ID: 1118730882

View in Genome Browser
Species Human (GRCh38)
Location 14:68665496-68665518
Sequence TTATAGACACAGTTTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118730882_1118730891 14 Left 1118730882 14:68665496-68665518 CCCATCCCAAACTGTGTCTATAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1118730891 14:68665533-68665555 GAAGACACTGGTATTAGAGCTGG 0: 1
1: 0
2: 2
3: 6
4: 142
1118730882_1118730890 2 Left 1118730882 14:68665496-68665518 CCCATCCCAAACTGTGTCTATAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1118730890 14:68665521-68665543 AGGCTCTGGAGGGAAGACACTGG 0: 1
1: 0
2: 6
3: 40
4: 382
1118730882_1118730888 -9 Left 1118730882 14:68665496-68665518 CCCATCCCAAACTGTGTCTATAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1118730888 14:68665510-68665532 TGTCTATAATCAGGCTCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1118730882_1118730889 -8 Left 1118730882 14:68665496-68665518 CCCATCCCAAACTGTGTCTATAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1118730889 14:68665511-68665533 GTCTATAATCAGGCTCTGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 91
1118730882_1118730892 21 Left 1118730882 14:68665496-68665518 CCCATCCCAAACTGTGTCTATAA 0: 1
1: 0
2: 1
3: 14
4: 195
Right 1118730892 14:68665540-68665562 CTGGTATTAGAGCTGGTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118730882 Original CRISPR TTATAGACACAGTTTGGGAT GGG (reversed) Intronic
903025230 1:20424706-20424728 TTATATATAAATTTTGGGATTGG - Intergenic
908002908 1:59698454-59698476 TTATAGAAACACTTTGGTAATGG - Intronic
910599622 1:89017127-89017149 TAATCAACACAGTTTGGTATTGG + Intronic
911337669 1:96600546-96600568 TTATAGACACTGTCTTGTATGGG - Intergenic
911503585 1:98720102-98720124 TTATTGACACAGTATGGTCTTGG - Intronic
912896445 1:113596169-113596191 TGATAAAGACAGTTTGGTATTGG + Intronic
916869892 1:168902352-168902374 TTATATAAACAGATTGGGGTTGG + Intergenic
917273310 1:173302613-173302635 TTGTAAAAACAGTATGGGATTGG - Intergenic
917729478 1:177860395-177860417 TAATAGTCATATTTTGGGATTGG - Intergenic
921485855 1:215714718-215714740 TTATAAACACAGTTTGTTAAAGG - Intronic
922627086 1:227059514-227059536 ATAAAGCCACAGTTTTGGATAGG + Intronic
922913856 1:229239726-229239748 TTATAGGCACAGGATGGGAGTGG + Intergenic
924679638 1:246219234-246219256 TTATAGGCACAGGGTGGGGTGGG - Intronic
1068802738 10:61160884-61160906 TTCTAGACACTGTTGGGAATTGG - Intergenic
1074879693 10:117646025-117646047 TTATAGTTACAGCTTGGGCTGGG - Intergenic
1075229276 10:120659340-120659362 TTAGGGACACAGCTTGGTATTGG + Intergenic
1078123254 11:8532132-8532154 TTACAGAATCAGTCTGGGATGGG - Intronic
1079598592 11:22284604-22284626 TTATAGAAATACTTTGGGCTAGG - Intergenic
1079738350 11:24026026-24026048 TTATGGACACAGGTTGGAACAGG + Intergenic
1080575267 11:33593133-33593155 TTATAGGCTCACTTTGGGCTGGG + Intronic
1081131177 11:39381896-39381918 TTATAGGCACAGGATGGGGTGGG + Intergenic
1082274534 11:50207274-50207296 TCAGAGACAGAGTTTTGGATTGG + Intergenic
1084977501 11:72810626-72810648 TGATAGACGCTGATTGGGATGGG + Intergenic
1085061861 11:73454659-73454681 TTATAGGCACAGGATGGGGTGGG - Intronic
1085197507 11:74681485-74681507 TTATAGACCCAGATGGGGGTGGG - Intergenic
1085603401 11:77875895-77875917 GTACAGAGACAGTTTGGGACAGG + Intronic
1086162433 11:83737571-83737593 TTATAAACACAGATTGGAAAAGG + Intronic
1086783025 11:90930765-90930787 TTATAGGCACAGGATGGGAAGGG - Intergenic
1087159899 11:94938527-94938549 TTATAGAGACAGTTGGGAGTCGG + Intergenic
1088301577 11:108363526-108363548 TTATTGTCACAATTGGGGATGGG + Intronic
1091139061 11:133219871-133219893 TTACAATCACAGTTTGGGAAGGG - Intronic
1091769511 12:3141911-3141933 TTATAGGGACAACTTGGGATGGG - Intronic
1092850860 12:12625090-12625112 TTATAGGCACAGGATGGGGTGGG + Intronic
1094095835 12:26703538-26703560 TTATTGTCACAGTTAGGGAATGG - Intronic
1095558909 12:43542190-43542212 TTTTGGAGACAGTTTGGGAGAGG - Intronic
1097374023 12:58819120-58819142 TTATAGGCACAGGCTGGGGTTGG - Intergenic
1098608229 12:72420945-72420967 TTACAGACTCATTATGGGATTGG + Intronic
1099440552 12:82694014-82694036 TTTTAGAAGCATTTTGGGATTGG + Intronic
1099494987 12:83335742-83335764 TTATAGACACAGGATGGGGGTGG + Intergenic
1100065804 12:90642300-90642322 TTATAGTTACAGGTGGGGATAGG + Intergenic
1100874324 12:98946212-98946234 TTCTAGAATCAGTTTGGGATGGG - Intronic
1105008788 12:132740510-132740532 ATAGAGACAGAGTTTTGGATAGG + Intronic
1109747280 13:66641784-66641806 ATACAGACACAGTTTTGCATTGG - Intronic
1110938281 13:81319105-81319127 TTATAGGCACAGGATGGGGTGGG - Intergenic
1111182580 13:84687800-84687822 TTATAGACACAGGATGAGGTGGG + Intergenic
1111606454 13:90545920-90545942 TTATAGGCATAGGATGGGATGGG + Intergenic
1111726275 13:92013460-92013482 TTATAGGCACAGGATGGGGTAGG + Intronic
1111972209 13:94928550-94928572 TTCTGGACACAGATAGGGATGGG - Intergenic
1116716382 14:48431570-48431592 TTATAGGCACAGGATGGAATGGG + Intergenic
1116738814 14:48729103-48729125 TTCTGGAAACAGTTTGGGAAAGG - Intergenic
1117989274 14:61417705-61417727 TTAGACACACAGCTTGGGAATGG + Intronic
1118408548 14:65451864-65451886 TTATAGGCACAGGATGGGATGGG + Intronic
1118488616 14:66237433-66237455 TTATAGACTCAGTTTTGAGTGGG - Intergenic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119908283 14:78325281-78325303 TTATAGCCACAGTGTTGCATAGG + Intronic
1120127259 14:80759857-80759879 ATATATACACAGTTTGTTATGGG - Intronic
1121177580 14:91902541-91902563 TTTTAGATACAGTTTTGCATTGG - Intronic
1123873569 15:24600673-24600695 TTATAGGCACAGGATGGGGTGGG - Intergenic
1125618119 15:41034263-41034285 TTATAGGCACATTATGGGGTTGG + Intronic
1126333818 15:47564793-47564815 TTATAGGCACAGGATGGGGTAGG - Intronic
1127217857 15:56843612-56843634 TTTTAAACTCAGTTTGGGCTGGG - Intronic
1128481576 15:68044678-68044700 TTATAGACATAGGCTGGGCTTGG - Intergenic
1129278282 15:74461770-74461792 TCATAGAATCAGTTTGGGAAGGG + Intergenic
1130134303 15:81169241-81169263 TTATAGGCACAGGATGGGATGGG - Intronic
1131107129 15:89742856-89742878 TTATAAAGACAGTTTGAGTTGGG - Intronic
1131520626 15:93111679-93111701 TTATATACACCTTTTGGGTTTGG - Intergenic
1133596500 16:7298585-7298607 TTATACACAAATTTTGGGCTGGG - Intronic
1134660256 16:15978809-15978831 TTGTTGTCACAGTTTGGGATGGG + Intronic
1135223352 16:20633998-20634020 TAATAGAAACAGTGTGGTATTGG + Intronic
1135921970 16:26658714-26658736 TTATAGAGATGGTTAGGGATGGG - Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1140925520 16:79579502-79579524 TTATAATCAAAGTTTGGTATCGG - Intergenic
1147249049 17:39142121-39142143 TCATTGTCACAGCTTGGGATGGG - Intronic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149067384 17:52496446-52496468 TTATAGGCACAGGATGGGGTTGG + Intergenic
1149072143 17:52556053-52556075 ACAAAGACACAGTTTGGAATTGG + Intergenic
1150323578 17:64237290-64237312 TTATACACACAGTATGAGACAGG + Intronic
1151105873 17:71616681-71616703 TTGTAGACAGTGTTAGGGATAGG - Intergenic
1156713542 18:39977522-39977544 TCATAGGCACAGGATGGGATGGG + Intergenic
1156905573 18:42348495-42348517 TTATAGACACAGGATGGGGGTGG - Intergenic
1157213302 18:45761970-45761992 TTATTGCCTCAGTTTGGGTTAGG - Intergenic
1157256653 18:46145563-46145585 TTTAAAACACAGTTTGGGCTGGG + Intergenic
1158053069 18:53247119-53247141 CTATACACACAGTTTGGACTTGG + Intronic
1158290229 18:55932451-55932473 TTATAGGCACAGGATGGGGTAGG - Intergenic
1159677096 18:71298833-71298855 CTAAAGATAGAGTTTGGGATGGG - Intergenic
1159727245 18:71976545-71976567 TTGTAGACAAACTTTGTGATAGG + Intergenic
1163014659 19:14447007-14447029 TTATAAACACAGTCTCGGCTGGG + Intronic
1164075741 19:21816550-21816572 TTCCAGCCACAGTTTGGGAGAGG + Intronic
1164953788 19:32363177-32363199 TTATGGTCAGAGTTTGGGCTTGG + Intronic
1164956146 19:32387452-32387474 TTAGTGACACAGTTTCAGATTGG - Exonic
1165343873 19:35231434-35231456 TTATATACAAATTTTGGAATCGG - Intergenic
1166290258 19:41858959-41858981 TTTTAGAAACAGTATGAGATAGG + Intergenic
925656542 2:6156042-6156064 TTATAGGCACAGGATGGGGTGGG - Intergenic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
930131169 2:47852376-47852398 TTATAGTCAAAGTATGGGACTGG - Intronic
930336815 2:50059397-50059419 ATAAAGATACAGTTTGGAATTGG + Intronic
930837428 2:55809070-55809092 TTAGAGACACAGATTGTGACAGG - Intergenic
931462920 2:62463807-62463829 TTATAGGCACAGGATGGGGTGGG - Intergenic
932123618 2:69123829-69123851 TTATAGACACGGTTTTGGAGAGG - Intronic
933162401 2:79039984-79040006 TTTTATACACAGATTAGGATTGG - Intergenic
938997497 2:136696082-136696104 TGATGTACACAGTTTGGGCTTGG + Intergenic
942307805 2:174625668-174625690 TTTTAGTCTCAGTTTGGGCTAGG + Intronic
944067433 2:195633835-195633857 TTATAGACACAGGGTGGGGTGGG + Intronic
944131662 2:196353801-196353823 TTATAGGCACAGGATGGGAGAGG - Intronic
1169975202 20:11317794-11317816 TTATTCTCACTGTTTGGGATGGG + Intergenic
1170472687 20:16684040-16684062 TTATATACACTGTTTTGGAAGGG + Intergenic
1171127121 20:22612064-22612086 TTATAGACAGAGATTGAGAATGG + Intergenic
1172724136 20:37024078-37024100 TTAAAGACATAGTTTGGGCCAGG - Intronic
1172884878 20:38224211-38224233 TGATAAACACAGTATGGGCTGGG - Intronic
1173172155 20:40736154-40736176 ATATAGATACAGGTTGGGGTTGG + Intergenic
1176230702 20:64031379-64031401 TTTAAGAAACAGTTTGGGACAGG + Intronic
1177438795 21:21090844-21090866 TTTGAGAAACAGATTGGGATAGG - Intronic
1179159222 21:38878238-38878260 TTATAAAAACAGGCTGGGATGGG + Intergenic
1181822924 22:25489591-25489613 TCATAGTCACCCTTTGGGATAGG + Intergenic
1182885757 22:33772640-33772662 TGATAGACAAAGTTGGGGAGGGG - Intronic
1183472757 22:38018305-38018327 TTATAGACAGAGTCAGAGATAGG + Intronic
1183810544 22:40253403-40253425 TTATAGAAAAAATTTGGGAGGGG + Intronic
952181425 3:30920537-30920559 TTATAGGCACAGGATGGGGTGGG - Intergenic
953237603 3:41120072-41120094 TTATAAACACAGGGTGGGGTTGG + Intergenic
955980030 3:64515515-64515537 TTCTAGAGACAGATGGGGATGGG - Intergenic
955992579 3:64643633-64643655 TTATAGAGACAGTTAGGGGTGGG + Intronic
956649725 3:71492999-71493021 TCATACAAAAAGTTTGGGATAGG + Intronic
958069405 3:88590586-88590608 TAATAGAGACAGCTGGGGATGGG - Intergenic
960472365 3:118082669-118082691 TTATAACCACACTTTGGAATAGG + Intergenic
961833629 3:129638817-129638839 TGATAGTCACAGCTTGGGCTGGG + Intergenic
967809084 3:193740755-193740777 TAATAGAGACAGTGTGGCATTGG - Intergenic
970562510 4:17296667-17296689 TTAAAAAAAAAGTTTGGGATAGG - Intergenic
971873345 4:32273073-32273095 TTATAGGCACAGGATGGGGTGGG + Intergenic
972300862 4:37784548-37784570 TTATAGGCACAGGATGGGGTGGG - Intergenic
974237256 4:59198212-59198234 TTAAAGACAAAGTATGGCATGGG - Intergenic
975387112 4:73770452-73770474 TTATAGGCACAGGATGGGGTGGG - Intergenic
975876512 4:78844565-78844587 TTATAAAAACAGTTTTAGATAGG + Intronic
977833883 4:101625232-101625254 TTATATATACAGCTTTGGATTGG + Intronic
983751738 4:171282343-171282365 TTACAGACAAAATTGGGGATGGG + Intergenic
983773513 4:171578200-171578222 TTATAGGCACAGAATGGGAAGGG + Intergenic
984037005 4:174681711-174681733 TTTAAGACACCGTTTGTGATAGG + Intronic
985786978 5:1901453-1901475 TTAGAGCCACTGGTTGGGATGGG - Intergenic
986588666 5:9346090-9346112 TTATAGGCACAGGATGGGGTGGG - Intronic
987606518 5:20142979-20143001 ATATAGAGGTAGTTTGGGATTGG + Intronic
988542655 5:32125580-32125602 TCACAGAGCCAGTTTGGGATGGG - Exonic
988603610 5:32661843-32661865 TTATAGGCACAGGATGGGGTTGG + Intergenic
992268123 5:75038159-75038181 TTACAGACCCAGTTTAGGTTAGG - Intergenic
992454279 5:76901975-76901997 TTCTAGACACACTTTGGGCCAGG - Intronic
994929456 5:106163232-106163254 TTATGGACCCAGTTGAGGATAGG + Intergenic
998610719 5:143685074-143685096 TAAAAGACACAGTTTAGGTTGGG - Intergenic
999392355 5:151202769-151202791 TGATAGACTCAGTGTGGCATTGG - Intronic
1000810648 5:165857313-165857335 TTATAGACACAGGATGGAGTGGG - Intergenic
1000866305 5:166518870-166518892 TTATAGGCACAGGATGGGGTAGG + Intergenic
1001570345 5:172726748-172726770 TTATACACACAGTGAGGGAAGGG - Intergenic
1001681239 5:173558489-173558511 TCATAGTCACAGCTGGGGATGGG - Intergenic
1003440222 6:6133896-6133918 TTATAGATAGAGTTTGGAAAAGG - Intergenic
1006725863 6:36198228-36198250 TTTCAGTCACACTTTGGGATTGG + Intronic
1007417059 6:41697510-41697532 TCATAGACACACTTGGGGAAGGG - Intronic
1007866252 6:44973141-44973163 TTACAGAGACACTTTGGAATTGG - Intronic
1010021086 6:71160845-71160867 GTATAGACACCGTTTAAGATTGG - Intergenic
1010337728 6:74706773-74706795 TTTTAAACACAGTTTGTTATAGG + Intergenic
1012907539 6:105085493-105085515 TTATAGACACAGACAGGGGTAGG - Intergenic
1013127432 6:107198088-107198110 CTATAAACAAAGTATGGGATGGG - Intronic
1014862120 6:126482128-126482150 GTATAGACACTGTTTGTGCTGGG + Intergenic
1014927402 6:127289917-127289939 TTTTAGGAACAGTTTGGGGTGGG - Exonic
1015925515 6:138306565-138306587 TAATAAACACAGTGTGGTATTGG + Intronic
1017233721 6:152098584-152098606 TTAAAGACCCACTTTAGGATGGG - Intronic
1018148326 6:160914697-160914719 ATTTCGACACAGTTTGGTATTGG - Intergenic
1018347525 6:162917353-162917375 TTTTAGACAGAGTTAGAGATTGG - Intronic
1018654802 6:166024962-166024984 TTATAGACACAGGATGGGGGTGG + Intergenic
1021008602 7:15433324-15433346 TGTTACACACAGTTTGTGATAGG - Intronic
1022262101 7:28716007-28716029 TTATATAAATAGTTTGGGAATGG - Intronic
1022787102 7:33649408-33649430 TTATGTACATGGTTTGGGATGGG + Intergenic
1024808940 7:53184418-53184440 TTATAGAAATAGGATGGGATGGG - Intergenic
1026190123 7:68118072-68118094 TCAGAGACAGAGTTTTGGATTGG + Intergenic
1026591033 7:71695724-71695746 TTCTATATTCAGTTTGGGATTGG + Intronic
1026896377 7:74012304-74012326 TTAGAGACCCAGGTTGGAATGGG + Intergenic
1028046873 7:86131037-86131059 TTATAGGCACAGGATGGGATGGG + Intergenic
1028821871 7:95220946-95220968 TTATATTCCCAGTTTGGGGTAGG - Intronic
1030235033 7:107249253-107249275 TCATTGTCACAGTTGGGGATGGG + Intronic
1032797618 7:135290347-135290369 TTATAGGCACAGGATGGGGTGGG - Intergenic
1033445026 7:141413286-141413308 TTACAGATACATGTTGGGATTGG - Intronic
1033802224 7:144914660-144914682 TTAAAAACAAAGTTTGGGAAAGG + Intergenic
1033853928 7:145534057-145534079 TACTAGATACACTTTGGGATGGG + Intergenic
1037387399 8:18358166-18358188 TTTTTGACACAGTATGGGAGAGG - Intergenic
1039173903 8:34781782-34781804 TAATAGACACAGTTTATGAAAGG - Intergenic
1039782741 8:40802838-40802860 TAATAAAGACAGTTTGGTATTGG + Intronic
1040683462 8:49842055-49842077 TTATAGGCACAGGATGGGAGTGG - Intergenic
1041993751 8:64027824-64027846 GGATGGACACAATTTGGGATAGG - Intergenic
1042251605 8:66761478-66761500 TTATAAAAATAGTTTGGGCTGGG + Intronic
1042443404 8:68854203-68854225 TTAAAGATGCAGTTTGTGATTGG + Intergenic
1043534160 8:81182634-81182656 TTATTTACAGACTTTGGGATTGG + Intergenic
1043707674 8:83372978-83373000 TTCTGGAGACAGTTTGGGATGGG + Intergenic
1043951252 8:86311539-86311561 TTATAGGCACAGGATGGTATGGG - Intronic
1044671998 8:94691596-94691618 TTATAGACAGAGTCTGGGACTGG + Intronic
1045834957 8:106508969-106508991 TTATAGAGATAGTTTGTAATAGG + Intronic
1045868322 8:106895256-106895278 ACATAGACATAGTTTGGGAGAGG + Intergenic
1046181246 8:110651622-110651644 TTAAAAACATAGTTGGGGATGGG - Intergenic
1046398734 8:113676077-113676099 TTATAGGCACAGGATGGGACAGG - Intergenic
1046717594 8:117584569-117584591 TTTCACACACACTTTGGGATTGG + Intergenic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1048731976 8:137452529-137452551 TTATAGAAAGAGTATGGAATTGG - Intergenic
1048777471 8:137963092-137963114 TAATTGACCCAGTTTGGGGTGGG - Intergenic
1050669513 9:7980231-7980253 TTATAGCCACACGTTGGCATAGG - Intergenic
1055468506 9:76588943-76588965 TTATAGAAAAAGTTTGGGCTGGG - Intergenic
1057006865 9:91568442-91568464 TTATAGACACAGGATGGGATGGG + Intronic
1060551989 9:124490017-124490039 TTATAGTCACAGTCTGCGAGGGG - Intronic
1188587302 X:31793185-31793207 TTATAGGCACAGGATGGGGTGGG + Intronic
1189475268 X:41347969-41347991 TTATAAATGCAGTTTGGGATGGG - Exonic
1189646187 X:43135154-43135176 TTAAAGACATAGTTTGGCTTTGG - Intergenic
1197287419 X:124612530-124612552 TTATCAACATAGTTTGGGATGGG - Intronic
1199400650 X:147395024-147395046 TGAGAGAGACAGTTTGGAATTGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1201860572 Y:18593240-18593262 TTTTAGACACAGTTATGGAGGGG + Intergenic
1201872751 Y:18727141-18727163 TTTTAGACACAGTTATGGAGGGG - Intergenic