGG - Intergenic
1197735379 X:129846861-129846883 TGATCCTGAGTGCCACCACTGGG + Intergenic
1197876466 X:131114283-131114305 GGCTCCTGAATGGCACCCCTAGG - Intergenic
1199728011 X:150604071-150604093 GGCTCCTGTGAGCCTCCTCCTGG - Intronic
1199849019 X:151712027-151712049 GGCAGCTGAGAGCTTCCTCTTGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic