ID: 1118729734

View in Genome Browser
Species Human (GRCh38)
Location 14:68658023-68658045
Sequence ACAGCTCCTTGCCTTGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118729730_1118729734 14 Left 1118729730 14:68657986-68658008 CCACCTGGTAAAAATCTGCTCAT 0: 1
1: 0
2: 2
3: 13
4: 168
Right 1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 265
1118729729_1118729734 15 Left 1118729729 14:68657985-68658007 CCCACCTGGTAAAAATCTGCTCA 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 265
1118729728_1118729734 20 Left 1118729728 14:68657980-68658002 CCTGTCCCACCTGGTAAAAATCT 0: 1
1: 0
2: 1
3: 16
4: 557
Right 1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 265
1118729731_1118729734 11 Left 1118729731 14:68657989-68658011 CCTGGTAAAAATCTGCTCATTAT 0: 1
1: 0
2: 1
3: 11
4: 201
Right 1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118729734 Original CRISPR ACAGCTCCTTGCCTTGGCCC AGG Intronic
900305372 1:2004038-2004060 TCACCTCCAAGCCTTGGCCCTGG - Intergenic
900312758 1:2042301-2042323 ACAGCCCCCCACCTTGGCCCTGG + Intergenic
902818963 1:18932018-18932040 CCAGCTCGTTGCCTTGGCAGTGG - Intronic
903005527 1:20295680-20295702 CCAGCTGCCTGCCCTGGCCCTGG - Intronic
903662191 1:24984926-24984948 ACAGCTGCCTCCCCTGGCCCAGG - Intergenic
903766777 1:25740213-25740235 CCTGCTCCTTGCCTAGGCCCTGG - Intronic
903835815 1:26202655-26202677 ACAGCCCCTGGCCTCTGCCCAGG - Exonic
904043895 1:27599191-27599213 CCAGCCCCTGGCCCTGGCCCTGG - Intronic
904045381 1:27605172-27605194 ACAACTCCTTGTCATAGCCCAGG - Intergenic
904723909 1:32532185-32532207 ACAGCACCTGGCCCAGGCCCTGG - Intronic
905902281 1:41589468-41589490 AGGCCTCCCTGCCTTGGCCCCGG - Intronic
907111567 1:51931207-51931229 GCAGCTCCTTGCCTCTGCCAGGG + Intronic
907782285 1:57578173-57578195 ACAGCTCCCTGCTATGGCCATGG - Intronic
912748747 1:112268124-112268146 AGGGCTCATGGCCTTGGCCCAGG - Intergenic
912944903 1:114076693-114076715 TCAGTTCCTTCCCTTGGCCTTGG + Intergenic
914936900 1:151989518-151989540 AGAGTTCCTTGCTGTGGCCCTGG - Intronic
915583465 1:156830245-156830267 AGAGCTGCTGGCCTGGGCCCAGG - Intronic
915740155 1:158113288-158113310 AGAGCTCGGTGCCTTTGCCCGGG - Intergenic
916500999 1:165386852-165386874 CCAGCTGCTTACCTTGGACCTGG - Intergenic
916812124 1:168314780-168314802 AGAGCTCCAGGCATTGGCCCTGG + Intergenic
918148562 1:181779323-181779345 GCAGCTTCTTTCCTTGGGCCTGG - Intronic
920575071 1:207053326-207053348 ATCCCTCCCTGCCTTGGCCCCGG - Exonic
922505916 1:226125545-226125567 TCAGCTCCCTGTCTTGGCCAGGG - Intergenic
923535961 1:234852012-234852034 CCAGCTCCTTGCCTTGGGTGGGG + Intergenic
1062956614 10:1544382-1544404 GCAGCTCCACTCCTTGGCCCAGG + Intronic
1063605930 10:7522850-7522872 ACAGCTCTGTGCCTTGGCTTAGG - Intergenic
1071118447 10:82250803-82250825 ATAGCTCCTTGCCTGGTGCCTGG + Intronic
1072662275 10:97370355-97370377 AGAGCTCTGTGCCCTGGCCCTGG - Intronic
1073027931 10:100501954-100501976 GAAGGTCTTTGCCTTGGCCCTGG + Intronic
1074163854 10:110857889-110857911 GTACCGCCTTGCCTTGGCCCAGG - Intergenic
1074419312 10:113295035-113295057 AGAGCTCCCTGTCCTGGCCCAGG - Intergenic
1075014902 10:118903494-118903516 GGGGCTCCTTCCCTTGGCCCAGG - Intergenic
1075088901 10:119431835-119431857 ACAGCTCCCAGCCTGGGCCCAGG - Intronic
1075316978 10:121460687-121460709 AAAGCTCGTTTCCTGGGCCCTGG + Intergenic
1076659858 10:132048318-132048340 TCTGCTCCTGGCCTTGGCACCGG + Intergenic
1077343588 11:2036616-2036638 ACAGCTCCCAGCCCTGGCCCTGG - Intergenic
1078019278 11:7641771-7641793 ACTTCTCCTTCTCTTGGCCCTGG - Intronic
1079361135 11:19771465-19771487 ACACCTCCATGCCTTTGCTCAGG - Intronic
1080837809 11:35956587-35956609 CCAGTTCCTTGCCTTGACCTTGG + Intronic
1081670764 11:44941213-44941235 AGAGCTCCCAGCCTTGGCCGGGG + Intronic
1081762168 11:45584196-45584218 ACAGCTCCTCACCCTGCCCCAGG - Intergenic
1083631096 11:64095931-64095953 ACAGCTCCTCGCTTTCTCCCTGG + Intronic
1084021919 11:66422844-66422866 CCAGGTCCTGGCCCTGGCCCTGG + Exonic
1084065415 11:66701125-66701147 CCAGATCGTTGCCTAGGCCCTGG + Exonic
1084416405 11:69035404-69035426 ACAGCTCCCAGCCATGGCCAGGG + Intergenic
1084900460 11:72306346-72306368 ACTCCTCATTGCCTTGGCCAGGG + Intronic
1085018635 11:73191341-73191363 ACAGCACCTAGACGTGGCCCAGG - Intergenic
1085440505 11:76558261-76558283 ACTACTCCTTGCCCTGGTCCCGG - Intergenic
1086208306 11:84286779-84286801 ACAGCTCCTTTCCATGGCTCAGG - Intronic
1089160416 11:116432747-116432769 CCAGCTCCTCGCCTAGGGCCTGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1089627117 11:119758345-119758367 ACATCTCCTTGCCTTTGCAAGGG + Intergenic
1202826574 11_KI270721v1_random:91805-91827 ACAGCTCCCAGCCCTGGCCCTGG - Intergenic
1092872053 12:12813916-12813938 AAAGCACCTGGCCTTGGCCTTGG + Intronic
1095405285 12:41861092-41861114 GCAGATGCCTGCCTTGGCCCAGG + Intergenic
1096072523 12:48783188-48783210 CCAGCTCCTTGCCCTTGCCTGGG + Exonic
1096117121 12:49061043-49061065 ACTGCCCCTTGCTTTGGCCAGGG + Intergenic
1096368508 12:51048566-51048588 AGAGTTCCACGCCTTGGCCCTGG + Intronic
1097160873 12:57045823-57045845 AGAGCCCCTTGGCTTGGCCTGGG - Intronic
1100242445 12:92723096-92723118 ACGCCTCCATGCCTTGGCTCAGG - Intronic
1101119241 12:101562072-101562094 ACACCTGCTTGCCTTTGCCCTGG + Intergenic
1103322671 12:120101048-120101070 AAAGCCCCTTTCCTGGGCCCCGG - Intronic
1103735820 12:123060267-123060289 TGAGCTCCTTGCCTTGGCACTGG + Intronic
1103903657 12:124316309-124316331 GCAGCTCCTTGGATGGGCCCGGG + Intergenic
1106802097 13:33266645-33266667 ACAGCTTCTTCCCATGGCTCAGG + Intronic
1109321033 13:60810155-60810177 ACAGCTGTCTGCCTTGACCCTGG - Intergenic
1110014647 13:70386097-70386119 GCAGCTCCAGGCCTTGGCACAGG + Intergenic
1110582959 13:77153310-77153332 AGAGGTGCTTGCCTGGGCCCTGG + Intronic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1111964619 13:94848192-94848214 GCAGCTCCTTGCGCTGGCACTGG - Intergenic
1112401835 13:99085321-99085343 GCAGCTCCTTGCGTTGCCGCCGG - Intronic
1113522922 13:110953442-110953464 ACAACACCTGGCCATGGCCCAGG - Intergenic
1113652264 13:112042336-112042358 ACAGCTCCTTTCCCTGCTCCTGG - Intergenic
1113702453 13:112397379-112397401 ACAACACCTGGCCATGGCCCAGG + Intronic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1122307356 14:100774188-100774210 ACAGCTCCCGGCCTTGGCGCTGG - Intergenic
1122541083 14:102497907-102497929 ACAGCACCTTGTCCTTGCCCAGG - Intronic
1122836074 14:104431720-104431742 ACTGCCCCTTCCCTTGGCCCAGG - Intergenic
1123699694 15:22905030-22905052 ACAGTTCCTTTCCTTGGCTCTGG + Intronic
1124597262 15:31101709-31101731 CCAGCTCCCTGCCCTGGCCAAGG - Intronic
1125202319 15:37110883-37110905 ACAGCGGCTTCCCTTGGCGCCGG - Intergenic
1126358699 15:47823339-47823361 AGAGCTCCTTCCTTGGGCCCTGG - Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127403118 15:58612300-58612322 ACAGCTCCTCAACTTGGCCAAGG - Intronic
1128087226 15:64894628-64894650 ACACCTCCCTGCCTTTGCCCAGG - Intronic
1128791041 15:70434171-70434193 GCTTCTCTTTGCCTTGGCCCTGG - Intergenic
1129032438 15:72628925-72628947 ACAGCTCCTTGGGCTGGACCAGG - Intergenic
1129032565 15:72629463-72629485 ACAGCTTCTTCCCTGGGCCAGGG - Intergenic
1129217451 15:74108314-74108336 ACAGCTCCTTGGACTGGACCAGG + Intronic
1129319850 15:74768379-74768401 AGAGCTCCTGGCCTTTTCCCCGG - Intergenic
1129665524 15:77577468-77577490 ACTGCTCCATGCCCAGGCCCTGG - Intergenic
1130046988 15:80453275-80453297 ACAGGTCCTGCCCTTGCCCCTGG - Intronic
1130261148 15:82355314-82355336 ACAGCTCCTCACCTTCGCCGCGG - Intergenic
1130280087 15:82513704-82513726 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130471462 15:84229890-84229912 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130478956 15:84344461-84344483 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130492814 15:84443670-84443692 ACAGCTCCTCACCTTCGCCGCGG - Intergenic
1130593756 15:85234517-85234539 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130932317 15:88438309-88438331 ACAGCTCTGGGCCTGGGCCCTGG + Intergenic
1132293312 15:100718207-100718229 GCAGCGCGCTGCCTTGGCCCTGG - Intergenic
1132404383 15:101533492-101533514 ACTGCTCCCTGCCCTGGCCCTGG + Intergenic
1132502182 16:289462-289484 GCAGCTCCTTGAACTGGCCCAGG + Exonic
1132667543 16:1089097-1089119 ACCGTTCCTTTCCCTGGCCCTGG - Intergenic
1132941861 16:2512520-2512542 CCAGCTCCTTGCCCTTGCCAAGG - Intronic
1133317164 16:4892039-4892061 GCAGCTGCTGGACTTGGCCCAGG - Exonic
1133747153 16:8696022-8696044 AAAGCTCCTTGCCTTGGAGCGGG - Intronic
1133779915 16:8930071-8930093 ACACCTCCTTGCCTAGGCTAGGG + Intronic
1135106761 16:19656413-19656435 ACATCTCCATGCCTTTGCTCAGG - Intronic
1135149649 16:19994617-19994639 ACAGCTCCTGGCCTGGAGCCTGG + Intergenic
1135435651 16:22425222-22425244 CCAGCTCATTTCCATGGCCCGGG + Intronic
1136146697 16:28320552-28320574 ACACCTCCTTGGCTGGGCCGCGG - Exonic
1136461935 16:30416893-30416915 ACAGGGTCTTGCCGTGGCCCAGG - Intronic
1136550937 16:30982209-30982231 ACCGCGCCTGGCCATGGCCCTGG - Intronic
1138337482 16:56264466-56264488 ACAAGTCCTGGCCTTGCCCCTGG + Intronic
1139475932 16:67202558-67202580 TCAGCCCCCTGCCCTGGCCCAGG - Intronic
1140408967 16:74730008-74730030 AAACCTCCTTCCCCTGGCCCTGG + Intronic
1141702877 16:85650478-85650500 AGAGCTCCTGGCCTAGACCCAGG + Intronic
1142044858 16:87919026-87919048 CCAGCTCATTTCCATGGCCCGGG + Intronic
1142271762 16:89093691-89093713 ACGGCGCCTTGCCTCGGCCACGG + Intronic
1142287675 16:89177999-89178021 CCAGCTCCTAGCCTGGGCCTTGG - Intronic
1142429015 16:90016452-90016474 ACACCTGCTTGCCTCTGCCCTGG - Intronic
1143014772 17:3885811-3885833 CCACCTCCATGCCTTTGCCCTGG + Intronic
1143383521 17:6510879-6510901 TCAGCTTCCTGCCTTTGCCCCGG - Intronic
1143865026 17:9917281-9917303 ACAGCTCCCTGTCTTTGGCCGGG + Exonic
1144840359 17:18182332-18182354 TCACCTCCTGGCCTTTGCCCAGG - Intergenic
1145310589 17:21699044-21699066 TGAGCACCTTGTCTTGGCCCTGG + Intronic
1145751995 17:27361767-27361789 ACTTCTCCTTGCCTTTGCACAGG + Intergenic
1145960255 17:28883046-28883068 ACACCTCCCTGCCTTGGCTTAGG + Intronic
1148867125 17:50634664-50634686 ACATCCCCCTGGCTTGGCCCAGG + Intergenic
1151404378 17:73877235-73877257 ACAGCCCCTTGCTGTTGCCCAGG - Intergenic
1152240352 17:79157631-79157653 ACAGCTCCTCTCCTTGTCCCAGG + Intronic
1152418920 17:80181564-80181586 ACAGCACCTTGGCCTGGCGCAGG - Exonic
1152744757 17:82033571-82033593 ACAGGGCCTGGCCATGGCCCGGG + Exonic
1153995161 18:10434245-10434267 AAAGCCCCTTGACCTGGCCCAGG + Intergenic
1154475251 18:14748560-14748582 CCAGCTTCTGGACTTGGCCCCGG - Exonic
1157178148 18:45469761-45469783 ACACCTCCTTGCCTTTGCCTTGG - Intronic
1157696242 18:49726044-49726066 AGAGCTCTTTGACTTGGTCCTGG + Intergenic
1160828865 19:1093550-1093572 CCAGCTTCTTGGCCTGGCCCAGG - Intronic
1160832730 19:1111215-1111237 TCCGCTCCTGGCCCTGGCCCTGG - Intronic
1161124248 19:2546938-2546960 GCTGCCCCTTGCCCTGGCCCGGG - Intronic
1161314210 19:3610355-3610377 ACAGCTGCTGGCCTGGGCCCAGG - Intergenic
1161553786 19:4929060-4929082 ACAGCCCCCTGGCATGGCCCAGG + Intronic
1161839007 19:6667378-6667400 ACACCTCCTTCCCTGGGGCCAGG + Intronic
1162111433 19:8401966-8401988 ACTGCCCCTTGGCTCGGCCCTGG + Intronic
1162657292 19:12140523-12140545 ACAACTCCTTCCCTGAGCCCTGG + Intronic
1163149417 19:15402170-15402192 ACAGCTCTTTTTCTTGTCCCTGG - Intronic
1165059893 19:33199978-33200000 ACAGCGCCTTGCCCTGCCCCTGG + Intronic
1166050749 19:40257354-40257376 CCAGCTCCTGGCCTAGTCCCAGG + Intronic
1166348328 19:42180579-42180601 CCTGTTCCCTGCCTTGGCCCTGG + Intronic
925594309 2:5539932-5539954 ACAGCTCCCTCCCCTGACCCTGG - Intergenic
925825469 2:7844344-7844366 AGAGCTCCTTGCTGAGGCCCTGG + Intergenic
927702739 2:25278141-25278163 ACTGCTCCTGGCCCAGGCCCAGG + Intronic
927840293 2:26437409-26437431 GCAGCTCCCTGCCCTGCCCCAGG + Intronic
929517089 2:42613432-42613454 ACAGCTCCATGCCTTGGCCAGGG - Intronic
933764047 2:85695209-85695231 CCAGCTCCTGTCCTAGGCCCTGG + Intronic
935951660 2:108335290-108335312 ACTAGTCCTGGCCTTGGCCCTGG + Intergenic
936463762 2:112729409-112729431 ACCGCGCCTGGCCTTGGCCTGGG + Intronic
936969967 2:118167997-118168019 AAAGCTCCTAGCCCAGGCCCTGG + Intergenic
938093436 2:128447643-128447665 CCAGCACCTTGCCCAGGCCCAGG - Intergenic
938949914 2:136246080-136246102 TGAGCCCCTTGCCTTGGCCAGGG - Intergenic
942358686 2:175148492-175148514 ACAGACCCTTCCCTTGGCCCAGG + Intronic
945006417 2:205412121-205412143 CCAGCTACCTGCCTTTGCCCTGG + Intronic
946030576 2:216700837-216700859 ACAGCTCTATGCAATGGCCCTGG + Intergenic
948207309 2:236168864-236168886 CCAGCTCCCAGCCTTCGCCCCGG - Intergenic
949058170 2:241940821-241940843 AGAGGTCCTGGCCTTGTCCCAGG - Intergenic
1168972334 20:1939136-1939158 ACATCTGCTTGCCCTGGGCCCGG - Exonic
1170926157 20:20726240-20726262 TCACCTCCTTGCCTTGACCTTGG - Intergenic
1171881381 20:30620156-30620178 ACAGGTCCATGCCTGGGTCCAGG + Intergenic
1172016062 20:31873917-31873939 CTAGCTCCTTACCATGGCCCTGG + Intronic
1172776035 20:37407593-37407615 ACACCTCCATGCCTTTGCCCAGG + Intergenic
1173591595 20:44229081-44229103 ACAGCTCCTGGCCCTGGTGCCGG + Intergenic
1174375653 20:50124932-50124954 ACATCTCCTGGGCTGGGCCCAGG - Exonic
1175230676 20:57471494-57471516 ACAGTCCCCTGCCCTGGCCCAGG + Intergenic
1175415078 20:58795756-58795778 ACAGTCCCTTCCCTTGACCCTGG + Intergenic
1175890738 20:62314813-62314835 AGAGCTCATTGCCCAGGCCCGGG - Exonic
1176062835 20:63179704-63179726 TCTGCTCCCTGCCTTGGGCCTGG - Intergenic
1176367161 21:6040068-6040090 ACAGCCACTGGCCCTGGCCCTGG - Intergenic
1178937536 21:36876038-36876060 GCAGCTCCATGCCCTGGCACGGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1179756358 21:43498478-43498500 ACAGCCACTGGCCCTGGCCCTGG + Intergenic
1179802542 21:43817730-43817752 GCAGCTCCATGCCATGGCCAAGG + Intergenic
1180354086 22:11824583-11824605 TCAGCCCCTTCCCTGGGCCCTGG - Intergenic
1180384159 22:12167742-12167764 TCAGCCCCTTCCCTGGGCCCTGG + Intergenic
1180840742 22:18957769-18957791 ACAGCTCCTCACCTTGGACAGGG - Intergenic
1181734036 22:24868220-24868242 ACTGCTCCTGACCTTTGCCCAGG + Intronic
1182301943 22:29341912-29341934 ACAGGGCCATGCCCTGGCCCCGG + Intronic
1183832442 22:40425502-40425524 TCAGGTCCTGGCCCTGGCCCTGG - Intronic
1184107887 22:42379042-42379064 CCAGATCCTGGCCTTGGCTCAGG - Intergenic
1184484081 22:44765671-44765693 GCTGCTCCTGTCCTTGGCCCGGG - Intronic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1185184120 22:49382385-49382407 ACAGCTCCCGGCCTTGGCACTGG - Intergenic
949114881 3:309028-309050 GCAGCTCCTCGCCAGGGCCCCGG + Intronic
949441378 3:4084554-4084576 TTAGCTCCTTGCCTTGGTTCTGG - Intronic
950420383 3:12895325-12895347 AGAGCTCCCTGCCTTGGCACTGG - Intergenic
950497118 3:13340443-13340465 ACAGCCCCCAGCATTGGCCCAGG - Intronic
950851334 3:16064657-16064679 AGAGCTCCTTTCCTTAGCTCTGG + Intergenic
952268367 3:31808288-31808310 ACCTCTCCTTGCCTTGCCCCAGG - Intronic
953732955 3:45465577-45465599 CCAGCATCTCGCCTTGGCCCCGG - Intronic
954407752 3:50354976-50354998 GCAAATCCTTGCCTTGGCTCAGG + Exonic
954681696 3:52349538-52349560 CCAGCTCCTTCCCTTGGCCTGGG - Intronic
954961517 3:54569496-54569518 CCAGCTCCTTCCCTTGGCTAGGG - Intronic
955161424 3:56468292-56468314 ACCTCTCGTCGCCTTGGCCCCGG + Exonic
955328272 3:58026308-58026330 ACTCGTCCCTGCCTTGGCCCTGG + Intronic
960955717 3:123029048-123029070 ACTGCTTCTTGCCATGGTCCAGG - Intergenic
961443829 3:126968813-126968835 CCACCTCATTGCCCTGGCCCTGG + Intergenic
963258731 3:143172509-143172531 ACAGCTACTTGTCATGGTCCAGG - Intergenic
964409937 3:156387261-156387283 TCAGCTCCCTGGCTTGGCCTCGG - Intronic
965468401 3:169060631-169060653 ACATCTCCTATCATTGGCCCTGG - Intergenic
965544684 3:169903480-169903502 ACAGCTCATTGTATTGGGCCTGG + Intergenic
967910319 3:194537394-194537416 ACAGCTCCCTTCCTGGGGCCTGG + Intergenic
967939638 3:194756161-194756183 ACAGTTCCTGGCCCTGGTCCAGG + Intergenic
968983880 4:3865144-3865166 CCACCTCCCTGCCTGGGCCCAGG + Intergenic
969466808 4:7362130-7362152 ACAGCCCCCTGCCTTTGCACAGG - Intronic
971355195 4:25888945-25888967 ACAGCTAAGTGCCTTGGCCCTGG + Intronic
971938949 4:33189307-33189329 CCAGCTCCTTGCTTTGGGCTTGG + Intergenic
972195621 4:36650195-36650217 ACAGTTCCTTCTCTTGGTCCTGG - Intergenic
975473268 4:74794262-74794284 ACTGCTCCTGGCCCTTGCCCTGG - Exonic
978478281 4:109157777-109157799 ACAGCTCCCTGCTTATGCCCAGG + Intronic
979184430 4:117770892-117770914 CCAGCTGGTTGCCTTGGCACTGG - Intergenic
979687355 4:123525546-123525568 ACAGTTCCTTGTCTTTGCCTTGG + Intergenic
981395425 4:144242497-144242519 ACACATCCTTGCCTTGTTCCAGG + Intergenic
981495650 4:145389231-145389253 ACAGCTCCTTCCCATGTCACAGG + Intergenic
985146971 4:186903470-186903492 ACACTCCCTTGCCTGGGCCCTGG + Intergenic
985478051 5:90958-90980 TCAGCTCCCTGCCTGGGCTCAGG + Intergenic
985559759 5:578725-578747 ACACTTCCTTGCCTTCTCCCTGG - Intergenic
985589971 5:759485-759507 AAAGCTCCTTGCTGTGGCCCAGG - Intronic
985888456 5:2698020-2698042 ACAGCTGCTTTCTCTGGCCCTGG - Intergenic
990415999 5:55587408-55587430 ACAGCTCATATCCTTTGCCCTGG + Intergenic
995346615 5:111127674-111127696 ACAGCGACTTGCCTTGGGCAAGG - Exonic
995911277 5:117189977-117189999 ACAGCTCCTTTCTCTGGCTCAGG + Intergenic
998398885 5:141837373-141837395 ACAGCGCCCAGCCTTGGGCCGGG - Intergenic
998410505 5:141907016-141907038 ACAGCTCCTGGGCTTGTTCCTGG - Intergenic
998509224 5:142697618-142697640 TCACCTCTTTGCCTTGGCTCTGG + Exonic
999467987 5:151825171-151825193 CCAACTCCTCTCCTTGGCCCTGG - Intronic
1000227635 5:159281417-159281439 ACAGGGCCTTGCTTAGGCCCTGG - Intronic
1001250191 5:170141167-170141189 CCAGCTCCTTGTATTGGGCCCGG + Intergenic
1001352420 5:170981604-170981626 GCTGCTCCTTGCCTTGTGCCAGG + Intronic
1001659147 5:173377705-173377727 GCAGCTCCTTGCCTTCCCTCTGG + Intergenic
1001877912 5:175216946-175216968 CCATCTCCCTGCCTTGGCACAGG - Intergenic
1002461744 5:179377285-179377307 ACACCTGCCTGCCTTGGCACAGG - Intergenic
1003860212 6:10316036-10316058 ACAGCTCCATGCCCTGGCAGTGG + Intergenic
1006189890 6:32201304-32201326 GCAGCTGTTTGCCCTGGCCCGGG - Exonic
1007636087 6:43300596-43300618 ACACTTCCTTGCCCAGGCCCAGG - Intronic
1007975833 6:46100404-46100426 GCAGCTCCCTGACTTTGCCCTGG + Intergenic
1008071944 6:47106875-47106897 ATACCTCCATGCCTTGGCACTGG + Intergenic
1010198789 6:73264736-73264758 TCTTCTCCCTGCCTTGGCCCTGG - Intronic
1010359754 6:74979025-74979047 ACAGTCTCTTCCCTTGGCCCTGG - Intergenic
1010553010 6:77246055-77246077 AGAGCTCCTTGCATTGGCTCTGG - Intergenic
1011516957 6:88165934-88165956 CCAGCGCCTTCCCTTGGCCCGGG - Exonic
1015254736 6:131165610-131165632 AGAGCTCTTTGCCTGGGGCCTGG + Intronic
1017821114 6:158049640-158049662 ACAGCTGCTTCCCTGGGCTCAGG - Intronic
1017860292 6:158391390-158391412 ATGGCTCCCTGCCTTTGCCCTGG - Intronic
1019283005 7:210031-210053 ACAGCCCCGTGCCTGAGCCCGGG + Intronic
1019616680 7:1966115-1966137 AGCGCTCCTGGCCTTGGCCTGGG - Intronic
1020274477 7:6615964-6615986 TCAGCCCCTTCCCTTGGCCCAGG + Exonic
1024550412 7:50558420-50558442 ACAGCTGCTGGCCTGGGGCCTGG + Intronic
1024717897 7:52101398-52101420 AAAGGTTCTTGCCTTTGCCCAGG + Intergenic
1024783988 7:52885561-52885583 ACACGTCCTTTCCATGGCCCAGG + Intergenic
1026976082 7:74499254-74499276 ACAGCTCACTGCCTTGGACTAGG + Intronic
1029443234 7:100599776-100599798 TCAGCTCCTTGCCTGAGCCCAGG - Intronic
1029474465 7:100774893-100774915 ACGCCTCCTAGCCCTGGCCCTGG + Intronic
1030823675 7:114127332-114127354 ACAGGTCCTTGCCATGGTCAAGG + Intronic
1034213140 7:149382593-149382615 ACACCCCCTTACCCTGGCCCAGG - Intergenic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1042668997 8:71240197-71240219 CAAGCCCCTTTCCTTGGCCCTGG + Intronic
1044535778 8:93354987-93355009 ACAGCTTCTTTTCTTTGCCCAGG - Intergenic
1047218496 8:122899095-122899117 CCAGCTCAGTGCCTTGGGCCAGG - Intronic
1049156028 8:141067349-141067371 TCAGCTCCTGGGCTGGGCCCAGG - Intergenic
1049294425 8:141823652-141823674 ACAGCTCCCTGCCTTGAGACAGG + Intergenic
1051755848 9:20399379-20399401 ACAGCTCTTTGCATGGTCCCTGG - Intronic
1056567481 9:87787062-87787084 ACAGCTGCTTGCCTTGGTTGAGG + Intergenic
1056972043 9:91213351-91213373 ACAGCTTCTTGACCTGGCCTGGG + Intergenic
1058419745 9:104822383-104822405 TGTGCTCCTTCCCTTGGCCCAGG + Intronic
1061093281 9:128439054-128439076 ATGGCTCCTGGCCTTGGCCATGG + Intergenic
1061185379 9:129049816-129049838 ACAGCTCCATGCCTGAGCACAGG - Exonic
1061216351 9:129224148-129224170 CCAGCACCCTGCCTGGGCCCAGG - Intergenic
1061423367 9:130484116-130484138 ACTGCTTCTCACCTTGGCCCTGG + Intronic
1061777149 9:132973182-132973204 GCAGCTTCTGGCCTTGGCCCAGG - Intronic
1061836405 9:133332742-133332764 ACAGCTCCTTGGCACTGCCCTGG + Exonic
1061871406 9:133522615-133522637 ACACCTCCCTGCCTGGGCCTAGG - Intronic
1062571391 9:137187263-137187285 ACAGATTCATGCCTTGACCCTGG - Intronic
1062592873 9:137281831-137281853 CCAGCTCCTTCCCCTAGCCCTGG - Exonic
1185661700 X:1733571-1733593 ACTGCTCCTTGCTTCAGCCCAGG - Intergenic
1185745233 X:2567221-2567243 ACAACTCCTTGGCTTGCACCTGG + Intergenic
1187735724 X:22302108-22302130 GCAAATCCATGCCTTGGCCCTGG + Intergenic
1188443907 X:30236931-30236953 AGAGCTGCTAGCCTTGGCCTTGG - Exonic
1190909651 X:54759090-54759112 ACAGCTCCTTATCTTTGCTCAGG + Intronic
1192196395 X:69031634-69031656 TGACCTCCTTACCTTGGCCCTGG + Intergenic
1192437753 X:71153358-71153380 CCAGCTCCGGGCCTGGGCCCAGG - Intronic
1195858042 X:109351861-109351883 ACAGCTCATTATCATGGCCCAGG + Intergenic
1199645587 X:149907557-149907579 TCAGCTCTCAGCCTTGGCCCAGG - Intergenic
1199711574 X:150473372-150473394 ACAGGTGCTTCCCTTGGGCCAGG - Intronic
1200104664 X:153705699-153705721 GCAGCTCCTTGCCGGGGGCCTGG - Intronic
1200829784 Y:7679112-7679134 ACATATCCTGGCCCTGGCCCTGG + Intergenic
1201730036 Y:17192984-17193006 ACAGCTCCTTGGCACTGCCCTGG - Intergenic
1201905048 Y:19078867-19078889 ACAGAGTCTTGCCGTGGCCCAGG - Intergenic