ID: 1118734463

View in Genome Browser
Species Human (GRCh38)
Location 14:68691600-68691622
Sequence AGCCCACAGCACCCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 317}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118734463_1118734467 -3 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734467 14:68691620-68691642 GCTATTAGTGTATAAACTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 60
1118734463_1118734470 5 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734470 14:68691628-68691650 TGTATAAACTGCTGGCGGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 69
1118734463_1118734472 9 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734472 14:68691632-68691654 TAAACTGCTGGCGGGTAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 72
1118734463_1118734469 1 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734469 14:68691624-68691646 TTAGTGTATAAACTGCTGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1118734463_1118734471 8 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734471 14:68691631-68691653 ATAAACTGCTGGCGGGTAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 85
1118734463_1118734468 0 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734468 14:68691623-68691645 ATTAGTGTATAAACTGCTGGCGG 0: 1
1: 0
2: 0
3: 7
4: 144
1118734463_1118734473 16 Left 1118734463 14:68691600-68691622 CCCCTCCTGGGGTGCTGTGGGCT 0: 1
1: 1
2: 3
3: 44
4: 317
Right 1118734473 14:68691639-68691661 CTGGCGGGTAGGTGGGAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118734463 Original CRISPR AGCCCACAGCACCCCAGGAG GGG (reversed) Intronic
900432316 1:2608144-2608166 AGCCCAGCGCACCCAAGCAGGGG + Intronic
901210208 1:7520311-7520333 ACCCCACAGGACCCTGGGAGAGG - Intronic
901465594 1:9418966-9418988 AGCCCACAGCTCTGCAGGGGTGG - Intergenic
902877905 1:19352030-19352052 ACCCCACAGGACACGAGGAGCGG + Intronic
903177640 1:21590292-21590314 AGGCCACAGCCCCTCAGGCGGGG - Intergenic
903753530 1:25645125-25645147 CGCCCTCAGCACACCAGGCGAGG - Intronic
903781713 1:25824243-25824265 AGACCAAAGCACCCCAGTAAAGG - Intronic
904360764 1:29970333-29970355 TTCACAAAGCACCCCAGGAGGGG - Intergenic
904965758 1:34371299-34371321 AGCACACAGGTCCCCAGGGGAGG - Intergenic
905180324 1:36161362-36161384 AGCCCAGATCTCTCCAGGAGAGG + Intronic
905468459 1:38173932-38173954 AGCCCACAGGAGCCCAGAAGTGG - Intergenic
909585287 1:77282123-77282145 AGACCACAGCCCCCGGGGAGAGG + Exonic
910146558 1:84086495-84086517 AGCCCACAGCACTCCTGGTCAGG + Intronic
910989126 1:93036843-93036865 AGGAGACAGCAGCCCAGGAGAGG + Intergenic
911830609 1:102546024-102546046 TGCCCACAGCATCCCAGCATTGG - Intergenic
913069584 1:115286624-115286646 AGCCCGCAGCGCCCCGGCAGCGG - Exonic
914339644 1:146749069-146749091 AGCTGACACCACCCCAGCAGAGG + Intergenic
915624041 1:157103716-157103738 AGCCCACAGCACAAGAGGGGAGG - Intergenic
915632544 1:157163465-157163487 AGCCCACAGGTCACCAGGAGGGG - Intergenic
915676552 1:157537515-157537537 AGCTCACAGGACCACAGGACCGG - Intronic
917144121 1:171869310-171869332 AGCCCACAGCTCCTCAGGCATGG - Intronic
917525696 1:175786514-175786536 TTCCCACAGCACCCCACTAGAGG + Intergenic
918180993 1:182086029-182086051 AGCCCACCTCACCCCAGCAGTGG + Intergenic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
919934243 1:202241228-202241250 GGAACACATCACCCCAGGAGGGG - Intronic
920443408 1:205997318-205997340 AGTACACAGCACCGCAGGAGAGG + Intronic
922096220 1:222445159-222445181 AGCCCTCTGCACCACAGAAGTGG + Intergenic
922176576 1:223202274-223202296 AGCCCCCACCACCCCAGGGCTGG - Intergenic
922788897 1:228298899-228298921 GGCCCACAGTATCACAGGAGAGG - Intronic
1062932921 10:1364251-1364273 AGACCACACCACCCCGGGAAAGG - Intronic
1063042786 10:2359937-2359959 AGCCCAGAGCATCCCACGGGAGG - Intergenic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1066488942 10:35875451-35875473 AGTTCACAGCCTCCCAGGAGAGG - Intergenic
1067693669 10:48520373-48520395 AGCCCTCAGCAGCCCAGGAGGGG + Intronic
1069883879 10:71611177-71611199 AGCCCACAGCGCCTGTGGAGGGG + Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1073873111 10:107888778-107888800 AGCCCACTGCACTCCAGTGGCGG + Intergenic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1075008841 10:118851199-118851221 AACCCTCAGCACTCCAGGATAGG + Intergenic
1075108039 10:119555375-119555397 AGGCCACTGCACTCCAGCAGGGG + Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1075687460 10:124374444-124374466 AGCCCACAGCACTAAATGAGTGG - Intergenic
1076645967 10:131954538-131954560 AGCCCACAGCGCCACAGAGGCGG - Intronic
1076835584 10:133019502-133019524 CGCCCAACGCACCACAGGAGAGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077069664 11:662864-662886 AGCCCTCAGCACGGCAGCAGGGG + Intronic
1077140732 11:1023779-1023801 AGCCCCCAGCTGCCCAGGGGAGG - Intronic
1077249246 11:1553698-1553720 AGCACACAGCACACATGGAGGGG + Intergenic
1077365821 11:2161194-2161216 AGCCCTCAGCCCTCCAGGACAGG - Exonic
1078463311 11:11531609-11531631 GGCCCAAAGCACTGCAGGAGGGG - Intronic
1080260691 11:30346765-30346787 AGCCCAATGCAGGCCAGGAGTGG + Intergenic
1080282279 11:30570879-30570901 AGCCCACAGCAAGACAGGAAAGG + Intronic
1083589275 11:63883454-63883476 AGCCCAGAGAACCCTTGGAGAGG + Intronic
1083742141 11:64716692-64716714 AGCCCACAGCTCTGCAGCAGAGG + Intronic
1083819241 11:65157807-65157829 AGGCCACTGCACTCCAGGATGGG - Intergenic
1083975893 11:66119791-66119813 AGCTAACAGCACACCAGGAGTGG - Intronic
1084113389 11:67027726-67027748 ACCCCACAGCACAACAGGCGTGG - Intronic
1084573725 11:69975532-69975554 AGCCCAAATCACCCCTGAAGGGG - Intergenic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1089292434 11:117445386-117445408 AGGCCACAGCACCCTGGGACTGG + Intronic
1089466486 11:118689532-118689554 AGCCCACAGCCCCCACTGAGAGG - Intergenic
1090272466 11:125397785-125397807 AGCCCCCACCACCCCAGGGGAGG - Intronic
1090332351 11:125941935-125941957 AACCCACAGCACAAAAGGAGGGG + Intergenic
1090359747 11:126164016-126164038 AGACCACAGGGCCCCAGGTGCGG + Intergenic
1091664754 12:2411224-2411246 AGCCCACAGCAGCCCTGCGGTGG + Intronic
1091884082 12:4003313-4003335 AGGCCCCAGCACCCTGGGAGAGG - Intergenic
1097967423 12:65595856-65595878 AGCCCACACCACCCAGGGAGAGG + Intergenic
1100378292 12:94038116-94038138 ATCCCACAGCTCCCAAGTAGTGG + Intergenic
1101341073 12:103841783-103841805 AGCCGACATCAGCCCATGAGTGG - Intronic
1102403841 12:112655035-112655057 AGCACACACCACCAGAGGAGTGG - Intronic
1102763138 12:115407195-115407217 AGCACAAAAGACCCCAGGAGTGG - Intergenic
1103809562 12:123602459-123602481 AGACCACAGCACCCGAGGGCGGG - Intronic
1104012723 12:124943392-124943414 GGCTCAGAGCACCACAGGAGAGG + Intergenic
1104729005 12:131094857-131094879 AGCTCTCAGCAGCCCAGGACAGG - Intronic
1104800953 12:131554995-131555017 AGCCCAGAGCTCCCCAGGCAAGG + Intergenic
1104971129 12:132531120-132531142 AGGCCAGACCACCCCAGGGGTGG + Intronic
1105660025 13:22484032-22484054 GGGCCACAGAAGCCCAGGAGGGG + Intergenic
1106470277 13:30048178-30048200 AGCCCACAGAAGCCCATGAGTGG + Intergenic
1106480291 13:30132759-30132781 AGCACACAGCAGCCCAAGCGAGG - Intergenic
1107803473 13:44132190-44132212 AGGCCACTTCACCTCAGGAGTGG + Intergenic
1107912511 13:45118681-45118703 AGTCTAGAGCACCCCAGGAATGG - Intergenic
1108481904 13:50881218-50881240 AGCCCACAGCACATCTGGTGGGG - Intergenic
1108572405 13:51764606-51764628 AGCACACAGCTCACCACGAGGGG + Exonic
1108574143 13:51777129-51777151 AGCACACAGCATCCCATGAGGGG + Intronic
1113461344 13:110484663-110484685 AGCACACAGCACCACAGTAGGGG - Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113853463 13:113431084-113431106 GGCCCACAGCCACCTAGGAGAGG + Intronic
1117098222 14:52318646-52318668 ATTCCACAGCACTCCAGTAGTGG + Intronic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1119831957 14:77711370-77711392 AGGCCACTGCACCCCTGCAGGGG - Intronic
1121644425 14:95508058-95508080 AGCCCACAGCACTCCTGGCATGG + Intergenic
1122577419 14:102751017-102751039 GGCCCACACCAGCCCAGGGGTGG - Intergenic
1122743076 14:103882899-103882921 AGCCCACTGCCCTGCAGGAGTGG - Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1123587594 15:21773150-21773172 AGGCCCCAGAACCCCAGGATGGG - Intergenic
1123624232 15:22215715-22215737 AGGCCCCAGAACCCCAGGATGGG - Intergenic
1125184243 15:36912207-36912229 AGACCACAGCAACCATGGAGTGG + Intronic
1125274971 15:37979807-37979829 TGCTACCAGCACCCCAGGAGGGG + Intergenic
1128340652 15:66820549-66820571 AGGCCAGAAAACCCCAGGAGGGG + Intergenic
1129191068 15:73937834-73937856 AGCCCCCAGCACCACTGGTGGGG - Intronic
1129412742 15:75358957-75358979 TGCCCACAGCAGCCCACCAGTGG - Intronic
1130543921 15:84840911-84840933 AGGCCACAGGACTCCAGGAGAGG + Exonic
1131157432 15:90083869-90083891 AGACCAGAGCACCTCAGGAAGGG - Exonic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1132316957 15:100897416-100897438 TGCCCACTGTACCCCTGGAGGGG - Intronic
1132598655 16:764374-764396 TGCCCACGGCGCTCCAGGAGGGG - Intronic
1134659765 16:15975233-15975255 AACCTCCTGCACCCCAGGAGAGG - Intronic
1134762768 16:16728719-16728741 AGCCCACAGCATCATAGTAGGGG - Intergenic
1134983284 16:18630429-18630451 AGCCCACAGCATCATAGTAGGGG + Intergenic
1136398093 16:30003983-30004005 CCCCCACACCACCCCAGCAGCGG + Intronic
1137772965 16:51032210-51032232 TGCAGACACCACCCCAGGAGTGG - Intergenic
1139345714 16:66302259-66302281 AGCCCACAGGACACCAGCAGAGG + Intergenic
1139560376 16:67737968-67737990 AGCCCCCAGAAACCCAGGAGGGG + Intronic
1139877435 16:70157377-70157399 AGCCCACAGCACAGCAGAACAGG - Exonic
1139952995 16:70680934-70680956 GGCCCAGGGCACCCCAGCAGGGG - Intronic
1139994642 16:70968339-70968361 AGCTGACACCACCCCAGCAGAGG - Intronic
1140412141 16:74747688-74747710 AGCCCCCAGCAGCTCAGGGGAGG + Intronic
1141643349 16:85354535-85354557 AGCCATCTCCACCCCAGGAGGGG + Intergenic
1141702539 16:85649069-85649091 AGCCACCGGCAACCCAGGAGAGG - Intronic
1142262056 16:89047717-89047739 AGCTCTGAGCAGCCCAGGAGTGG + Intergenic
1143390202 17:6555783-6555805 AGCCCACGGGACCCCAGAAGAGG + Intronic
1144318423 17:14087803-14087825 AGGCCACAGCACCAGAGAAGAGG - Intronic
1146167897 17:30605132-30605154 AGAACACAGACCCCCAGGAGGGG - Intergenic
1146220866 17:31018649-31018671 AGAACACAGACCCCCAGGAGGGG - Intergenic
1147422051 17:40326794-40326816 AGCCCCCTACACCCCAGGGGTGG - Intronic
1147591408 17:41686099-41686121 AGACCACAGGACCACAGGACCGG - Intergenic
1147686428 17:42289058-42289080 GGCCCACAGGCCCCCTGGAGAGG - Intronic
1148211354 17:45810718-45810740 AGCCCACAGACCCGCAGGACAGG + Intronic
1148667770 17:49387605-49387627 ACACCACAGCAAGCCAGGAGGGG - Intronic
1149894978 17:60422299-60422321 AGCGCACAGCAGGCCAGGAGAGG - Intronic
1150001935 17:61445929-61445951 AGCCAGCAGGACCCCAGGAGTGG - Intergenic
1150830050 17:68511647-68511669 AGACGACAGCACCCCCGGCGGGG + Intergenic
1150834693 17:68553538-68553560 AGGTCACAGCACTCCTGGAGGGG + Intronic
1151199676 17:72458519-72458541 AGCCCCCAGCACCCAACGGGCGG + Intergenic
1151453922 17:74214985-74215007 TGCCCACTGAACCCCAGGAAGGG - Intronic
1151732133 17:75917837-75917859 TGCCCCCAGCACTGCAGGAGCGG - Exonic
1152116199 17:78389009-78389031 GGCACATAGCAACCCAGGAGAGG - Intronic
1152331214 17:79674395-79674417 AGCCCAGGGCACCCCAAGACAGG + Intergenic
1152335878 17:79700103-79700125 ACCCAACTGCACCCCAGCAGAGG + Intergenic
1152987802 18:335435-335457 AACCCCCAGCACCTCAGGATGGG + Intronic
1153663653 18:7348887-7348909 AACCCACATCATCCCAAGAGTGG + Intergenic
1158931679 18:62329391-62329413 AGCTCAGTGCACCCCAGGACTGG + Intronic
1160270784 18:77381745-77381767 AGCCCACAGTACTCCAGGTATGG - Intergenic
1160686583 19:439515-439537 AGACCACTGGTCCCCAGGAGAGG + Intronic
1160710728 19:549838-549860 ACCCCACTGCACCCCTGGAGGGG - Exonic
1161440833 19:4290782-4290804 AGCCCTAAGCAGCCCTGGAGAGG + Intergenic
1162174524 19:8821481-8821503 AGAGCTCAGAACCCCAGGAGAGG - Intronic
1164004897 19:21139483-21139505 AGGCCACTGCACTCCAGGATGGG + Intergenic
1164513811 19:28917708-28917730 AGCCCACAGAACCTCAGCTGGGG + Intergenic
1164812269 19:31166585-31166607 AGCCCAGTTGACCCCAGGAGAGG - Intergenic
1165007686 19:32819891-32819913 AGCCCACAGCAGAGGAGGAGAGG + Intronic
1165245435 19:34495830-34495852 AGCCCACAGAACACCCAGAGAGG - Intronic
1165333677 19:35154935-35154957 GGCCCACTGTAGCCCAGGAGAGG - Exonic
1165419876 19:35717556-35717578 AGCCCGCGGCACCCTGGGAGTGG + Intergenic
1165705931 19:37976209-37976231 TGCCCACGGCGCCCCAGGGGAGG + Intronic
1166504176 19:43361224-43361246 GGCCACAAGCACCCCAGGAGGGG - Exonic
1166506283 19:43373534-43373556 GGCCACAAGCACCCCAGGAGGGG + Intergenic
1167853450 19:52219632-52219654 TGCACACAGCAACCCAGGACAGG - Intronic
1168104173 19:54156567-54156589 ACACCACAGCACCCCGGGAAAGG + Intronic
925201035 2:1967970-1967992 TGCTCACTGCACCCCAGGAGGGG + Intronic
927475616 2:23412198-23412220 AGCCCACAGCACCCCAACCCTGG - Intronic
928050980 2:27995147-27995169 GGCCCACAGCACCCCAGTGAAGG - Intronic
928493843 2:31811830-31811852 ATGCCACAGCCCCACAGGAGAGG - Intergenic
931235673 2:60410703-60410725 CAGCCACAGGACCCCAGGAGGGG + Intergenic
932431753 2:71679679-71679701 AGTCCACAGCAGCCATGGAGAGG + Intronic
932462565 2:71892527-71892549 AGCTCTCAGCCCCCAAGGAGGGG + Intergenic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934056801 2:88258147-88258169 AGCTCCTACCACCCCAGGAGTGG + Intergenic
934561539 2:95316043-95316065 CCCCCACAGCAGCCCAGCAGTGG + Intronic
934716736 2:96549117-96549139 AGCTCTCAGCGCCCCAGGACAGG - Intronic
934982024 2:98850589-98850611 AGCTCTCAGAACTCCAGGAGTGG - Intronic
935655827 2:105421985-105422007 ACGCAACAGGACCCCAGGAGGGG - Intronic
936525244 2:113236809-113236831 AGCCCTCATCTCCCCAGGAGAGG + Intronic
937078610 2:119124890-119124912 ACCCCAGGGCACCTCAGGAGAGG - Intergenic
937321260 2:120962089-120962111 AGCCCATAGCATCCCTGGGGTGG + Intronic
937868786 2:126772944-126772966 AGCCCGCAGCGACCCAGCAGAGG - Intergenic
938109169 2:128552677-128552699 ACCCCCCAGCAACCAAGGAGGGG - Intergenic
939368441 2:141265403-141265425 AGCCCAAGGCACCCCAGTGGAGG + Intronic
940273441 2:151915498-151915520 AGCCTACAGAACCCCCGCAGGGG - Intronic
941359284 2:164531923-164531945 AGTCCACAGCATCCCAGTACGGG + Intronic
943395603 2:187329062-187329084 ACCCTACAGAACCACAGGAGTGG + Intergenic
944642368 2:201740905-201740927 AGCCCACAGCAGCACAGCATGGG - Intronic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
948570353 2:238913736-238913758 AGCCCTGAGCACCCCAGAAGAGG + Intergenic
948661432 2:239508932-239508954 TGCCCACCTCAGCCCAGGAGAGG - Intergenic
948809922 2:240469264-240469286 AGCCGACACCACGCCAGGAGTGG + Intergenic
948908419 2:240991069-240991091 GGTCCACAGCTCCCAAGGAGAGG - Intronic
948915006 2:241030078-241030100 AGCACACAGCATGACAGGAGGGG + Intronic
1170439497 20:16364492-16364514 AGCCTACAGCACCCCTAGAGTGG - Intronic
1171174429 20:23040836-23040858 AGCCCACAGCGGCCCAGGGAAGG + Intergenic
1172153006 20:32803769-32803791 AGCTCAGAGCACCCTAGGTGGGG + Intronic
1173181883 20:40812266-40812288 AGGCCACAGCATCCCTGGAGGGG + Intergenic
1173283909 20:41653741-41653763 ACCCCACAGCACCCCAGCCTGGG + Intergenic
1173586467 20:44186811-44186833 TCACCACTGCACCCCAGGAGGGG + Exonic
1173852698 20:46228761-46228783 AGCCCAGCCCAGCCCAGGAGGGG - Intronic
1174185685 20:48704344-48704366 AGCCCAAAGCACTCCAGGGAGGG + Intronic
1175551848 20:59822546-59822568 AGCGCCCACCAGCCCAGGAGGGG - Intronic
1175806673 20:61833151-61833173 AACCCACACCACTCCAGGATAGG + Intronic
1176026239 20:62986971-62986993 GGCCCACAGACACCCAGGAGGGG - Intergenic
1176188158 20:63792933-63792955 ACCCCACACCATCCAAGGAGGGG - Intronic
1178423079 21:32457515-32457537 AGCCCAGAGCAGCCCAGGTTCGG + Intronic
1180159742 21:45993682-45993704 AGCGCACAGCCCCCGTGGAGGGG + Intronic
1181337876 22:22154483-22154505 AGCCCACAGCACCCCCTGCTTGG - Intergenic
1181620663 22:24089081-24089103 AGCCCACTGAGCCCCAGCAGAGG - Intronic
1181689408 22:24550118-24550140 AGCCCACAGCCAGCCAGCAGTGG - Intronic
1181857226 22:25790799-25790821 AGCTCCCAGGACCCAAGGAGTGG - Intronic
1183300623 22:37057338-37057360 AGCACCAGGCACCCCAGGAGGGG - Intronic
1184798602 22:46746733-46746755 GGCTCACAGCACCCCAGGGAAGG + Intergenic
1184993843 22:48188270-48188292 ATCCCTCAGCATCCCAGCAGAGG + Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950464752 3:13146789-13146811 AGACCACAGCACTCCAGGCTGGG + Intergenic
951082436 3:18467849-18467871 AGCCCACATCAGCCTAGAAGTGG - Intergenic
951513273 3:23528457-23528479 AGCCAGCAGCACCCCGAGAGTGG + Intronic
953749220 3:45596355-45596377 AGCCCACAGCATCCCTGGTAGGG - Intronic
954627924 3:52032856-52032878 AGCCCACAGAACACCAGGGGAGG + Intergenic
954717725 3:52534561-52534583 AGACCACAGCATCTCACGAGGGG - Intronic
955050989 3:55410850-55410872 AGCCCACAGAATCCAAGGAAAGG + Intergenic
955134083 3:56198892-56198914 AGCCCACTGTACCACAGAAGTGG + Intronic
959277583 3:104296330-104296352 AGCCCACAGGCCCCTAAGAGGGG - Intergenic
960687095 3:120306057-120306079 AGCCCAAAGCAGGCCAGGCGCGG + Intergenic
961463762 3:127069123-127069145 AGCCTCGAGCAGCCCAGGAGAGG + Intergenic
961595048 3:128009320-128009342 AGCCATCAGCACCCAAGCAGTGG - Intergenic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
961792690 3:129387613-129387635 AGCTCATAGCACACGAGGAGAGG - Intergenic
962118529 3:132537187-132537209 AGCCCCCTTCACCTCAGGAGCGG + Intronic
965493788 3:169372868-169372890 AGCCCACAGGACCCCTGAGGAGG + Intronic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
967214043 3:187194971-187194993 AGGCCACATCTCCCCAGAAGAGG - Intergenic
967412757 3:189183355-189183377 AGATCACAGCACCACAGGACCGG + Intronic
967939262 3:194753847-194753869 AGCTCAGAGCTCCCCAAGAGAGG + Intergenic
968085128 3:195870752-195870774 TGGCCACAGCATGCCAGGAGTGG + Intronic
968450918 4:675554-675576 ACCCCAGAGCAAGCCAGGAGAGG - Intronic
969237621 4:5877100-5877122 AAACCACAGGACCCAAGGAGTGG + Intronic
969415236 4:7053552-7053574 AGTCCACGGCACTGCAGGAGGGG - Intronic
969624730 4:8296672-8296694 ACCCCACACCACCCCATGTGGGG - Intronic
977440613 4:97062441-97062463 AGCACACAGCACCTCAGAATTGG - Intergenic
977654195 4:99503274-99503296 AGGGCACTGCACCCTAGGAGTGG - Intergenic
977911996 4:102548087-102548109 AGCACACAGCACTCCAGGGAAGG + Intronic
978668164 4:111211736-111211758 TGCCCAGAGCACACTAGGAGTGG - Intergenic
978937490 4:114395738-114395760 ATCCCACCACACCCAAGGAGAGG - Intergenic
980664976 4:135921326-135921348 AGCACACAACACCCCAGAACAGG - Intergenic
981311102 4:143298966-143298988 ACCTCACAGCACACCTGGAGAGG - Intergenic
981683665 4:147429256-147429278 AGCCCACAGAACCCCAAAAATGG + Intergenic
982915172 4:161199728-161199750 AACTCACAGCACAACAGGAGAGG + Intergenic
984063137 4:175017018-175017040 AGACCACAGCCCCCCAGAAGTGG + Intergenic
984108039 4:175574790-175574812 ACACCACAGCCCCCCAGAAGTGG + Intergenic
985631749 5:1017658-1017680 AGCCCACAGCCCCCCACCACGGG + Intronic
985655690 5:1130451-1130473 CCCCCACCCCACCCCAGGAGAGG + Intergenic
985664295 5:1173952-1173974 TGCCCACGGTACCCCAGGGGCGG - Intergenic
985762825 5:1759975-1759997 AGCCTCCAGGACCCCAGGAGTGG + Intergenic
986201666 5:5584820-5584842 AGCCCACGGCACCAGAGGACAGG - Intergenic
987428098 5:17796363-17796385 AGCCCACAGCCAGCCAGGACTGG + Intergenic
991497598 5:67242709-67242731 AACCCAAAGCATCCCAAGAGGGG + Intergenic
993120354 5:83766632-83766654 ATCCCAGAGCATCCCAGGGGTGG - Intergenic
998936509 5:147234947-147234969 AGCGCACAGCTACCCCGGAGGGG - Exonic
1001307883 5:170588952-170588974 ATCCCACAGCAACCCTGAAGAGG - Intronic
1001513715 5:172340398-172340420 AGCCGACAGCTTCCCAGAAGGGG - Intronic
1002992759 6:2253195-2253217 AGGCCACTGCACCCCAGGCTGGG - Intergenic
1003535870 6:6975017-6975039 AGCCCTCAGAACCCTAGGAGAGG + Intergenic
1004051095 6:12080209-12080231 AGCCCACAGGAGCCCAGGTGAGG - Intronic
1004358515 6:14950690-14950712 AGCCCAGAGCACCACATAAGTGG - Intergenic
1005939960 6:30553349-30553371 ACCCCACAGGACCCTAGTAGTGG - Exonic
1005999786 6:30955862-30955884 AGCCCCCAGCCCCCAGGGAGGGG + Intergenic
1006030469 6:31173507-31173529 AGCCCTGAGCACCCCAGAAGGGG - Intronic
1006111738 6:31751045-31751067 AGGCCACTGCACTCCAGGATGGG - Intronic
1006680741 6:35795401-35795423 GGCCCACGGCACCCCTGGGGAGG - Intronic
1006931569 6:37692137-37692159 GGCCCACAGGAGCCCAGGAAAGG + Intronic
1007218215 6:40257908-40257930 ATTCCACAGGACCCCACGAGAGG + Intergenic
1007252005 6:40502141-40502163 TGCCCACAGCAGCCCTAGAGGGG + Intronic
1009492736 6:64312282-64312304 AGCCCACTGCACCTCAGCAAGGG + Intronic
1009630391 6:66191545-66191567 AGAACACAGGACTCCAGGAGGGG + Intergenic
1010954058 6:82070394-82070416 AACCCACAGTACCTGAGGAGTGG + Intergenic
1011259562 6:85456925-85456947 ACCCCACAGCACCCTAGGGGTGG - Intronic
1011434458 6:87322417-87322439 AGCCCGCAGACCCCAAGGAGGGG + Intronic
1017011889 6:150068921-150068943 AGTCCACAGCCCCCCAGGTTTGG + Intronic
1017793528 6:157822737-157822759 ACCCCGCAACACCCCAGGCGTGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018652801 6:166005815-166005837 AGTTCACAGCCCCCCAGGAAGGG - Intergenic
1018909169 6:168092047-168092069 AGCCAGCAGCAGCCCAGCAGAGG - Intergenic
1018957190 6:168418163-168418185 AGCTCACAGGAAGCCAGGAGCGG - Intergenic
1018995269 6:168705538-168705560 AGCACACAACACCCCAGGGCGGG + Intergenic
1018995279 6:168705574-168705596 AGCACACAACACCCCAGGGCGGG + Intergenic
1018995289 6:168705610-168705632 AGCACACAACACCCCAGGGCGGG + Intergenic
1018995299 6:168705646-168705668 AGCACACAACACCCCAGGGCGGG + Intergenic
1018995311 6:168705682-168705704 AGCACACAACACCCCAGGGCGGG + Intergenic
1018995333 6:168705754-168705776 AGCACACAGCACCCCAGGGCGGG + Intergenic
1018995345 6:168705790-168705812 AGCACACAGCACCCCAGGGCGGG + Intergenic
1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG + Intronic
1022501957 7:30887403-30887425 ACCTCACAGCAGCTCAGGAGAGG - Intronic
1023267705 7:38425290-38425312 AGCCCACAGCAGCCCAGGAGAGG + Intronic
1023905780 7:44520877-44520899 AGCCCACAGCCACCCCAGAGAGG + Intronic
1024250950 7:47505314-47505336 GGTGCACAGCACCCCAGGAAAGG + Intronic
1024403005 7:48946583-48946605 AGACCACAGGACCACAGGACCGG + Intergenic
1026386870 7:69858569-69858591 AGCCCAAAGCAGCTCAGCAGGGG - Intronic
1026933203 7:74236586-74236608 AGCCCCCAGCTAGCCAGGAGAGG - Intronic
1027492808 7:78851345-78851367 CCCTCACAGCACTCCAGGAGGGG - Intronic
1028543831 7:91975969-91975991 ACCCCACTGCACTCCAGCAGTGG - Intronic
1029075380 7:97929977-97929999 ACCCCACAGCAGCCCTGGGGTGG + Intergenic
1030225560 7:107146436-107146458 ACCCCACAGAGCACCAGGAGAGG - Exonic
1030511329 7:110485941-110485963 AGCCATCTGCACCCCAGAAGAGG + Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1034511258 7:151536811-151536833 AGCCATCTGCAACCCAGGAGAGG + Intergenic
1034707525 7:153158840-153158862 AGCCCACAGCTCCCTAGGGGTGG - Intergenic
1034821975 7:154224066-154224088 AGGACACTGCAGCCCAGGAGGGG + Intronic
1035202991 7:157278791-157278813 GGCCTATTGCACCCCAGGAGCGG - Intergenic
1035221686 7:157410079-157410101 AGAACACAGCAGCCCAGGCGCGG - Intronic
1035280763 7:157776627-157776649 AAGCCACAGCACCAGAGGAGGGG - Intronic
1035280878 7:157777049-157777071 AAGCCACAGCACCAGAGGAGGGG - Intronic
1035291266 7:157840801-157840823 AGGCCACAGGACCCCTGAAGAGG + Intronic
1035929937 8:3768995-3769017 GGCCCACAGCACACCTGGGGAGG + Intronic
1036499614 8:9301166-9301188 AGCCCCCAGCAACCCAGCATGGG - Intergenic
1036609134 8:10334686-10334708 AGCCGGGAGCACCTCAGGAGCGG + Intronic
1037302706 8:17469592-17469614 ATACCACAGCCCCCCAGAAGTGG + Intergenic
1040124878 8:43726013-43726035 AGCTCACAGGACCACAGGACTGG - Intergenic
1040470275 8:47730786-47730808 CACCCACTGCACCTCAGGAGGGG + Intronic
1040873914 8:52130001-52130023 AGCCCACTGCACTCCAGCATGGG + Intronic
1041195924 8:55401300-55401322 ATCCCAGAGCACACAAGGAGTGG + Intronic
1041709098 8:60876733-60876755 AGCCCCCAGCGCCTCAGGATGGG + Intergenic
1042034984 8:64523133-64523155 AGCCCACAGCACTCCAGTCTGGG + Intergenic
1042850746 8:73213650-73213672 GCCCCACTGCAGCCCAGGAGAGG + Intergenic
1043684767 8:83071527-83071549 AGACCACAGGACCACAGGACTGG + Intergenic
1043914754 8:85908761-85908783 AGCCCACAGCTTCCCAGGTAAGG - Intergenic
1044415090 8:91929489-91929511 AGACCACAGCACTCCAGCTGGGG - Intergenic
1045595645 8:103651352-103651374 ATTCCACAGCACTCAAGGAGAGG - Intronic
1047219708 8:122909740-122909762 AGCCCACAGGACAGCAGCAGTGG - Intronic
1047591472 8:126331592-126331614 AGCACATAGCAGCCCAGGAAAGG + Intergenic
1047727486 8:127696527-127696549 AGAGCACAGCACACCTGGAGAGG + Intergenic
1048962651 8:139593487-139593509 AGCCAACAGGAAGCCAGGAGTGG - Intergenic
1049215163 8:141404435-141404457 AGACCCCAGGACCCCAGGACAGG - Intronic
1049256264 8:141615539-141615561 AGACCACTGCTCCCCAGGAGGGG - Intergenic
1049443289 8:142618872-142618894 CGCCCTCAGCTCCTCAGGAGAGG + Intergenic
1049444166 8:142622407-142622429 AGGGCACAGCACCACGGGAGGGG + Intergenic
1049475410 8:142794911-142794933 AGCACTCACCAACCCAGGAGTGG + Intergenic
1049565397 8:143335377-143335399 AGCCCACAGCAGCCCCTCAGAGG + Intronic
1049609914 8:143550114-143550136 GGCCCAGAGCACCCCTGGGGGGG - Intergenic
1049618744 8:143588405-143588427 AGCCCACAGCACCCAGAGGGAGG + Intronic
1049795137 8:144493710-144493732 AGCCCAGGGCCCCCCAAGAGTGG - Intronic
1053250258 9:36568249-36568271 AGCCCACAGCACTCCAGCCTGGG + Intergenic
1053566786 9:39260991-39261013 AGCACACAGCCTTCCAGGAGTGG - Intronic
1053832567 9:42098837-42098859 AGCACACAGCCTTCCAGGAGTGG - Intronic
1054130357 9:61358016-61358038 AGCACACAGCCTTCCAGGAGTGG + Intergenic
1054597986 9:67088575-67088597 AGCACACAGCCTTCCAGGAGTGG + Intergenic
1056790760 9:89623978-89624000 AACACACAGGAACCCAGGAGGGG + Intergenic
1057198420 9:93127721-93127743 AGACCACAGCCTCCCAGGACTGG + Intronic
1057786695 9:98093404-98093426 TCCTCACAGCAGCCCAGGAGAGG + Intronic
1057867692 9:98694134-98694156 AGTCCACTGCAGCCCAGGAGTGG - Intronic
1059422434 9:114200663-114200685 AGCCCACAGGACACTTGGAGAGG + Intronic
1059761852 9:117345107-117345129 AGCACAAAGGAGCCCAGGAGAGG + Intronic
1060881110 9:127118718-127118740 AGCCCACAGCCCAGCAGGACTGG - Intronic
1061041814 9:128144956-128144978 AGCCCCCAGCACCCCAGGAAAGG - Intergenic
1061253173 9:129438138-129438160 AGCCCATGGCACCTCCGGAGGGG + Intergenic
1062040140 9:134400762-134400784 AGCCCATAGGGCCGCAGGAGAGG - Intronic
1062203660 9:135322694-135322716 ACCACAGAGCACCCCAGGGGAGG + Intergenic
1062448383 9:136605183-136605205 AGGCCATGGCACCCCAGGACTGG + Intergenic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1186343438 X:8666899-8666921 AGACAACATCACCCCATGAGGGG + Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1188404258 X:29787135-29787157 AGCCCACAGAAACCTGGGAGAGG + Intronic
1188837299 X:34974299-34974321 AGCCCACAGAACCCTAGAAGTGG + Intergenic
1188901300 X:35735026-35735048 AGTCCACAGCACTCATGGAGAGG - Intergenic
1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG + Intergenic
1189906235 X:45762806-45762828 AGGCCACTGCAGTCCAGGAGGGG - Intergenic
1190541769 X:51484610-51484632 GCCCCGCAGCACCCCAAGAGAGG + Intergenic
1193871179 X:86800710-86800732 ACACCACAGCACTCCAGGATGGG - Intronic
1196819952 X:119693896-119693918 AGCCCACAGCACCCAAGGCTTGG - Intergenic
1198263768 X:134990850-134990872 AGGCCCCAGAACCCCAGGAAGGG - Intergenic