ID: 1118729595

View in Genome Browser
Species Human (GRCh38)
Location 14:68656966-68656988
Sequence TTAAGCAGCCTGGTTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118729595 Original CRISPR TTAAGCAGCCTGGTTAAAAC AGG Intronic
906943433 1:50275684-50275706 TTAGGCAGCCTGATGAAAAAGGG - Intergenic
910181718 1:84491798-84491820 TAAAACACCCTGGATAAAACAGG - Intronic
910837276 1:91528386-91528408 ATAAGCACCCTTGTTAAAAGAGG - Intergenic
911440396 1:97919829-97919851 TTATGGAGCCTGGAGAAAACAGG + Intronic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
912761184 1:112368892-112368914 TTAAGCAACCAGCTTAAGACAGG + Intergenic
914322711 1:146580723-146580745 AAAAGCAGCCTGGAAAAAACAGG + Intergenic
917169749 1:172158080-172158102 TTAAGTAGCATGGTTAAGAAAGG + Intronic
917255951 1:173116480-173116502 TTAAGAAGACTGGGTAATACAGG + Intergenic
917426663 1:174921323-174921345 TAAAGTAGGCTGATTAAAACAGG - Intronic
918735625 1:188059080-188059102 TTCAGCAGCATGGATGAAACTGG - Intergenic
919064271 1:192673664-192673686 TTAAGCAGCAGGGTAAGAACTGG + Intergenic
922809034 1:228405938-228405960 TCAAGGGGCCTGGTTGAAACAGG + Intronic
924698368 1:246423758-246423780 GTAAGCAGCCTGTTTAAAAGAGG + Intronic
1069098007 10:64283768-64283790 TTCAGCAGCATGGGTAGAACTGG + Intergenic
1069432193 10:68347592-68347614 TTAAGCAAGCTGGTTAACAATGG - Intronic
1072393499 10:95014464-95014486 ACAAGCAGCCTGGTTAACATGGG - Intergenic
1073322656 10:102625099-102625121 TTGAGCAGACTGGTGATAACTGG + Intronic
1073930521 10:108568984-108569006 TTAAGTTGCCTGGTTATAAGGGG - Intergenic
1074161238 10:110838044-110838066 TTCATCATGCTGGTTAAAACTGG - Exonic
1077468193 11:2743695-2743717 TCAAGAAGGCTGGTTAAAGCTGG - Intronic
1078191797 11:9097271-9097293 TAAAGAAGCCAGGTTAAAAAGGG + Intronic
1082105328 11:48215328-48215350 GTAAGGAGCTTGGCTAAAACTGG - Intergenic
1084229237 11:67738804-67738826 TTAGGCTGCCTGGTTCAAATTGG + Intergenic
1088765320 11:112969907-112969929 TGAAGCAGGCAGGTAAAAACTGG + Intronic
1090717142 11:129440699-129440721 TTATGCAGCCTGGTCAGAGCAGG + Intronic
1092031642 12:5291209-5291231 TAAATCAGCCAGGTTAAAAGAGG + Intergenic
1093661259 12:21759922-21759944 TTCATCAGCCTGGTCAAAGCTGG + Intergenic
1093672327 12:21891812-21891834 TTGAGCAGCCTGTTTATAATCGG - Intronic
1093683117 12:22025303-22025325 TTAATCAGCCTTTTTAAAAAAGG + Intergenic
1094558241 12:31524355-31524377 TTAAGAAGCCTGGTTGGGACGGG + Intronic
1096507607 12:52105047-52105069 TTAGGCTGCCTGGTTCAAACTGG - Intergenic
1103707612 12:122886921-122886943 TGAAGCATCGTGGTTAAGACAGG - Intronic
1104091528 12:125521686-125521708 TTGAGCAGCCTGGTTAGGGCTGG + Intronic
1107708384 13:43129134-43129156 TTCAGCATTCTGGTTAAAATCGG - Intergenic
1109786480 13:67182214-67182236 TTAATCATCCTGCCTAAAACAGG + Intronic
1109810047 13:67500849-67500871 TAAAGGACCCTGATTAAAACAGG - Intergenic
1113820067 13:113207626-113207648 TTGAGAAAACTGGTTAAAACAGG - Intronic
1114837564 14:26221471-26221493 TTTAGCAGTCTGCTTAGAACTGG + Intergenic
1118729595 14:68656966-68656988 TTAAGCAGCCTGGTTAAAACAGG + Intronic
1125025865 15:35028350-35028372 TAAAGCTGTCTGGTTAGAACTGG + Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG + Intergenic
1133707788 16:8371890-8371912 AAAAGCTCCCTGGTTAAAACTGG + Intergenic
1140912042 16:79462979-79463001 CTGAGCACCCTGATTAAAACAGG - Intergenic
1141977789 16:87529066-87529088 TTAAGTTGCCTGGTGACAACAGG + Intergenic
1144215207 17:13049345-13049367 TTAAGTACCCTGGATACAACAGG - Intergenic
1153905498 18:9658052-9658074 TTCACGAGCCTGGTCAAAACTGG + Intergenic
1154008418 18:10555398-10555420 CTAAGCAGCGTGGTTCAGACTGG + Intergenic
1154293916 18:13133516-13133538 TAAAGCAGCCTGGGTGAGACTGG + Intergenic
1154385430 18:13887954-13887976 TTCAGAATCCTGGTTAATACAGG + Intronic
1158096202 18:53774364-53774386 TGCAGCAACCTGGATAAAACTGG - Intergenic
929875652 2:45794459-45794481 TTAACCAGCCTGGATGAAGCAGG + Intronic
930253935 2:49067230-49067252 TTAAGCCACCTGCTTAAAAGAGG - Intronic
930972807 2:57418020-57418042 TTGAGTAGCCTGATTAAAACAGG - Intergenic
933358623 2:81248303-81248325 TAAAACAGCCTCCTTAAAACAGG + Intergenic
935551508 2:104462612-104462634 TCAAGTAGTATGGTTAAAACAGG - Intergenic
939410175 2:141814747-141814769 TTCAGGAGACTGGGTAAAACTGG + Intronic
940321499 2:152382114-152382136 TGAAACAACATGGTTAAAACCGG - Intronic
940852431 2:158701395-158701417 GAAGACAGCCTGGTTAAAACAGG - Intergenic
940986737 2:160058596-160058618 TGGAGCATCCTGGTGAAAACTGG - Intronic
942283749 2:174392915-174392937 GTAAACAGGCTAGTTAAAACAGG + Intronic
943714936 2:191140933-191140955 TGCAGCAACCTGGATAAAACTGG + Intronic
944736724 2:202573643-202573665 CTAAGAAGCCTGGTTAATAGAGG - Intergenic
948606358 2:239138272-239138294 TTAAGCAGCCTGGAGACAAAGGG + Intronic
1175146040 20:56897169-56897191 ATAAGCAGCCAGGTTACATCTGG - Intergenic
1178929535 21:36805466-36805488 TTAAGCAGCCTGATTGAACGTGG + Intronic
949328979 3:2900330-2900352 TATACCAGCCTGGTTAAAAGTGG + Intronic
951309539 3:21106831-21106853 TTAAGAAGCCTGGGTAAAGGAGG - Intergenic
957825230 3:85433380-85433402 TTTAGCAGCCTATTTGAAACAGG - Intronic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
964200875 3:154117824-154117846 TGAAGGAGTCTGGATAAAACTGG - Intergenic
964709105 3:159652856-159652878 TTCAGCAACATGGATAAAACTGG + Intronic
973714101 4:53657638-53657660 ATGCGCAGCCTGTTTAAAACAGG - Intronic
974963564 4:68732902-68732924 TTAAGAAGCGTGGTTACAAAGGG + Intergenic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
977440884 4:97066051-97066073 TAAAGCAGCCTGATTTAAAGAGG + Intergenic
979519192 4:121646565-121646587 TCATGCAGCCTGGTAAAACCTGG - Intergenic
980503512 4:133685834-133685856 TTAAGCAGCCAGGAAACAACAGG - Intergenic
983037052 4:162879712-162879734 TTAAGCACCCTGTTTTAAATGGG + Intergenic
984373630 4:178899343-178899365 TTAAGCAGTCTGGAGAACACAGG - Intergenic
991766465 5:69986469-69986491 TAAAGCAGCGTTGTTCAAACCGG + Intergenic
991780849 5:70131636-70131658 TAAAGCAGCGTTGTTCAAACCGG - Intergenic
991845698 5:70861554-70861576 TAAAGCAGCGTTGTTCAAACCGG + Intergenic
991873295 5:71131949-71131971 TAAAGCAGCGTTGTTCAAACCGG - Intergenic
992261551 5:74975648-74975670 TGAAGCAGCCTGGATAACTCGGG + Intergenic
999001643 5:147930126-147930148 TGAAGCAGCATGGAGAAAACCGG - Intergenic
1001460274 5:171906119-171906141 CTAAGCAGCTGTGTTAAAACTGG - Intronic
1003087323 6:3070236-3070258 TTAAACAGCCTCTTTCAAACTGG + Intronic
1005217449 6:23547813-23547835 TTGAGCAGCCTAGTCAAGACTGG + Intergenic
1006549129 6:34806046-34806068 TTAATCAGACTTGTTAAACCAGG - Intronic
1006710799 6:36068543-36068565 TTAAGCACCCTGTTTAAATATGG + Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1010606908 6:77901543-77901565 ATAAACAGCCTGATTAAAAATGG - Intronic
1010882132 6:81190586-81190608 TGCAGCAGCATGGATAAAACTGG + Intergenic
1015085092 6:129280990-129281012 TTATGCATCCTGGTTGAAACAGG - Intronic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1020671213 7:11115284-11115306 GTAAGCAGAATGGTTAAAAAGGG - Intronic
1020943093 7:14564696-14564718 CTAAGAAGTCTGGTAAAAACAGG - Intronic
1022262741 7:28722124-28722146 TAAATCAGCCTGTTTAAAACTGG + Intronic
1026626387 7:71996051-71996073 TTAGCCAGCCTGGTTTATACAGG - Intronic
1029992334 7:104973717-104973739 TTAAGCACCCTGGTTGATAGAGG - Intergenic
1030873784 7:114788669-114788691 TTAATCTGCATGGTTGAAACTGG + Intergenic
1031192580 7:118573104-118573126 GTAAGCAGACTGGTTAACAAAGG - Intergenic
1040401553 8:47055091-47055113 TTAAGCAACATGGATAAAGCTGG + Intergenic
1040470999 8:47736060-47736082 TTACCCAGCCTAATTAAAACAGG - Exonic
1042438510 8:68796651-68796673 ATAAGCATCCTGGTTTAAAATGG + Intronic
1043281686 8:78475722-78475744 TTATGCATCATGGTTAAAATAGG - Intergenic
1048299082 8:133238508-133238530 CTGAGCATCCTGGTTCAAACGGG - Exonic
1052748866 9:32468464-32468486 GAAATCAGCCTGGTTAACACAGG + Intronic
1192485653 X:71523316-71523338 TAAAACAGTCTGGTTAAAAATGG - Intronic
1197323452 X:125062839-125062861 TTAATCAGCCTGCTCAAAAGGGG - Intergenic