ID: 1118733542

View in Genome Browser
Species Human (GRCh38)
Location 14:68686091-68686113
Sequence GGTAGGCTCTTCACCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118733539_1118733542 -4 Left 1118733539 14:68686072-68686094 CCTAAATGAAGTGAGAAATGGTA 0: 1
1: 0
2: 2
3: 46
4: 289
Right 1118733542 14:68686091-68686113 GGTAGGCTCTTCACCTGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 124
1118733537_1118733542 15 Left 1118733537 14:68686053-68686075 CCAACAAACTATTATACATCCTA 0: 1
1: 0
2: 0
3: 19
4: 191
Right 1118733542 14:68686091-68686113 GGTAGGCTCTTCACCTGCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118733542 Original CRISPR GGTAGGCTCTTCACCTGCCA GGG Intronic
900173278 1:1280989-1281011 GGGAGGCTGTTCACCTGCCTGGG + Intronic
900345626 1:2209018-2209040 GGGAGGCTCTTGACAGGCCAGGG - Intronic
900679777 1:3910471-3910493 AATAGGCTGTTCACCTGCAACGG + Intergenic
901069171 1:6508724-6508746 GGCAGGCTCTCCACTTACCATGG + Intronic
901758512 1:11455869-11455891 GGCAGGCTCTTCAGCTTCCAGGG - Intergenic
901924412 1:12556847-12556869 GCTGGGCCCTTAACCTGCCAAGG - Intergenic
907222931 1:52920839-52920861 GCTAGGCGCTTCTCCTGCCTTGG - Intronic
907303453 1:53501936-53501958 GGAAGGCTCTGACCCTGCCAGGG - Intergenic
907569133 1:55466916-55466938 CGTAGCATCTTCATCTGCCAGGG - Intergenic
918570874 1:185990364-185990386 GGTAAGCTCTTCACTTCACATGG - Exonic
920429838 1:205911358-205911380 GGTAAGCTAACCACCTGCCAGGG - Intergenic
1063410738 10:5834707-5834729 GCAAGGCACTTCACCTGTCAAGG - Intronic
1075166153 10:120070062-120070084 GGGAAGCTCTTCACCTTCCCAGG + Intergenic
1076384013 10:130044458-130044480 GGTAGGCTCTGCTCCAGCCAGGG + Intergenic
1077150497 11:1070973-1070995 GGTGTGCACTTCACCTCCCAAGG - Intergenic
1077222986 11:1425605-1425627 GGGAGGCTCTTCACCTACAGGGG + Intronic
1079612981 11:22456171-22456193 GCTAGGCTCTTCACCTGTGAGGG + Intergenic
1079970742 11:27032163-27032185 GGTTGGCTCTGTGCCTGCCAAGG - Intergenic
1080718596 11:34827401-34827423 GGCAGGCTCTTGACATGCCAGGG - Intergenic
1087051971 11:93895598-93895620 AGAATGCTGTTCACCTGCCAAGG + Intergenic
1093395011 12:18670440-18670462 GGTAGGCCCTTCAACTCTCATGG - Intergenic
1096756854 12:53806747-53806769 GGTAGGCTCTTAAAATGCCCAGG - Intergenic
1096845252 12:54403101-54403123 TGTAGGCTCTTCTCTTTCCATGG + Intronic
1097059110 12:56269182-56269204 GGTTGGCTTTCCACCTGTCATGG + Exonic
1097824404 12:64159684-64159706 AGCAGTCTCTTCCCCTGCCATGG + Exonic
1114081968 14:19209060-19209082 GGCAGGCACATCACCTGGCAAGG - Intergenic
1117658875 14:57984044-57984066 GGTAGTCTCTTCTTCTGCAAGGG + Intergenic
1118124640 14:62887901-62887923 TGTAGCCTCATCACCTGCTAGGG + Intronic
1118733542 14:68686091-68686113 GGTAGGCTCTTCACCTGCCAGGG + Intronic
1120880520 14:89412294-89412316 GGTCAGCTCTTCATCTTCCATGG + Exonic
1122468925 14:101952797-101952819 GGGAGGGTCTTCACCTTGCATGG + Intergenic
1122834358 14:104423722-104423744 AGGAGGCCCTTCACCTGCCGTGG - Intergenic
1125641353 15:41233003-41233025 GGTAACCTCTCCACCTACCAAGG + Intronic
1129329403 15:74819264-74819286 AGTGGGATCCTCACCTGCCAGGG - Exonic
1130171346 15:81518120-81518142 GGAAGGCTCTTCCCCAACCAGGG + Intergenic
1130859663 15:87875152-87875174 GGCAGTCTCTTCAGCTGGCAGGG + Intronic
1132113293 15:99117741-99117763 GGTAGGGTATTCACAAGCCACGG + Intronic
1132113302 15:99117777-99117799 GGTAGGGTATTCACAAGCCACGG + Intronic
1132892951 16:2213444-2213466 GGCAGGCTCTGCACCTGTCCGGG - Exonic
1133149930 16:3820405-3820427 GGTGGGCTGTTCACCTGCCCAGG - Intronic
1134477087 16:14583790-14583812 GGTAGGCTCTCCACATACCTTGG + Intronic
1141850587 16:86642637-86642659 GGCAGGCACTGCAGCTGCCAGGG - Intergenic
1141851994 16:86652536-86652558 GGGAGGCTTTTCACCTGCAGAGG + Intergenic
1144765994 17:17732822-17732844 GGTAGGCTCTGCACAGGGCATGG - Intronic
1147976038 17:44248566-44248588 GTTGGGCTCTTCACCAACCAAGG + Exonic
1148697608 17:49570549-49570571 GGTAGCCTCCTCATCTGCAAAGG - Intergenic
1152234246 17:79130284-79130306 GGCAGGCTCTTGATCTGCCCTGG - Intronic
1157427878 18:47599773-47599795 TGTAGACACGTCACCTGCCAAGG - Intergenic
1159716277 18:71827416-71827438 GTTAGGCTCCTCCCCTCCCATGG - Intergenic
1160457025 18:79008718-79008740 GGTGGGCTCTGCACCGTCCATGG + Intergenic
925385961 2:3461829-3461851 GGTGGCCTCTTCACCACCCAAGG + Intronic
926700821 2:15802073-15802095 GGCAGGGTCTTCTCCTGCCTGGG + Intergenic
926715649 2:15921697-15921719 GGTAGGTCCTTCCACTGCCAGGG + Intergenic
927571934 2:24167497-24167519 GGTTGGTTCTTCTCCTGCCCTGG + Intronic
928805020 2:35140350-35140372 GGCTGGCTCTTTGCCTGCCAGGG + Intergenic
929124576 2:38511430-38511452 AGTAGCCTCTTGACCTGCCTTGG - Intergenic
932823347 2:74919996-74920018 GGTCGCCTCCTCACCTGCCCAGG + Intergenic
935171806 2:100616011-100616033 GGCAGGCTCCTCCCCTGCCCAGG - Intergenic
935848051 2:107187864-107187886 GGTGGGCTCTGTGCCTGCCAAGG - Intergenic
936080608 2:109430091-109430113 GGGGGGCTCATCAGCTGCCAAGG - Intronic
937352892 2:121178062-121178084 GGTAGGATCATCACCTGCCATGG + Intergenic
938494616 2:131787538-131787560 GGCAGGCACATCACCTGGCAAGG + Intergenic
938648042 2:133351632-133351654 GTAATGCTCTTCACCTGGCATGG + Intronic
940777822 2:157903130-157903152 TGAAGGCTAATCACCTGCCAGGG + Intronic
942579308 2:177399604-177399626 GTTAGGCTCTACACCTGCAGAGG - Intronic
943897408 2:193382696-193382718 GTTAGGCTCCTAACCTTCCAGGG + Intergenic
945155787 2:206835707-206835729 CCTAGGCTCATCACCTGCCTGGG - Intergenic
946401911 2:219472701-219472723 TGTTGGCTCTTAACCTCCCAGGG + Intronic
946430809 2:219626617-219626639 GGGAGGCTCGTTACCTGCCATGG - Intergenic
1169732111 20:8797730-8797752 TGTAGGCTCCTCACCTTTCAAGG + Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1173107691 20:40153134-40153156 GGTTGGCTGGTCACATGCCAAGG - Intergenic
1173284128 20:41655092-41655114 GGTAGGCTCCTCACCAGCTCTGG + Intergenic
1174682994 20:52426029-52426051 GGCAGGCTCTGCCCCAGCCAGGG - Intergenic
1176711860 21:10157059-10157081 GGCAGGCACATCACCTGGCAAGG + Intergenic
1177445084 21:21184262-21184284 GCTAGTGACTTCACCTGCCAAGG + Intronic
1179035114 21:37752877-37752899 TGTAGGCTCTGCCCCTGCCCTGG + Intronic
1180188066 21:46150237-46150259 GGGAGGCTCAGCTCCTGCCAAGG + Exonic
1180498805 22:15913610-15913632 GGCAGGCACATCACCTGGCAAGG + Intergenic
1184305959 22:43602063-43602085 TGCCGGCTCTTCACCTGGCAAGG + Intronic
952567786 3:34679842-34679864 GGGAGCCTGATCACCTGCCAGGG + Intergenic
954446498 3:50549700-50549722 GGTTGGCTCTCCCCCTGCTATGG + Intergenic
955093115 3:55771802-55771824 GGCAGGCTCTCCACCTGTAATGG + Intronic
956756084 3:72388353-72388375 GGTAGGCTTTGCTCCTTCCAAGG - Intronic
966718444 3:183037049-183037071 GGAAAGCTCTTCACTTACCATGG - Intronic
967849614 3:194071908-194071930 GGTAGGCGAATCACCTGACAGGG - Intergenic
969401869 4:6961211-6961233 GGTAGGCTCTTCACATGGCCGGG + Intronic
976618843 4:87107074-87107096 CTTACGCTCTTCAGCTGCCATGG + Intronic
977973487 4:103237909-103237931 GGTAGGCTCTTTACATTCCAGGG + Intergenic
977986777 4:103391703-103391725 GGTGGGCTCTTTACATTCCAGGG - Intergenic
983163038 4:164440838-164440860 GGTAGGCCCTTGAGATGCCATGG - Intergenic
983792286 4:171813219-171813241 GGTCCTCTCTTTACCTGCCAGGG - Intronic
984816907 4:183847442-183847464 GGTAGTCACTTCACCACCCAGGG + Intergenic
985009757 4:185570343-185570365 CGTATGCTCTGCACCTGTCATGG - Intergenic
990316228 5:54585670-54585692 GGAAGGCGCTTCATCAGCCAGGG - Intergenic
995679599 5:114702218-114702240 GGAGGACACTTCACCTGCCAGGG + Intergenic
996451344 5:123629062-123629084 GGCAGGCTCTGTGCCTGCCAAGG - Intergenic
996516149 5:124371925-124371947 GCTAGCCTCTCCAGCTGCCAAGG - Intergenic
1004271931 6:14203339-14203361 GGAAGGCACTTTACCTCCCAGGG + Intergenic
1007371117 6:41427628-41427650 GGTCCCCTCTTCACCTGCCCCGG - Intergenic
1008469414 6:51866441-51866463 GGTGGGATCATGACCTGCCAAGG + Intronic
1011753079 6:90472865-90472887 GGTGGGCTGTTTTCCTGCCACGG - Intergenic
1014530073 6:122547807-122547829 GGAAGGCTCATCACCTGGCTCGG - Intronic
1014824815 6:126037052-126037074 GGTGGGCTCCTCAGCTGTCATGG + Intronic
1025029318 7:55543813-55543835 TGTAGGCTATTCATCTGACATGG - Intronic
1031045515 7:116882876-116882898 GGTATGCTTGTCAGCTGCCAGGG + Intronic
1031991516 7:128202030-128202052 AGCAGGCTCTTCGCCTGGCACGG + Intergenic
1034010209 7:147521512-147521534 GGCAGGCTCTTCCTTTGCCAGGG - Intronic
1037957125 8:23068710-23068732 GGCACGCTCTTCCCCAGCCAGGG + Intronic
1037961780 8:23103200-23103222 GGTGCGCTCTTCCCCAGCCAGGG - Intronic
1037969758 8:23163745-23163767 GGTGCGCTCTTCCCCAGCCAGGG + Intronic
1038426071 8:27464745-27464767 GGTAGTATCTTCACCCGCAAAGG - Intronic
1044793511 8:95872459-95872481 GGCAGGCTCTGTGCCTGCCAAGG - Intergenic
1046250479 8:111624325-111624347 GGTAGGCCATCCACCTGCCGAGG - Intergenic
1047129972 8:122008160-122008182 GGTATGCTCTACATCTCCCAGGG - Intergenic
1049128130 8:140810723-140810745 GGTTGGCTCTGTGCCTGCCAAGG - Intronic
1053648858 9:40142747-40142769 GGCAGGCACATCACCTGGCAAGG + Intergenic
1053756886 9:41321106-41321128 GGCAGGCACATCACCTGGCAAGG - Intergenic
1054329838 9:63740688-63740710 GGCAGGCACATCACCTGGCAAGG + Intergenic
1054535725 9:66233423-66233445 GGCAGGCACATCACCTGGCAAGG - Intergenic
1054891587 9:70258134-70258156 GGCAGGCTCCTAAACTGCCACGG + Intergenic
1057440841 9:95082127-95082149 GGGAAGTCCTTCACCTGCCAGGG - Intronic
1057724586 9:97559172-97559194 GGCAGGCTCTCCAGCTCCCACGG - Intronic
1057897216 9:98918966-98918988 GGTAAGCTCTTTAACAGCCAAGG + Intergenic
1058627218 9:106947285-106947307 GCTAGGTTCTTCAGCTTCCATGG + Intronic
1060816846 9:126639470-126639492 TGGAGGCTCTTCAGCTGCTAAGG + Intronic
1062566202 9:137165002-137165024 GGTGGCCTCTTCTCCTGCCCGGG - Intronic
1202796614 9_KI270719v1_random:126048-126070 GGCAGGCACATCACCTGGCAAGG + Intergenic
1187426322 X:19180469-19180491 GGTAGGCTCTGCCCCTGCAGTGG - Intergenic
1188573181 X:31614043-31614065 GGTAGCTTCTTCACCTGGTATGG - Intronic
1188888894 X:35584949-35584971 TGTACTCTCTTCACATGCCATGG + Intergenic
1195200780 X:102548033-102548055 GGTCAGCTCTTCATCTTCCATGG + Intergenic
1199188118 X:144939980-144940002 GGTAGGATCTTCACCCTCCTGGG - Intergenic
1199188447 X:144942331-144942353 GGTAGGATCTTCACCCTCCTGGG - Intergenic
1200424057 Y:3003260-3003282 GGGAGCCTCATCACCTCCCAGGG + Intergenic