ID: 1118734579

View in Genome Browser
Species Human (GRCh38)
Location 14:68692146-68692168
Sequence GATGAGAGGGAGACTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1046
Summary {0: 1, 1: 0, 2: 3, 3: 91, 4: 951}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118734579_1118734590 24 Left 1118734579 14:68692146-68692168 CCGCCCCCAGTCTCCCTCTCATC 0: 1
1: 0
2: 3
3: 91
4: 951
Right 1118734590 14:68692193-68692215 CTATTATTGCCCCTTCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118734579 Original CRISPR GATGAGAGGGAGACTGGGGG CGG (reversed) Intronic
900538270 1:3189759-3189781 GAGGAGAGGGGGTCTGGGAGTGG + Intronic
900650949 1:3729852-3729874 GGGGACAGGGAGGCTGGGGGAGG + Intronic
900779724 1:4610221-4610243 GCTGTGAGGGAGCCTGGGGAGGG + Intergenic
900802475 1:4745938-4745960 GAGGAAAGGGAGGCTGGGAGAGG - Intronic
900844483 1:5085720-5085742 GATGCGAGGGAGAATGCAGGAGG - Intergenic
900887967 1:5428876-5428898 GAAGGGAGGGAGAGGGGGGGAGG + Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
901648004 1:10726983-10727005 GAGGGGAGGGAGACCGGGAGAGG + Intronic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902384529 1:16068786-16068808 GATGGGAGGGAGCCTGGGGAAGG - Intronic
902801507 1:18832909-18832931 GAAGACAGGGAGACAGGGAGAGG - Intergenic
902840518 1:19071159-19071181 GATGAGAGGGAGTGGGGAGGAGG + Intergenic
903000112 1:20259191-20259213 GAAGAGATGGAGGTTGGGGGTGG + Intergenic
903868196 1:26413152-26413174 GATAAATGGGAGAGTGGGGGAGG - Intronic
903870721 1:26432407-26432429 GAGAAGAGGGTGACTGGGCGGGG + Intronic
903929319 1:26853355-26853377 GGTGACAGGGATACTGGGTGGGG - Intronic
904286778 1:29458034-29458056 CAAGAGAGGGAGAATGGGAGGGG - Intergenic
904469533 1:30727905-30727927 GAAGAGAGGGAGAGGGAGGGAGG - Intergenic
904469549 1:30727959-30727981 GAAGAGAGGGAGATGGTGGGAGG - Intergenic
904879988 1:33689089-33689111 GAGGAGAGGGAGAGAGGGAGTGG + Intronic
904899867 1:33848406-33848428 AATCAGTGGGAGACTGGAGGAGG - Intronic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905262335 1:36728792-36728814 GAGGAGAGGGAGGCAGGGAGAGG - Intergenic
905275315 1:36813859-36813881 GATGACAGGGAGTCTGGGCAAGG + Intronic
905404629 1:37724557-37724579 GAGCAGAGGGAAACTGGGGCAGG + Intronic
905900876 1:41581358-41581380 GAGAAAAGGGAGACTGGTGGGGG + Exonic
907105486 1:51878738-51878760 GGCGAGAGGGAGACTGGGTTGGG - Exonic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908458759 1:64329401-64329423 GATGGGAGTGGGACTGGGGGAGG - Intergenic
909100872 1:71346105-71346127 GAGGGGTGGGGGACTGGGGGAGG + Intergenic
909189317 1:72532171-72532193 GATGGGAGGGAGCCAAGGGGAGG - Intergenic
909558905 1:76987017-76987039 GTGGAGTGGGGGACTGGGGGAGG + Intronic
910523294 1:88148504-88148526 GAAGAGAGGGAGAGGGAGGGAGG + Intergenic
910806303 1:91192423-91192445 GAAGAGAGGTAGTCTGGGGTGGG - Intergenic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
910940553 1:92528779-92528801 GATGAGAGAGAGAGTGTGGGAGG + Intronic
911087804 1:93993680-93993702 CATGAAAGTGTGACTGGGGGAGG + Intronic
911219853 1:95234598-95234620 GAGGGGTGGGAGGCTGGGGGAGG - Intronic
912451216 1:109768866-109768888 GATGGGAAGGAGCCTGGGAGAGG + Intronic
912703399 1:111895028-111895050 GATGAGAGGGAGATGTGGAGAGG + Intronic
913105930 1:115613934-115613956 GATGAGGTGGAGGCTGAGGGTGG - Intergenic
913353483 1:117890160-117890182 GCTGAGAAGGGGACTGGTGGTGG + Intronic
913556445 1:119971938-119971960 GATGAGGGAGTGAATGGGGGAGG + Intronic
914230365 1:145760453-145760475 TGTGAGAGGGACCCTGGGGGAGG + Intronic
914831541 1:151174305-151174327 GGTGAGAGGGAAACTGGAGTGGG + Intronic
914901461 1:151713385-151713407 GATGAGAGACAGCCTGGGGATGG - Intronic
915076065 1:153308838-153308860 GAATGGAGGGAGGCTGGGGGAGG - Intronic
915664872 1:157435200-157435222 GAGGAGAGAGAGACCTGGGGAGG - Intergenic
915724551 1:158008234-158008256 GAAGAAAGGGACACTTGGGGTGG + Intronic
915725995 1:158018147-158018169 GCTGAGAGGAAGAATTGGGGGGG + Intronic
915872362 1:159574669-159574691 GGTGGCAGCGAGACTGGGGGAGG - Intergenic
917157695 1:172022166-172022188 GAGGAGAGTGAGACTTGGAGAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
918089441 1:181276279-181276301 GGTGGCAGTGAGACTGGGGGAGG + Intergenic
918513450 1:185336579-185336601 GAAGAGAGGGAGGCTGGAGGTGG + Intergenic
918818634 1:189224979-189225001 GAAGAGAGGGAGAGAGGGAGAGG - Intergenic
919149592 1:193678861-193678883 AATGAGAGGGAGAGTGGGCGGGG - Intergenic
919732549 1:200922524-200922546 CATGAGAGAGAGACTGCCGGGGG + Intergenic
919899488 1:202033528-202033550 GGAGAGTGGGAGGCTGGGGGAGG + Intergenic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
920530359 1:206697519-206697541 GAGAAGAGGGAGCATGGGGGTGG + Intronic
920671690 1:208008579-208008601 GATGAGAGTGACAGTGGGGATGG - Intergenic
920835470 1:209506802-209506824 GAGGAAAGGGAGAGTTGGGGAGG - Intergenic
921099143 1:211913079-211913101 GAAGAGAAGGAGACTTGGAGGGG - Intergenic
921216233 1:212939002-212939024 GATGGGAGGGAGGCCGGGCGCGG - Intergenic
921940527 1:220834153-220834175 GGTAAGGGTGAGACTGGGGGAGG + Intergenic
922335913 1:224617824-224617846 GAGGCGAGGGAGACTGGGAAGGG + Intronic
922416148 1:225425208-225425230 GAGTAGTGGGAGAGTGGGGGGGG + Intronic
922801902 1:228368285-228368307 GTGGAGAGGGAGGCTGGGGCTGG + Intronic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923120313 1:230984060-230984082 GATGGGTGGGGGACAGGGGGTGG - Intronic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923509808 1:234640695-234640717 AAAGAGAGGGAGAGTGAGGGAGG + Intergenic
923841027 1:237670295-237670317 GGGGAGAGGGAGACTGGAGAGGG + Intronic
924581902 1:245330565-245330587 GAGTGGAGGGAGAGTGGGGGAGG + Intronic
924581911 1:245330588-245330610 GAGTGGAGGGAGAGTGGGGGAGG + Intronic
1063206363 10:3834674-3834696 GATGAGGTGGAGACTGGCGCTGG - Intergenic
1063354496 10:5385425-5385447 GATGAGAGGGAGAGAGGAAGAGG - Intergenic
1063394944 10:5677998-5678020 GAGGAGAGGGAAGCTGGAGGTGG - Intergenic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1063964171 10:11333069-11333091 GTTGAGAGGGAGATGGGGAGGGG - Exonic
1063984163 10:11483579-11483601 GAAGAGAGGGAGAGAGGGGGAGG + Intronic
1064010077 10:11728605-11728627 CAAGAGAGAGAGACTCGGGGAGG + Intergenic
1064488133 10:15819069-15819091 GTTGAGAGGGAGAGTGCAGGAGG + Intronic
1064627967 10:17280940-17280962 GAAGAGAGAGAGACTGAGGGGGG + Intergenic
1064823199 10:19362988-19363010 GAAGTGAGGGAGACTGTGGGAGG + Intronic
1064998161 10:21314437-21314459 GAGGAGAGGAAGGTTGGGGGAGG + Intergenic
1065020178 10:21496431-21496453 GAGGAGAGGGAGACGTGTGGGGG + Intronic
1065049681 10:21779028-21779050 GATGGCAGCGAGGCTGGGGGAGG + Intronic
1066783447 10:38977381-38977403 AAGGAGAGAGAGAGTGGGGGAGG + Intergenic
1067768247 10:49105316-49105338 AAAGAGAGAGAGACGGGGGGGGG + Intronic
1068842377 10:61629955-61629977 GCTGGGAGGGAGACTGAGGCCGG + Intergenic
1069343197 10:67437314-67437336 CCTGAGAGGAAGACTGGGAGTGG + Intronic
1069636595 10:69929061-69929083 GATGAGAGGGTCACAGGGGGAGG - Intronic
1069681300 10:70287482-70287504 GAAGAGAAAGAGACTGGGTGTGG + Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1069804283 10:71108151-71108173 TATGGGAGGGACACAGGGGGAGG + Intergenic
1069819340 10:71217838-71217860 GTGGAGATGGGGACTGGGGGTGG - Intronic
1069837643 10:71319353-71319375 GCTGAGCGCGAGTCTGGGGGCGG - Intronic
1070440760 10:76440870-76440892 GATGAAGGGGAGACGTGGGGTGG - Intronic
1070547813 10:77466191-77466213 GAAGTGAGGGAGAGTGGGTGTGG - Intronic
1071154827 10:82676399-82676421 AATAAGAGGGTGGCTGGGGGCGG - Intronic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071370794 10:84949739-84949761 CATGTGAGGCAGACTGGGAGAGG + Intergenic
1071381543 10:85068155-85068177 GAGGAGAGGGAGAGAGGTGGGGG - Intergenic
1071449824 10:85783748-85783770 GATGAGAGGGAGTTTTGGGCAGG - Intronic
1071562878 10:86657017-86657039 ATGGAGAGGGACACTGGGGGTGG - Intronic
1071707558 10:88015940-88015962 GATGCTAGGGAGACTGGGGCAGG - Intergenic
1072157927 10:92740773-92740795 GAGGAGAGAGAGACTGGGCACGG - Intergenic
1072199701 10:93147319-93147341 GATGAGAGGGTGAGTGTGGCTGG - Intergenic
1072288351 10:93939043-93939065 CATGAGAGAGAGAGTGGGAGAGG + Intronic
1072293521 10:93988652-93988674 GATGAGACTGAGAATGGGGTAGG - Intergenic
1072455595 10:95572891-95572913 GATGAGAGAGAGAGGGAGGGAGG - Intergenic
1072528732 10:96298186-96298208 CATGAGAGGGAGCCTGTCGGGGG - Intergenic
1072618779 10:97066589-97066611 AAGGAGAGGGAGAATGGAGGGGG - Intronic
1072873060 10:99141176-99141198 AATGAGAGGGAGAATTGGGTAGG - Intronic
1073744123 10:106445938-106445960 GACAAGAGGGAGGCTGGGGGTGG - Intergenic
1074204640 10:111272220-111272242 GATGAGAGGAAGAGGGGAGGAGG + Intergenic
1074607291 10:114985850-114985872 GAAGAGAGGGAGAGAGGTGGGGG + Intergenic
1074626087 10:115188062-115188084 GGGGAGAGGGAGAAAGGGGGAGG + Intronic
1074845517 10:117393999-117394021 GAGGAGAGGGAGCCTATGGGTGG - Intergenic
1075465427 10:122647242-122647264 GATGAGGGGGACCCTGGGGCTGG + Intergenic
1075570187 10:123536107-123536129 GACTAGAGGGAGGCTGGAGGGGG + Intergenic
1075673818 10:124282193-124282215 CAAGAGAGAGAGAGTGGGGGGGG + Intergenic
1075851536 10:125592237-125592259 GAGGAAAGCGAGGCTGGGGGTGG + Intronic
1075921979 10:126221091-126221113 GAAGAGAAGGAGGCTGGGTGCGG + Intronic
1076073928 10:127517041-127517063 CATGAGAGGGGGGCTGGTGGAGG + Intergenic
1076366094 10:129921914-129921936 GATGAGCAAGAGACAGGGGGCGG - Intronic
1076845113 10:133066019-133066041 GATGAGTGGGTGGATGGGGGAGG + Intergenic
1076987104 11:246016-246038 CATGAGAGGGAGCCTGGCTGGGG - Intronic
1077094915 11:795224-795246 TGAGAGAGGGAGGCTGGGGGAGG - Intronic
1077106489 11:844597-844619 GGTGGGAGGGAGCCTGGTGGCGG + Intronic
1077178231 11:1200213-1200235 GGAGGGAGGGAGACTCGGGGCGG - Intronic
1077933671 11:6760122-6760144 CATGGGTGGGGGACTGGGGGAGG - Intergenic
1078707539 11:13759580-13759602 GATAAGGGAGAGACTGGAGGTGG - Intergenic
1078951698 11:16141786-16141808 GATGGCAGTGAGGCTGGGGGAGG + Intronic
1079081663 11:17417573-17417595 GTTGAGAGGTATCCTGGGGGAGG - Intronic
1079347619 11:19667004-19667026 GGTGGGAGGGAGGCTGGGGAGGG - Intronic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079682952 11:23321385-23321407 GATGGCAGCGAGGCTGGGGGAGG + Intergenic
1079892877 11:26079951-26079973 GAGGAGAGGGAGAGGGGGAGAGG + Intergenic
1080343814 11:31298355-31298377 GAGGAGAGGAAGACTGGGACAGG - Intronic
1080424526 11:32143901-32143923 GCTGAGAGGGAAACTGGAGAAGG + Intergenic
1081640183 11:44747689-44747711 GCTGAGAGAGAGACGGGAGGGGG - Intronic
1081669613 11:44935674-44935696 GATGAAAAGGGGGCTGGGGGTGG + Intronic
1081720544 11:45285675-45285697 GAGGAGAGGGAGGCTGGGAGGGG - Intronic
1082042681 11:47699302-47699324 CATGAGTGGGAGCCTGGAGGAGG - Intronic
1082107504 11:48236368-48236390 GGTGACAGGAAGGCTGGGGGAGG - Intergenic
1082136486 11:48555101-48555123 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082983488 11:59145198-59145220 GAAGAGAGGGAGAGTGAAGGAGG + Exonic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083289680 11:61682838-61682860 GATGGCAGGGGGACGGGGGGGGG + Intronic
1083489286 11:63003330-63003352 GAAGTGAGGGAGAATGGTGGTGG + Intronic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083767440 11:64848569-64848591 GATGAGTGAGAGGCTGCGGGGGG - Intergenic
1084142167 11:67239870-67239892 GGTGGGAGGGAGACAGGGCGGGG + Intronic
1084473255 11:69375232-69375254 GCTGAGAGGGAGAATGGGCCTGG + Intergenic
1084546891 11:69819110-69819132 AAAGAGAGGGAGAGTGGGAGAGG + Intergenic
1084563497 11:69917059-69917081 GAAGAGAGGGAGAGAGGGAGAGG - Intergenic
1084862030 11:72025266-72025288 GAGGAGAGGGAGACAGCAGGGGG + Intronic
1085658867 11:78343414-78343436 GAGGAGAGGGAGACAGAAGGAGG + Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1085737193 11:79049189-79049211 GATGAACTGGGGACTGGGGGAGG - Intronic
1085751373 11:79164667-79164689 TATGGGAGGGACACAGGGGGAGG + Intronic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086331837 11:85761992-85762014 GAGGAGAGTGAGGCTGAGGGGGG + Intronic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087600709 11:100311449-100311471 GTTAAGAGGAAGACTGGGGATGG + Intronic
1087916786 11:103820515-103820537 GGTGGCAGCGAGACTGGGGGTGG - Intergenic
1088645409 11:111913047-111913069 GATGAGGGGTAGTCTGGGGTGGG - Intronic
1088735818 11:112726949-112726971 GATGCGAGGGAGGCTGAGGAAGG - Intergenic
1088842528 11:113638925-113638947 GATGGGAGAGAAACTGGAGGTGG + Intergenic
1089157049 11:116410542-116410564 GCAGAGATGGAGCCTGGGGGAGG - Intergenic
1089395350 11:118133029-118133051 GGAGAGAGTGAGCCTGGGGGAGG + Intergenic
1089452053 11:118605700-118605722 GCGGAGATGGAGAGTGGGGGCGG + Intergenic
1089681693 11:120122242-120122264 TGGGAGAGGGAGGCTGGGGGAGG - Intronic
1090036806 11:123256296-123256318 GAGGATAGAAAGACTGGGGGTGG + Intergenic
1090189206 11:124757541-124757563 GATGGGTGGGAGATTGTGGGAGG + Intronic
1090223051 11:125047633-125047655 GATATGAGGAAGACTGTGGGAGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090876911 11:130798378-130798400 GATGATAGGCAGAGTGGGAGTGG + Intergenic
1091050480 11:132364169-132364191 GAGGAGAGAGAGAGTGGGAGAGG + Intergenic
1091091273 11:132773352-132773374 AATGAAAGGGGGAGTGGGGGAGG - Intronic
1092030363 12:5278622-5278644 GATGTGAGGGAGAGAGTGGGCGG - Intergenic
1092105220 12:5916990-5917012 GATGACAGGGACGCTGGGGGAGG + Intronic
1092256123 12:6927771-6927793 GAAGGGAGGGAGCCTGGGAGAGG - Intronic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092564358 12:9648605-9648627 GATCAGAGAGAGGTTGGGGGAGG - Intergenic
1092718470 12:11416586-11416608 GATGGCAGTGAGGCTGGGGGAGG + Intronic
1092829807 12:12432886-12432908 GATGAGAGAAAGAGTGGGGTAGG + Intronic
1093073728 12:14735391-14735413 GATGTGGGGAAGACTAGGGGAGG - Intergenic
1094179044 12:27571433-27571455 AATGAGAGGGAAAATGGGGGAGG + Intronic
1094417732 12:30235264-30235286 GAAGAGAGGGAGAGAGAGGGAGG - Intergenic
1095578190 12:43763699-43763721 GAGGGGAGGGAAAATGGGGGTGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096446701 12:51699498-51699520 GCTAAGAGGGAGGCTTGGGGAGG + Intronic
1096497082 12:52044821-52044843 ACTGAGAGGGAAACTGAGGGAGG + Intronic
1096588924 12:52644401-52644423 GATGAATGGGAGCCTGGGGATGG - Intergenic
1096777513 12:53973391-53973413 GACGAGAGGGGGCCTGGGGCAGG - Exonic
1096962134 12:55590353-55590375 GATGGCAGTGAGGCTGGGGGAGG + Intergenic
1097046147 12:56189173-56189195 GGGGAGAGGGAGGCTGGGGGAGG + Intronic
1097191797 12:57222832-57222854 GATGGGAGGGGGAATGAGGGGGG + Intronic
1099784222 12:87239391-87239413 GTTGGGAGGGAGAGTGGGGGTGG + Intergenic
1101679433 12:106950750-106950772 GATGAGAGGTTGCCTCGGGGTGG + Intergenic
1101973845 12:109337653-109337675 GATGGGAGGGACCCTGTGGGAGG - Intergenic
1102455024 12:113065766-113065788 GATGAGAGGGTGACGAGGAGGGG + Intronic
1102531893 12:113552868-113552890 GTGGAGGAGGAGACTGGGGGCGG + Intergenic
1103204738 12:119119799-119119821 GATGAGATGGAGAATGGAGGAGG + Intronic
1103239911 12:119404464-119404486 CCTGAGAGGGAGTTTGGGGGTGG + Intronic
1103424915 12:120825004-120825026 TATGAGAAAGGGACTGGGGGTGG - Intronic
1103919148 12:124390479-124390501 GATGGCAGGGCGACGGGGGGGGG - Intronic
1104253118 12:127115402-127115424 GATGAGAGGGGCAATGTGGGTGG - Intergenic
1104572285 12:129935639-129935661 GAGGAGAGGGAGACAGGGAAGGG - Intergenic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1105426193 13:20297041-20297063 GAGGACAGGGAGACAGAGGGCGG - Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1106679976 13:31999488-31999510 GGGGAGAGGGAGACTGGAGAGGG - Intergenic
1106821414 13:33468577-33468599 GATGAGAGAGAGAGTGGGGGAGG - Intergenic
1107797452 13:44067264-44067286 GTTAAGAGGGAGACTGAGGCCGG + Intergenic
1108454398 13:50598329-50598351 GATGAGAGAGAGAGATGGGGTGG - Intronic
1108558851 13:51623343-51623365 GATGAAAAGGAGGCTGGAGGAGG + Intronic
1108686900 13:52827516-52827538 GATGAGAGGGTGACTAGGACTGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1109789495 13:67228874-67228896 GAGGAGGGTGAGACAGGGGGAGG - Intronic
1109790104 13:67235401-67235423 AATTAGAGGGGGACTGTGGGGGG - Intergenic
1110460064 13:75735245-75735267 GAAGAGGGGGTGAGTGGGGGTGG - Intronic
1110892556 13:80708188-80708210 CATGGCAGCGAGACTGGGGGAGG - Intergenic
1111375135 13:87368442-87368464 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
1111557563 13:89901420-89901442 GGGGAGTGGGGGACTGGGGGAGG - Intergenic
1112152485 13:96779168-96779190 GATGAGTGGGGGGCTAGGGGAGG + Intronic
1112178711 13:97054837-97054859 CATGGGAGCGAGGCTGGGGGAGG - Intergenic
1112326662 13:98446320-98446342 GATGACAGGGATGCTGGCGGGGG + Intronic
1112401935 13:99085826-99085848 AAGGAGAGGGAGGCCGGGGGAGG + Intronic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1113082020 13:106530239-106530261 AATTAGAAGGAGGCTGGGGGAGG - Intronic
1113382977 13:109820680-109820702 GCTGAGAGTGAGGGTGGGGGAGG - Intergenic
1113401933 13:110002311-110002333 AATGACATGGAGCCTGGGGGTGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113809430 13:113129390-113129412 GGTGAGGGGGAGCCTGGGTGAGG + Intronic
1114617814 14:24077542-24077564 GGTGAGAGGAAGAGTAGGGGAGG - Intronic
1114673575 14:24427568-24427590 GCTGGGAGGGTAACTGGGGGTGG + Exonic
1115040443 14:28918167-28918189 AAGGAGTGGGGGACTGGGGGAGG + Intergenic
1115131174 14:30053547-30053569 GATGTGAGGGAGTCAGGGAGGGG + Intronic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1115994442 14:39181191-39181213 GCTGAGAGGGAGGCTGGGACTGG - Exonic
1116499469 14:45602678-45602700 GAGGAGAGGGAGACAGATGGGGG + Intergenic
1116731514 14:48628405-48628427 GAGGAGAGGGAGAGGGGGAGGGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117846714 14:59919792-59919814 GGAGAGAGCGAGACTGGAGGAGG + Exonic
1117952592 14:61097975-61097997 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
1118062181 14:62151591-62151613 CATGAGAGGGAGAAAGGAGGGGG + Intergenic
1118169181 14:63369331-63369353 CATTACTGGGAGACTGGGGGTGG - Intergenic
1118289436 14:64505647-64505669 GTAGAAAGGGAGACTGGGTGGGG - Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1118900402 14:69981069-69981091 GAGCAGAAGGAGGCTGGGGGAGG + Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119264266 14:73254824-73254846 GCTGAGGGCGAGGCTGGGGGCGG - Intronic
1119327415 14:73769100-73769122 GATGCGAGGGAGACCCTGGGAGG - Intronic
1119358358 14:74026150-74026172 AAAAAGAGAGAGACTGGGGGCGG + Intronic
1119422940 14:74518360-74518382 GATGAGAAGCAGGCTGGGGCCGG - Intronic
1119884276 14:78127299-78127321 AATGAGAGAGAGACAGGGTGGGG + Intergenic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1120528090 14:85601044-85601066 GGTGAGAGGGAGATTGGATGAGG + Intronic
1120545269 14:85803797-85803819 GAAGAGTGGGAGGGTGGGGGAGG - Intergenic
1120778260 14:88461417-88461439 GATGGCAGCGAGGCTGGGGGAGG - Intronic
1121028378 14:90634479-90634501 GAAGAGAGGGAGGCCGGGTGGGG + Intronic
1121210810 14:92206969-92206991 AATGAGAGGGAGGGTGTGGGTGG + Intergenic
1121481394 14:94278574-94278596 GAAGAGAGGGAGGGTGGGGAAGG - Intronic
1121592328 14:95125601-95125623 GAAGAGAGGGAGAAGGGGAGAGG + Intronic
1121649855 14:95549990-95550012 GATGACACAGAGACTGGGAGGGG + Intergenic
1122059919 14:99130151-99130173 GATGGGGAGGAGACTGGAGGAGG - Intergenic
1122070475 14:99202602-99202624 GATGGGAGGGAGAGAGAGGGAGG + Intronic
1122090857 14:99339260-99339282 CATGACAGGGACACTGGGGACGG - Intergenic
1122200938 14:100122127-100122149 GATGAGTGGCAGTCAGGGGGCGG + Intronic
1122354964 14:101117465-101117487 GAAGATAGGGAGAAAGGGGGAGG - Intergenic
1122468615 14:101950859-101950881 GATGATAGAGACACTGAGGGTGG - Intergenic
1122743578 14:103885494-103885516 GCTGTCAGGGAGCCTGGGGGAGG + Intergenic
1122771945 14:104101479-104101501 GATGCGTGGGAGGCTGGAGGAGG + Intronic
1122789947 14:104179921-104179943 GAGGAGACGGAGTGTGGGGGAGG + Intronic
1122825756 14:104369673-104369695 GAGCTGAGGGAGACTGGGGGTGG - Intergenic
1122918958 14:104871739-104871761 GAGGAGGGGGAGGCTGTGGGAGG + Intronic
1123587482 15:21772762-21772784 GAGGAGGGGGGGACGGGGGGTGG + Intergenic
1123624120 15:22215327-22215349 GAGGAGGGGGGGACGGGGGGTGG + Intergenic
1123627906 15:22239907-22239929 GATGTGAGGGAGGGTGGGGAGGG + Intergenic
1124626464 15:31310279-31310301 GATGGGAGGGTGACTGGGTGGGG + Intergenic
1125144885 15:36455628-36455650 GAAGAGAGAGAGAGAGGGGGGGG - Intergenic
1125358404 15:38840653-38840675 GGTGGCAGTGAGACTGGGGGAGG - Intergenic
1125362974 15:38884087-38884109 GATGTGAGGCAGCCTGGGAGAGG - Intergenic
1125547791 15:40519986-40520008 GGTAAAAGGGAAACTGGGGGAGG - Intergenic
1125805895 15:42493433-42493455 GATGACAGGGAAACGGGGGTGGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127051438 15:55088376-55088398 GCTGAGGGTGAGCCTGGGGGAGG - Intergenic
1127112483 15:55689485-55689507 AAGGGGAGGGAGTCTGGGGGAGG + Intronic
1127116989 15:55738770-55738792 GAAGAGAGGGAGGGAGGGGGAGG + Intronic
1127744800 15:61956329-61956351 GGAGAGGGGGGGACTGGGGGAGG + Intronic
1128304157 15:66587034-66587056 GAGGAGGGGGAGAATGGGGAGGG - Intronic
1128746328 15:70116956-70116978 GATGGGAGAGAGTATGGGGGAGG + Intergenic
1128782985 15:70375202-70375224 GATGTCAGGGAGACCGGGAGGGG - Intergenic
1129118935 15:73383186-73383208 TATAAGAGGGAGACAGAGGGAGG + Intergenic
1129270781 15:74418254-74418276 GATAAGCGGGTGAGTGGGGGAGG - Exonic
1129281901 15:74491940-74491962 GTGGAGAGGGGGACTGGTGGTGG + Intergenic
1129332983 15:74837252-74837274 GGTGAGGGGGACAATGGGGGAGG + Intronic
1129771380 15:78205430-78205452 GATGAAAGGGAGGCAGGGGCTGG + Intronic
1129872891 15:78952336-78952358 GGAGAGAGGGACCCTGGGGGCGG - Intergenic
1130720973 15:86385968-86385990 GATGAGAGGGAGAGGGGAGGAGG - Intronic
1130720990 15:86386013-86386035 GATGAGAGGGAGAGGGGAGGAGG - Intronic
1130785172 15:87087815-87087837 GAATAGAGGGAGACTTGGGTGGG - Intergenic
1131472534 15:92709398-92709420 GAGGAGAGAGAGCCTGGGGCAGG - Intronic
1131562303 15:93455154-93455176 GAGGAGAGGGAGGCGGAGGGAGG + Intergenic
1131643064 15:94313202-94313224 AATGAGAGGCAGAGTGGAGGGGG - Intronic
1132185391 15:99798583-99798605 GAGAAGAGGGACACTGGAGGGGG - Intergenic
1132431597 15:101765945-101765967 GAGAAGAGGGACACTGGAGGGGG + Intergenic
1132671146 16:1102773-1102795 GAGGTGAGGGGGGCTGGGGGAGG - Intergenic
1132746159 16:1437141-1437163 GATGAGCGGGAACCGGGGGGCGG + Intronic
1132806143 16:1776028-1776050 CATGAGAGGGCGCCTGGGGACGG - Intronic
1132855451 16:2042789-2042811 GTTGAGAGGGAGAAGAGGGGAGG - Intronic
1132929319 16:2450923-2450945 GAGAAGATGGAGACTGCGGGTGG + Intronic
1132942384 16:2514494-2514516 GGCGAGAGGGAGGCTGGGGTGGG + Intronic
1132977030 16:2716063-2716085 GAGGAGAGTGAGACTTTGGGGGG - Intronic
1133320307 16:4909392-4909414 GAGGAGTGGGAGGCTGAGGGTGG - Intronic
1133485613 16:6215453-6215475 GAAGAGAGGGAGAGGGGGAGAGG + Intronic
1133996843 16:10754676-10754698 GATGTGAGACAGACTGTGGGGGG + Intronic
1134025471 16:10949744-10949766 GATGAGGGGCAGACTGGAGGTGG + Intronic
1134112474 16:11524074-11524096 GATAGGAGGGGGGCTGGGGGTGG - Intergenic
1134290737 16:12901648-12901670 GGTGAGAGGGATACTGCGAGAGG + Exonic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135273352 16:21087649-21087671 TATGAGAGGGAGGCTGAGGCAGG + Intronic
1136172433 16:28496983-28497005 GAGGAGGAGGAGACTGCGGGAGG + Exonic
1136247845 16:28985517-28985539 GGTGAGTGGGAAACTGGTGGGGG + Exonic
1136377936 16:29876544-29876566 GATGAGAGGGAGACCCAGAGGGG + Intronic
1136683543 16:31981495-31981517 GATGAGGGGCAGCCTGGGGAGGG + Intergenic
1136713372 16:32258208-32258230 GATGTGAGTGAGACTGGGGCAGG - Intergenic
1136754539 16:32671223-32671245 GATGTGAGTGAGACTGGGGCAGG + Intergenic
1136813573 16:33199141-33199163 GATGTGAGTGAGACTGGGGCAGG - Intronic
1136820049 16:33309221-33309243 GATGTGAGTGAGACTGGGGCAGG - Intergenic
1136826613 16:33365761-33365783 GATGTGAGTGAGACTGGGGCAGG - Intergenic
1136831679 16:33464532-33464554 GATGTGAGTGAGACTGGGGCAGG - Intergenic
1137010563 16:35316248-35316270 GATGTGTGTGAGACTGGGGCAGG + Intergenic
1137250886 16:46740056-46740078 GATGCCAGGGAGCCTGGGGAAGG - Exonic
1137293165 16:47065980-47066002 GAGGAGAGGGAGAAAGGAGGAGG + Intergenic
1138012629 16:53397306-53397328 GGTGACAGCGAGGCTGGGGGAGG + Intergenic
1138554622 16:57764258-57764280 GGTGGGAGGGAGGCTGGTGGGGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139126549 16:64085145-64085167 GATGAGATGGACACTGGGCTGGG + Intergenic
1139370011 16:66461177-66461199 GGGGACAGGGAGACCGGGGGTGG + Intronic
1139949294 16:70661365-70661387 GATGGGACGGAGGGTGGGGGAGG + Exonic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140697762 16:77551817-77551839 GAAGAGAGGGAGAGGGTGGGAGG + Intergenic
1140798616 16:78464261-78464283 GATGACAGGGAGATGGAGGGAGG + Intronic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141766194 16:86061467-86061489 GGTGTGAGGGTGACTGGGGGCGG - Intergenic
1141992881 16:87620478-87620500 GAAGAGAGGGAGAGGGGGAGGGG + Intronic
1142153275 16:88521959-88521981 GCTGAGACGGGGAGTGGGGGTGG - Intronic
1142223879 16:88868005-88868027 GAGGAGAGAGAGACAGGGCGTGG + Intergenic
1202992150 16_KI270728v1_random:22116-22138 GATGTGAGTGAGACTGGGGCAGG - Intergenic
1203056686 16_KI270728v1_random:931554-931576 GATGTGAGTGAGACTGGGGCAGG + Intergenic
1142605067 17:1076915-1076937 GTGGAGAGGGAGAGTGGGTGAGG - Intronic
1142642088 17:1290035-1290057 GATGAGATGGAGTATGGGGGAGG - Intronic
1142894308 17:2964250-2964272 GATGGGGGTGAGGCTGGGGGAGG + Intronic
1143462347 17:7112031-7112053 GATGAGAGAGAGAGAGGGGAGGG + Intronic
1143541838 17:7573667-7573689 GAAGCGAAGCAGACTGGGGGAGG - Intronic
1143626145 17:8111168-8111190 GATGAGGGTCAGACTGGGGTTGG - Intronic
1143885473 17:10061782-10061804 CCTGAGAGGGAGGCTGGGAGTGG - Intronic
1143988159 17:10933357-10933379 CAGGAGAGAGAGAGTGGGGGCGG + Intergenic
1144193859 17:12871781-12871803 AATAAGAGAGAGACGGGGGGAGG - Intronic
1144201180 17:12943903-12943925 GATGACAGGAGGACTGGAGGAGG - Intronic
1144590600 17:16520609-16520631 GTTGATAGGGAGGCTGGGGCAGG + Intergenic
1144779037 17:17798760-17798782 GGTGAGTGGGAGAGTGGCGGTGG - Intronic
1145010480 17:19365006-19365028 GATGGTTGAGAGACTGGGGGAGG - Intronic
1145795940 17:27655382-27655404 GATGGGAGGGATCCTCGGGGAGG + Intergenic
1145810390 17:27760707-27760729 GATGGGAGGGATCCTCGGGGAGG + Exonic
1146091695 17:29885700-29885722 GATGGGAGGGAGCCAGTGGGAGG + Intronic
1146297198 17:31659276-31659298 GAGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146297214 17:31659322-31659344 GAGGAGAGGGAGAAAGGGGGAGG + Intergenic
1146948617 17:36890738-36890760 GATGAATGGGGGACTGGGGGCGG + Intergenic
1147144457 17:38477202-38477224 GATGAGGGGCAGCCTGGGGAGGG + Intronic
1147606700 17:41777697-41777719 GATGAGCTGGGGCCTGGGGGAGG + Intronic
1147632618 17:41941828-41941850 GTGGAGAGGGAGCCTAGGGGAGG - Intronic
1148152113 17:45403077-45403099 GAGGGCAGGGAGGCTGGGGGTGG - Intronic
1148466261 17:47866891-47866913 GCTGGGAGGGAGACAGGGAGGGG + Intergenic
1148731610 17:49840123-49840145 GAGCAGAGGGAGAATGGAGGAGG - Intronic
1148806472 17:50266544-50266566 GATGAGATGGAGCAGGGGGGAGG - Intergenic
1150458916 17:65330753-65330775 GAGTGGAGGGAGGCTGGGGGTGG - Intergenic
1151387601 17:73764636-73764658 GATGACAGGGATGCTGGGGAAGG + Intergenic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151933620 17:77248201-77248223 GGTTAGTGGGAGAGTGGGGGAGG - Intergenic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152094206 17:78263684-78263706 GATGTGGGGGAGTCTGGGGAAGG - Intergenic
1152323857 17:79624357-79624379 GAAGGGAGGGAGGCTGGGGAAGG + Intergenic
1152400827 17:80065211-80065233 GAGGAGAGGGAGGAAGGGGGAGG - Intronic
1152456143 17:80417358-80417380 GATGAGAGGGAGCTTAGTGGAGG - Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152599518 17:81254896-81254918 GAAGAAAGGGAGGCTGGGGAGGG + Intronic
1152623657 17:81378856-81378878 GGTGAGGGGGAGAGTGGGGTGGG - Intergenic
1152745412 17:82036489-82036511 GATGAGGGCGAGGCTGGGGCTGG + Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153135340 18:1911294-1911316 GATGACAGCGAGGCTGCGGGAGG + Intergenic
1153419872 18:4893208-4893230 GATGGCAGTGAGGCTGGGGGAGG + Intergenic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1155364169 18:25033786-25033808 GGGGAGAGGGAGAGAGGGGGGGG + Intergenic
1155843029 18:30669340-30669362 GATGGGAGGGACCCAGGGGGAGG - Intergenic
1156186660 18:34671133-34671155 GGTGGCAGCGAGACTGGGGGAGG - Intronic
1157308070 18:46531406-46531428 GATGAGGGGGAAAATGAGGGGGG - Intronic
1157323332 18:46650693-46650715 AGTGTGAGGGAGAATGGGGGAGG + Intronic
1157570037 18:48706126-48706148 GATGAGAGAGGGACGGGTGGAGG - Intronic
1158090217 18:53702413-53702435 GATGATAGGTTGACTGGGGATGG - Intergenic
1158462321 18:57657100-57657122 GAGGAGTGGGAGACGAGGGGAGG - Intronic
1158634829 18:59147573-59147595 GATGTGAGCGGCACTGGGGGAGG + Intronic
1159705187 18:71677585-71677607 GAGGGGTGGGGGACTGGGGGAGG - Intergenic
1159931394 18:74315989-74316011 GAAGCGAGGGAGACTGCTGGAGG + Exonic
1160409861 18:78668010-78668032 GATGGGAGGGAGTATGGGGGTGG - Intergenic
1160447862 18:78941311-78941333 GAGGAGAGAGAGAGTTGGGGAGG - Intergenic
1160804751 19:987600-987622 GCTGAGAGGGAAACTGAGGCAGG + Intronic
1160911929 19:1478623-1478645 GAGTAGAGGGAGACTCGGAGAGG + Intronic
1161062598 19:2222608-2222630 GACCAGAGGGAGACCGGGCGCGG + Intronic
1161201942 19:3019848-3019870 GATGAGAGGGTGGCGGGGAGAGG - Intronic
1161357624 19:3827665-3827687 GGTGAGAGGCAGCCTGGGCGGGG + Intronic
1161405688 19:4090084-4090106 AAGGAGAGTGAGGCTGGGGGCGG - Intergenic
1161415771 19:4145575-4145597 GATGAGAGAGAGGATGGGGAGGG + Intergenic
1161735616 19:5990584-5990606 GCTGTGATGGAGACTTGGGGAGG + Intergenic
1161845175 19:6708022-6708044 GATGAGAGTGGGACAGGGTGGGG - Intronic
1161938309 19:7385959-7385981 GGAGAGAGGGAGAGAGGGGGAGG - Intronic
1162065182 19:8121182-8121204 GAGGAGAGGGAGGGTGGGGACGG - Intronic
1162134323 19:8545803-8545825 GATGAGATGGAGAAGGGGAGAGG - Intronic
1162291733 19:9785717-9785739 GGTGAGAGGGAGATGGGGGCGGG - Intronic
1162292689 19:9791865-9791887 GATGAGGGCGAGACGGGGGCGGG - Intronic
1162292742 19:9792032-9792054 GATGAGGGGGAGTCGGGGGCGGG - Intronic
1162292813 19:9792252-9792274 GATGAGGGGGAGACGGGGCCGGG - Intronic
1162292846 19:9792367-9792389 GGTGAGGGAGAGACGGGGGGCGG - Intronic
1162292909 19:9792576-9792598 GGTGAGGGGGAGACGGGGGCGGG - Intronic
1162293002 19:9792854-9792876 GGTGAGGGGGAGACGGGGGTGGG - Intronic
1162372077 19:10285566-10285588 GATGAGAGGGGAAGTGGTGGGGG + Exonic
1162907432 19:13832014-13832036 GATGTGGGGGTGACTTGGGGGGG - Exonic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1163085974 19:14979850-14979872 GAAGGGAGGGGGACTGGGGGTGG + Intronic
1163390446 19:17027095-17027117 GAGGAGAGGGAGAGTGGGGGCGG - Intergenic
1163826981 19:19529338-19529360 GGAGAGATGGAGAGTGGGGGTGG - Intronic
1164526250 19:29015675-29015697 GAAGAGAGGGAGAGAGAGGGAGG - Intergenic
1165083270 19:33323774-33323796 GAGGAGGGGGTGATTGGGGGTGG + Intergenic
1165094673 19:33403573-33403595 CATGGGAGGGAGCCAGGGGGTGG + Intronic
1165279719 19:34785722-34785744 GAGAAGCGGGAGACTGGGGCAGG + Intergenic
1165433558 19:35785106-35785128 GGTGAGTGGGATGCTGGGGGTGG + Exonic
1165648145 19:37462069-37462091 AATGAGAGTGAGATTGGTGGAGG - Intronic
1165842821 19:38798789-38798811 GAGGAGAGGGAGAGGGGGAGGGG + Intergenic
1166109308 19:40612945-40612967 CATGAGTTGGAGGCTGGGGGAGG - Intronic
1166470163 19:43072911-43072933 GATTAGGGAGAGACTGGGAGGGG - Intronic
1166503589 19:43357928-43357950 GTTGAGAGGGAGAGTGTGTGTGG - Intronic
1166506865 19:43376833-43376855 GTTGAGAGGGAGAGTGTGTGTGG + Intergenic
1166558783 19:43718663-43718685 GGTGAGAGGCGGCCTGGGGGAGG - Exonic
1166566754 19:43770230-43770252 GATGAGTGGGAGGCTGGAGACGG - Intronic
1166597078 19:44059466-44059488 GATGAGAGGGTCACTGTGGTTGG + Intronic
1166611500 19:44203271-44203293 GAAGAGAGGGAGAGAGGGAGAGG - Intergenic
1166856356 19:45784299-45784321 GATGAGAGGGAGAGATGGGAGGG + Intronic
1166882537 19:45938125-45938147 GAAGAGAGGGAGATGGGTGGGGG + Exonic
1166892020 19:45999745-45999767 GATGAGAGGGAGAGAGCTGGGGG + Intronic
1166983769 19:46648102-46648124 AATGAGAGGGAGAGCGGTGGAGG + Exonic
1167075054 19:47243364-47243386 GAGGTGAGGGAGACGGGGCGAGG - Intergenic
1167118547 19:47502573-47502595 GAGGAGAGGGAACCTGGTGGTGG - Intronic
1167427812 19:49438451-49438473 GAGGCGAGGGAGACTGGGACGGG + Intronic
1167458625 19:49612377-49612399 GATGAGAGGCAGGATGGGTGGGG + Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168349825 19:55669384-55669406 GAGCAGAGGGAGACTGGGTCTGG + Intronic
1168517120 19:57017682-57017704 GATGAGGGGGAGAGAAGGGGAGG - Intergenic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
924979335 2:206969-206991 AAAGAGAGGGAAACTGGGGTGGG + Intergenic
924988095 2:288866-288888 GGGGAGCGGGAGACGGGGGGAGG - Intergenic
925079970 2:1056208-1056230 GATGAGAGGGAGAGTGCATGGGG + Intronic
925655607 2:6144961-6144983 GATGGGAGGAAAACTGGGGCAGG - Intergenic
926336073 2:11863851-11863873 GATGGTGGGGAGACTGGGGGAGG - Intergenic
926996096 2:18737225-18737247 GGGGGGAGGGAGGCTGGGGGAGG + Intergenic
927515527 2:23669699-23669721 GCTCAGAGGCTGACTGGGGGTGG - Intronic
927532273 2:23818200-23818222 GAAGAGAGGGAGAGGGAGGGAGG + Intronic
927532288 2:23818250-23818272 GAAGAGAGGGAGACGGAGGGAGG + Intronic
927598424 2:24418736-24418758 GCTGGGAGGGAGTCTGGGGAAGG - Intergenic
927754519 2:25698059-25698081 GAGGAGAGGGAGGCTGGGGCCGG + Intergenic
927915595 2:26934106-26934128 GAGGACAGGGAGACAGGAGGTGG - Intronic
928093875 2:28392544-28392566 GGTGAGCGGGGGACTGGGGAGGG + Intronic
928536291 2:32244837-32244859 GAGGAGAGGGAGAGAGGGGGAGG + Intronic
929027789 2:37621799-37621821 GAGGAAAGGGAGAGTGGAGGTGG + Intergenic
929097617 2:38278844-38278866 GAGGAGAGGGAGAGTGATGGGGG + Intergenic
929421555 2:41795386-41795408 GATGAGGGGTGGAGTGGGGGAGG - Intergenic
929706590 2:44219354-44219376 GAGGAGCTGGAGACTGGAGGTGG - Intronic
929887737 2:45893686-45893708 GAAGAGCGGGGCACTGGGGGAGG - Intronic
930418696 2:51121764-51121786 GATGACAGGGTGGCTGGGGAAGG - Intergenic
930583143 2:53236653-53236675 GAGGAGAGGGAGAGAGGTGGAGG - Intergenic
931590683 2:63880176-63880198 GAGGAGAGGGAGGAGGGGGGAGG - Intronic
932654300 2:73595335-73595357 GATGAGAGGTTGCCTGGGGCTGG - Intronic
933091872 2:78130597-78130619 GAGGAGAGAGAGAATGGGTGAGG - Intergenic
933793144 2:85899624-85899646 TCTGAGAATGAGACTGGGGGAGG - Intergenic
934492029 2:94767982-94768004 GATGGGAGGGGGGCCGGGGGTGG - Intergenic
934611406 2:95739651-95739673 CAAGAGAGGGAGTGTGGGGGAGG - Intergenic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
935136499 2:100308077-100308099 GATGGGAGGGAGGCCGGGCGTGG + Intronic
935157630 2:100497272-100497294 GAGGAGAGGGAGGCGGTGGGAGG - Intergenic
935171168 2:100612474-100612496 GCTGGGAGGGAGGCTGGGGCTGG + Intergenic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
935800486 2:106690637-106690659 AATGAGAGGGAGCCAGTGGGAGG - Intergenic
935871858 2:107459421-107459443 CATGAGAGGCCGTCTGGGGGTGG + Intergenic
936471411 2:112801960-112801982 GGTGTGAAGGAGAGTGGGGGTGG + Intergenic
936956159 2:118024295-118024317 TATGAGAGGGACACGGTGGGAGG + Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937057483 2:118951958-118951980 GAGGAGAGAGAAACTGGGAGAGG - Intronic
937236658 2:120435350-120435372 GAGGAGGTGGAGGCTGGGGGAGG + Intergenic
937272842 2:120664836-120664858 GATAAGAGGGAGAATGGAGCAGG + Intergenic
937421012 2:121755519-121755541 GAGGAGAGGGAGAGTGGGCGGGG - Exonic
937525251 2:122760601-122760623 GATGAAATGGAGGCTGGGGAGGG - Intergenic
937680724 2:124641266-124641288 GAGGAGACTGAGGCTGGGGGAGG + Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
939166438 2:138645950-138645972 GAGAAAAGGGAGACTGGGGCTGG + Intergenic
939837811 2:147151209-147151231 GATGGCAGCGAGGCTGGGGGAGG + Intergenic
940196487 2:151100664-151100686 AACGAGAGGGAGACTCGTGGTGG + Intergenic
940414442 2:153403516-153403538 GGTGGCAGGGAGGCTGGGGGAGG - Intergenic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940669577 2:156650721-156650743 CATGTCAGGGAGACTGGGAGGGG - Intergenic
940776626 2:157891597-157891619 GAAGAGAGAGAGAGTGGGGAAGG + Intronic
941354077 2:164467441-164467463 TATGAGAAGGAGACTGGGCATGG + Intergenic
941853585 2:170207948-170207970 GTTAAAAGGGAGTCTGGGGGTGG + Intronic
942088223 2:172462960-172462982 GATGACAGCGGGACTGGAGGTGG - Intronic
942240861 2:173963903-173963925 TCAGAGAGGGAGACAGGGGGAGG + Intronic
942534592 2:176949833-176949855 AATGACAGGGAGACTAGGGTTGG - Intergenic
942733231 2:179081978-179082000 CATGGGAGGGACACAGGGGGAGG - Intergenic
943017537 2:182531842-182531864 GGTGGGTGGGAGCCTGGGGGAGG - Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943087402 2:183329257-183329279 GAGGAGAGGGAAACAGGTGGGGG - Intergenic
943956088 2:194191820-194191842 GATGATAGGGAGACTGAGGCGGG - Intergenic
944465204 2:199993724-199993746 GTAGAGAAGGGGACTGGGGGTGG + Intronic
944533255 2:200684776-200684798 GAGGAGAGGGAGAGGGGGAGGGG + Intergenic
945110817 2:206357710-206357732 GTTCAGAGGGAGACTGGGAGAGG + Intergenic
945234917 2:207625129-207625151 GGTGAGAGGGAGACCAGGCGAGG + Exonic
945347904 2:208740445-208740467 GAGGAGAGAGAGAGTTGGGGGGG - Intronic
946187333 2:217988458-217988480 GATACGAGGCAGTCTGGGGGTGG - Intronic
946252306 2:218421178-218421200 GGTGAGAGGCAGCATGGGGGTGG + Intronic
946325471 2:218982622-218982644 GCTGAGATGGAGAGTGGCGGCGG - Intronic
946805186 2:223464314-223464336 GAAGAGAGAGAGGGTGGGGGAGG - Intergenic
947182594 2:227425467-227425489 GATGAGAAGGTGAATGGGGGTGG + Intergenic
947636920 2:231684887-231684909 GGCAAGAGGGAGACTGGGTGCGG + Intergenic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948220181 2:236263057-236263079 GTTGGGAGGGAGAATGGGGGTGG + Intronic
948242204 2:236447068-236447090 GATGAGAGAGTCACTGGAGGAGG - Intronic
948252070 2:236537243-236537265 GCTGACAGGGAGAATGGAGGAGG + Intergenic
948735800 2:240004127-240004149 GAGGAGTGAGAGAGTGGGGGAGG + Intronic
948939204 2:241187764-241187786 GAGGAGAGGGAGAAGTGGGGGGG + Intergenic
948992245 2:241561075-241561097 CATGAGAGGCTGGCTGGGGGCGG - Intronic
949035537 2:241814273-241814295 GGTGCGAGGGAGGGTGGGGGAGG + Intronic
1168901016 20:1365111-1365133 GATGAGAGTGGGAATGTGGGTGG - Intronic
1169152161 20:3297911-3297933 GATGAGAGGGAGAGTTAGGAGGG - Intronic
1169216201 20:3796200-3796222 GATGAGGGCGGGACTGAGGGCGG - Exonic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1170503442 20:16998814-16998836 GAAGCGAGGGATACTGGGGAAGG + Intergenic
1170556712 20:17520712-17520734 GAAGAGGAGGAGTCTGGGGGTGG - Intronic
1170719821 20:18866919-18866941 GGTGGCAGTGAGACTGGGGGAGG - Intergenic
1170837145 20:19894335-19894357 GATGGTAGGGAGAGTGGGGGTGG - Intronic
1171517082 20:25746479-25746501 GATGGGAGTGAGCCTGGGGCAGG + Intergenic
1171772132 20:29330903-29330925 GGTGACAGTGAGGCTGGGGGAGG + Intergenic
1171786650 20:29471857-29471879 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
1171869397 20:30513424-30513446 GAGGACAGGGAGAGAGGGGGCGG + Intergenic
1172014470 20:31864741-31864763 GATGAGACTGAGGCTCGGGGAGG + Intronic
1172051799 20:32123158-32123180 GAGGAGAGGGAGAGGGGGAGGGG + Intronic
1172240790 20:33411323-33411345 GGTGAGCGTGGGACTGGGGGTGG - Intronic
1172474321 20:35226297-35226319 CCTGAGAGGCAGCCTGGGGGAGG - Intergenic
1172525074 20:35595845-35595867 GCTATGAGGGAGGCTGGGGGTGG - Intergenic
1172621267 20:36319984-36320006 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172621285 20:36320038-36320060 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172740324 20:37161424-37161446 GGGGAGAGGGAGACGGGGTGGGG + Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173332573 20:42087583-42087605 GAAGAGATGGAGGCTGGGTGCGG + Intronic
1173427819 20:42958214-42958236 GGAGAGAGGGAGACAGGGAGAGG + Intronic
1173678866 20:44861988-44862010 GATGAGGGGGAGTGAGGGGGAGG + Intergenic
1173843927 20:46176391-46176413 GAGGTGGGGGAGACTCGGGGTGG - Intronic
1174061065 20:47833497-47833519 GAGGAGCTGGAGACTCGGGGAGG - Intergenic
1174070711 20:47897202-47897224 GAGGAGCTGGAGACTCGGGGAGG + Intergenic
1174100388 20:48122527-48122549 GAGGAGTTGGAGACTCGGGGAGG - Intergenic
1174148035 20:48465791-48465813 CAGGAGAGGGAGACTTTGGGGGG + Intergenic
1174213159 20:48895884-48895906 GATGAGAGAAAGGCTGGGCGCGG - Intergenic
1174435986 20:50507370-50507392 GATGAGGGGGGGACCGGGTGCGG - Intergenic
1174627518 20:51927809-51927831 GATGAGGGGGAGTGGGGGGGAGG + Intergenic
1174790463 20:53473060-53473082 GATGGCAGTGAGGCTGGGGGAGG + Intronic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1175624204 20:60476894-60476916 GATGGGAGGGGCACTGGGGATGG + Intergenic
1175795110 20:61766191-61766213 GTGGCGAGGGAGACTGAGGGTGG - Intronic
1175870808 20:62208551-62208573 GCTGACGGGGACACTGGGGGTGG - Intergenic
1176074499 20:63242285-63242307 GCAGAGATGGAGACTGTGGGAGG - Intronic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1177241770 21:18467256-18467278 GATGGGTAGGAGGCTGGGGGAGG + Intronic
1177784505 21:25656274-25656296 GTTTAGAAGGAGCCTGGGGGTGG - Intronic
1178000209 21:28153794-28153816 GATCAGAAGAAGACTGGGGGAGG - Intergenic
1178824630 21:36004961-36004983 GGGGAGGGGGAGACAGGGGGAGG + Intergenic
1178880970 21:36449875-36449897 GACGAGAAGGAGACTTTGGGAGG - Intergenic
1179932236 21:44578620-44578642 GATGAGAGGGGGACTCATGGAGG + Intronic
1180673269 22:17569835-17569857 GATGAGGGGGAGGCAGAGGGAGG + Intronic
1181169469 22:21000172-21000194 GCTGAGGGGGAGACTGGCCGTGG + Exonic
1181510358 22:23386204-23386226 GTTGAGAGAGAGATGGGGGGTGG - Intergenic
1181560556 22:23697243-23697265 GATGTGAGTGAGCCTGGGGCAGG + Exonic
1181670449 22:24423543-24423565 GAAAAGAGGGAGTGTGGGGGTGG + Intronic
1182415383 22:30217937-30217959 GGTGAGAGGGAGACAGGGAGGGG + Intergenic
1182513841 22:30840491-30840513 GATGGGAGGGAGATGGGGTGGGG + Intronic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1183395632 22:37569283-37569305 GGTAAGAGGGAGGCTGGGGCGGG - Exonic
1184568985 22:45310269-45310291 GCTGAGAGGGAGTCCTGGGGTGG - Intronic
1184757858 22:46526955-46526977 GATGAGAGTGAAACTGAGAGAGG - Intronic
1185033908 22:48460865-48460887 GATGTGAGGCAGATTTGGGGTGG + Intergenic
1185336827 22:50274693-50274715 GCTGGGAGGGGTACTGGGGGAGG - Intergenic
1185336887 22:50274819-50274841 GCTGGGAGGGGTACTGGGGGAGG - Intergenic
1185383870 22:50522730-50522752 GGTTAGAGGGAGACGGGGAGGGG + Intronic
949317640 3:2774311-2774333 GATGAAATGGAGATTGGGGTGGG - Intronic
949631630 3:5934529-5934551 GGGGGGTGGGAGACTGGGGGAGG - Intergenic
949994074 3:9602541-9602563 GGCAAGAGGGAGGCTGGGGGTGG - Intergenic
951042962 3:18008446-18008468 GAAGAGAGGGAGAGAGAGGGGGG + Intronic
951404017 3:22271689-22271711 GATGAGAAGGAGACAGGCAGAGG - Intronic
951645042 3:24880336-24880358 GAGCAGAGGAAAACTGGGGGTGG + Intergenic
951782202 3:26376481-26376503 CATGAAAGGGAGACTGGAAGGGG + Intergenic
952137825 3:30443102-30443124 GATGACAGGGAGACGAGGGTAGG + Intergenic
952632206 3:35482830-35482852 GGTGGGAGCGAGGCTGGGGGAGG - Intergenic
952866299 3:37857495-37857517 GAGGAAAGGGGAACTGGGGGTGG - Intergenic
952925537 3:38316833-38316855 GAGGAGAGGGAGCCTCTGGGAGG - Intronic
953388453 3:42520599-42520621 GAAGAGAGTGGGACTGGGTGGGG + Intronic
953549314 3:43888838-43888860 TATGGGAGGGAGAGTGGGGATGG + Intergenic
953783939 3:45896535-45896557 GAGGAGACCGAGACTGGGGAAGG + Intronic
954144519 3:48627930-48627952 GATGATGGTGAGACTGGAGGTGG - Exonic
954624652 3:52015956-52015978 CATGCGATGGAGGCTGGGGGTGG + Intergenic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954885230 3:53867576-53867598 GATGGGGGTGAGACTGGGGAAGG - Exonic
955216341 3:56987526-56987548 GATGAAAGGGACTCTGGGGACGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955239876 3:57169006-57169028 GAGGAGATGGAGACTGGGAGCGG - Intronic
955421681 3:58744547-58744569 GATGAGAGAGTCCCTGGGGGAGG + Intronic
955980725 3:64524545-64524567 GATGAATGGGATATTGGGGGAGG - Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
956077696 3:65523424-65523446 GAAGAGAGGGAGGCAAGGGGTGG + Intronic
956341471 3:68228919-68228941 GAAAAAAGGGACACTGGGGGAGG + Intronic
956696265 3:71921761-71921783 GCAGAGCGGGAGACTGGGGTGGG - Intergenic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
957792649 3:84959749-84959771 GGGGACAGGGAGACTGGGAGGGG - Intronic
957909366 3:86602565-86602587 GATGGGAGGGACACAGTGGGAGG + Intergenic
959109464 3:102104791-102104813 GAGGAAAGGGAGACTGGATGTGG + Intronic
959598931 3:108157291-108157313 GATGAGAGGGACATGGGGGAAGG - Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
959817947 3:110698087-110698109 GCTAAGAGGGAGGCGGGGGGAGG - Intergenic
960073482 3:113458215-113458237 GAGGAGAGGGAGACGGGAGAGGG - Intronic
960083324 3:113564535-113564557 TATGAGAGTGTCACTGGGGGCGG + Intronic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960719828 3:120615256-120615278 GGTGAGTGGGGGGCTGGGGGCGG - Intergenic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
961343298 3:126244858-126244880 GATGAGATGGAGGCTGGAAGAGG - Intergenic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
961684347 3:128618995-128619017 GGTGAGAAGGAGGCTGTGGGAGG - Intergenic
962234381 3:133694721-133694743 GCTGAGAGGGAGATGGGGCGAGG - Intergenic
962444354 3:135451465-135451487 AATGGGAGGGAGCCTGGAGGAGG + Intergenic
962787779 3:138784413-138784435 GACGAGAGGGAGAGGGGGAGGGG - Intronic
963071421 3:141308440-141308462 GAAGAGAGGGAAACTGGGGTGGG - Intergenic
963238767 3:142982267-142982289 GATGAGAGGGAGAGGAGAGGAGG + Intronic
963303158 3:143621048-143621070 GGTGACAGCGAGGCTGGGGGAGG + Intronic
963387938 3:144620332-144620354 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963978486 3:151509908-151509930 GGTGGCAGGGAGGCTGGGGGAGG + Intergenic
964694424 3:159491537-159491559 GGTGACAGCGAGGCTGGGGGAGG + Intronic
964767583 3:160193583-160193605 GATGAGATGGGGGCTGGTGGGGG + Intergenic
964773293 3:160247519-160247541 GGTGAGAGGGAGAATGGATGTGG - Intronic
964813940 3:160696195-160696217 GATGAGAGAGAGGATGGGGGAGG - Intergenic
965137263 3:164787226-164787248 GGTGAAAGTGAGGCTGGGGGAGG + Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965651520 3:170938639-170938661 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
965727268 3:171731489-171731511 AATGAGAGGGAGGCTGGGCACGG + Intronic
966022899 3:175237479-175237501 AATGGGAGAGAGGCTGGGGGTGG - Intronic
966478488 3:180377652-180377674 GCTGATAGGGTGACTGGGGAGGG + Intergenic
966589746 3:181668834-181668856 GGGGGGTGGGAGACTGGGGGAGG + Intergenic
966723303 3:183085991-183086013 GCTGAAGGAGAGACTGGGGGAGG - Intronic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
966915157 3:184580630-184580652 GCTGGGAGGGAGACTGGGGGCGG + Intronic
967052806 3:185800276-185800298 GGAGAGTGGGGGACTGGGGGAGG + Intronic
967473441 3:189889408-189889430 GATGGCATGGAGAGTGGGGGAGG - Exonic
968505009 4:967527-967549 GGTAAGGGGGAGGCTGGGGGAGG - Exonic
968533959 4:1112675-1112697 GATGAGGGGGACACAGGGGTCGG - Intronic
968539093 4:1154067-1154089 GAGGGGAGGGAGGCTGGGTGTGG + Intergenic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
968937056 4:3617094-3617116 GAAGGAAGGGAGACTGGGAGGGG - Intergenic
969111328 4:4846162-4846184 GATGAAAGGGAGAGAGAGGGAGG - Intergenic
969300578 4:6294771-6294793 GCAGAGAGGGACACTTGGGGTGG + Intronic
969318433 4:6395880-6395902 GCAGAGAGGGGGCCTGGGGGAGG - Intronic
970673895 4:18426414-18426436 GGTGAGCGGGAGGCTAGGGGAGG + Intergenic
970904544 4:21200634-21200656 GAAGAGAGGGAGGGTGAGGGTGG + Intronic
971260444 4:25052118-25052140 TATGGGAGGGACACAGGGGGAGG + Intergenic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
972923147 4:43968442-43968464 CATGAGAGTGATAGTGGGGGAGG - Intergenic
973559681 4:52122670-52122692 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
973822749 4:54677248-54677270 GATGAGAGTGGGGATGGGGGCGG - Intronic
974000940 4:56510067-56510089 TATAAGAGGGAGGCTGGGTGCGG + Intronic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974254236 4:59428918-59428940 GATGGCAGTGAGGCTGGGGGTGG + Intergenic
974658399 4:64854994-64855016 TAGGAGATGGAGACTGTGGGAGG - Intergenic
975455461 4:74585125-74585147 GAAGAGAGGGAGAATGGCTGAGG + Intergenic
975603300 4:76125837-76125859 GGAGAGAGGGAGAGAGGGGGAGG + Intronic
975715874 4:77205501-77205523 GAGGAGGGGGCGGCTGGGGGCGG - Intronic
975849928 4:78561634-78561656 GATGTGAGGGAGACCAGAGGAGG - Intronic
976725786 4:88214397-88214419 GATTTGAGAGAGAATGGGGGAGG - Intronic
977171904 4:93772632-93772654 GAGGAGAGGGAGAAGGTGGGAGG - Exonic
977352286 4:95903885-95903907 GATGAGGAGGAGACTGGGGATGG + Intergenic
977715119 4:100173531-100173553 GAGGAGAGGGAGAGAGGTGGGGG + Intergenic
978412526 4:108441126-108441148 GATGGCAGCGAGGCTGGGGGAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
978773309 4:112480279-112480301 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
978900816 4:113947545-113947567 GGAGAGAGGGAGAGTGAGGGAGG + Intronic
979637989 4:122978704-122978726 TATGTGAGGGAGGCTGAGGGTGG - Intronic
979726945 4:123973575-123973597 GTGGAGTGGGAGAATGGGGGAGG + Intergenic
979874624 4:125872401-125872423 TGTGAGAGGGAGACTTGGGAAGG - Intergenic
979876572 4:125898883-125898905 GAAGAGAGGGAGGCGGGGGGAGG - Intergenic
980018171 4:127677027-127677049 GATGGCAGGGAGGCTGGGGGAGG + Intronic
980528494 4:134019835-134019857 GATGAAAGAGACACTGGGGTTGG + Intergenic
980545932 4:134261232-134261254 CATGGGAGGGAGCCTGGGGGAGG - Intergenic
981836147 4:149056619-149056641 GAAGAGAGGGATACTAGAGGGGG + Intergenic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
983647382 4:170005579-170005601 GATGAGAAGGAGAGAGGAGGAGG - Exonic
983688450 4:170438433-170438455 TATGAGAGGAAGACTGGAGATGG - Intergenic
983893292 4:173054180-173054202 GAAGAGAGGGAGAATGAGAGAGG + Intergenic
984145806 4:176058718-176058740 CATGACAGAGAGACTGGGGTGGG + Intergenic
984191612 4:176612868-176612890 GATTAGAGGGAGACAGAGGTTGG - Intergenic
985182218 4:187277411-187277433 GAGGAGAAGGAGGCTGGGTGAGG - Intergenic
985493695 5:193187-193209 GCTGGGAGGGAGCCTGGTGGTGG + Intronic
985774093 5:1831671-1831693 GATGAGAGGCACTCTGGGGCTGG + Intergenic
985827645 5:2204883-2204905 TAGGAGAGGGAGGCTGGTGGGGG + Intergenic
985943166 5:3155229-3155251 GCTGGGAAGGAGACTGTGGGAGG + Intergenic
986284057 5:6347148-6347170 GAGGAGAGGGAACCTGGAGGAGG - Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986857026 5:11881430-11881452 GATGAGAAGGATAGTGGGGAGGG - Intronic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989753713 5:44925616-44925638 GATGAGAAGGAGGCCGGGCGCGG - Intergenic
989977297 5:50601841-50601863 GGTGGCAGGGAGGCTGGGGGAGG - Intergenic
991472560 5:66984743-66984765 GATGAGTTGGAGGATGGGGGCGG + Intronic
992428556 5:76684647-76684669 GGTGAGATGGAGACTGGAAGTGG + Intronic
992827697 5:80567302-80567324 AATGAAAGGAAAACTGGGGGTGG - Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
994350276 5:98737613-98737635 GATGGCAGTGAGGCTGGGGGAGG + Intergenic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
994846369 5:104993422-104993444 TATGGGAGGTAGACTGGGGCTGG + Intergenic
995905461 5:117117493-117117515 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
996662896 5:126025850-126025872 GATGAAAGGGAGAATGAAGGGGG - Intergenic
996796196 5:127350990-127351012 GATGGGAAGGATAGTGGGGGTGG + Intronic
997034815 5:130176840-130176862 GAGGAGTGGGATACTAGGGGAGG + Intronic
997098373 5:130939753-130939775 GGGTAGAGGGAGGCTGGGGGAGG - Intergenic
997658102 5:135570024-135570046 GATGCCAGGGGGACTCGGGGAGG - Intergenic
998039367 5:138942889-138942911 GCTGAGAGAGAGGCTGGGTGGGG - Intergenic
998053239 5:139053736-139053758 GAGGAGATGGAGGCTGAGGGTGG - Intronic
998151329 5:139759148-139759170 GGAGAGACGGAGAATGGGGGAGG - Intergenic
998281387 5:140811150-140811172 GAGGTGTGGGGGACTGGGGGAGG - Intronic
998283768 5:140837967-140837989 GATGAAAGGCAGGCTGGGTGTGG - Intronic
998392048 5:141793535-141793557 GATGAGAGGGAGTGGGGGAGGGG - Intergenic
999089283 5:148921160-148921182 TAAGGGAGGGAGACTGGGTGAGG + Intergenic
999270124 5:150291901-150291923 GAGGAGAGGGAGGGTGGGAGAGG + Intergenic
999311491 5:150554712-150554734 CATGTGAGGGAGAGTGGGTGGGG - Exonic
999396567 5:151232998-151233020 GATGAGATGTATATTGGGGGAGG - Intronic
999709889 5:154308702-154308724 GATGAGCTGCAGACTGGAGGTGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000268185 5:159657968-159657990 GAGGAAAGGGAGGCTGGGAGGGG + Intergenic
1000628272 5:163564042-163564064 GCTGCAAGGGAGACTGGCGGGGG - Intergenic
1000719760 5:164692343-164692365 AATGAGAGGGAGAATGGCTGTGG + Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001696708 5:173675676-173675698 GAGGGGAAGGAGACTTGGGGTGG - Intergenic
1001824400 5:174733745-174733767 GGTGAGAGGGTGGCTGGGGGTGG - Intergenic
1001857241 5:175023572-175023594 GAGGCGAGGGAGACTGGAGGGGG - Intergenic
1002319682 5:178367594-178367616 CATGTTAGGGAGGCTGGGGGCGG + Intronic
1002724664 5:181286566-181286588 GTTTAGAGGGAGAGTGGGGTGGG - Intergenic
1002899552 6:1399469-1399491 GAGGAGAGGGAAGCAGGGGGAGG + Intergenic
1003691298 6:8356302-8356324 GAGGGGTGGGAGGCTGGGGGAGG + Intergenic
1003824475 6:9937657-9937679 AATGAGAGTGAGACTGGGTAGGG + Intronic
1003825232 6:9944987-9945009 GATGAGGGGGAGAATGATGGTGG - Intronic
1003901503 6:10659664-10659686 GAAGAGGGGGAGACGGGGAGAGG + Intergenic
1004097769 6:12575820-12575842 GGTGACAGGGAGAGTGGAGGTGG - Intergenic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1005100936 6:22172066-22172088 GGTGAAAGCGAGGCTGGGGGAGG - Intergenic
1006014416 6:31068256-31068278 GAGGAGAGGGAGAGGGGGAGGGG + Intergenic
1006041525 6:31260214-31260236 GGTGACAGTGAGGCTGGGGGAGG - Intergenic
1006210094 6:32386085-32386107 GAGGAGAGGGAGAGGGGGAGGGG + Intergenic
1006303818 6:33207573-33207595 AATGAGAGGGATACAGGGCGAGG - Intergenic
1006942715 6:37763550-37763572 GATGGGATGGAGAGTGGGGTGGG - Intergenic
1007070007 6:39029537-39029559 TATGAGAGAGACACTGGGGAGGG + Intronic
1007115336 6:39339335-39339357 AGTGAGAGGGAGGCTTGGGGAGG + Intronic
1007125515 6:39422746-39422768 GGAGGGAGGGAGACTGGGGCTGG - Intronic
1007243682 6:40444797-40444819 ACTGAGAGGGAGACTGTGCGGGG - Intronic
1007385537 6:41518044-41518066 TATGAGGAGGAGGCTGGGGGTGG - Intergenic
1007470754 6:42088701-42088723 GGTGAGAGTGGGACTGGGGCTGG - Intergenic
1007554806 6:42756923-42756945 GGAGAGAGGGAGGGTGGGGGGGG - Intronic
1007581523 6:42963004-42963026 GATGGGAGGGAGACTGGTGCTGG + Intronic
1008413147 6:51206848-51206870 AATGAAAGGGAGGCTGGGTGCGG + Intergenic
1008467025 6:51842587-51842609 GATTGGAGGGAGGCGGGGGGAGG - Intronic
1008816879 6:55579081-55579103 GAGGGGAGGGAGACTGGAGGAGG + Exonic
1008979836 6:57470452-57470474 AAAGAGAGGGAGACGGGGAGAGG - Intronic
1009239172 6:61163315-61163337 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009424685 6:63501079-63501101 AATGAGAGGAAGACTGGGCCTGG + Intergenic
1009643139 6:66362968-66362990 TATGGGAGGGAGACTGAAGGGGG - Intergenic
1010341769 6:74761949-74761971 GAAGATAGGGAGGCTGGGCGCGG + Intergenic
1010652115 6:78467623-78467645 GGTGGGAGCGAGGCTGGGGGAGG + Intergenic
1011271577 6:85585235-85585257 GGGGAGTGGGGGACTGGGGGAGG + Intronic
1011470705 6:87704747-87704769 GGTGAAGGGGAGACTGGGTGGGG + Intergenic
1011533528 6:88351233-88351255 GGTGGCAGGGAGGCTGGGGGAGG + Intergenic
1012422412 6:99079374-99079396 GGGGAGAGGGAGAGAGGGGGAGG - Intergenic
1012907910 6:105089479-105089501 GATGAGAGTGAGAGTGGGTTTGG - Intergenic
1013024564 6:106258133-106258155 GAGGAGATGGGGAGTGGGGGTGG - Intronic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1014094711 6:117447165-117447187 GATGAGGGGAATACTGAGGGAGG + Intronic
1014185233 6:118427224-118427246 GGTGGCAGGGAGGCTGGGGGAGG + Intergenic
1014679698 6:124412882-124412904 GGTGACAGGGAGGCTCGGGGAGG - Intronic
1015570843 6:134619789-134619811 GCTAAGAGTGAGAATGGGGGAGG + Intergenic
1016337978 6:143029384-143029406 GGTGGGTGGGGGACTGGGGGAGG - Intergenic
1016567761 6:145475462-145475484 GATGGGTGGGAGGCTAGGGGAGG + Intergenic
1016683557 6:146856909-146856931 GGGGAGTGGGGGACTGGGGGAGG + Intergenic
1016827846 6:148404758-148404780 GATGAGGGCGAGGCTGGGGTGGG - Intronic
1017125990 6:151065316-151065338 AGTGAGAGGGAGCCTGGGGCAGG - Intronic
1017128732 6:151090286-151090308 AGGGAAAGGGAGACTGGGGGTGG - Intronic
1017443894 6:154489977-154489999 GAGAGGAGGGAGACTGGGGTGGG - Intronic
1017755891 6:157528829-157528851 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755899 6:157528885-157528907 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755907 6:157528941-157528963 AATTAGATGAAGACTGGGGGTGG + Intronic
1018187579 6:161280297-161280319 GGTGAGAAGCAGACTGGAGGGGG - Intergenic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019379047 7:711975-711997 GATGAGGGTGAGACTGTGGATGG + Intronic
1019404754 7:877496-877518 GAAGAGAGAGAGACGGGGGGTGG - Intronic
1019833475 7:3357460-3357482 GATGCCAGGGAGACTGAGGTGGG - Intronic
1020834547 7:13132510-13132532 CAAGAGAGAGAGACTTGGGGAGG - Intergenic
1021315762 7:19145273-19145295 GAGGAGAGGGCGTCTCGGGGAGG + Exonic
1021893878 7:25214994-25215016 GATGAAATTGAGACTTGGGGTGG + Intergenic
1022327021 7:29341605-29341627 GATGGGAGGGAGAGAGGGAGGGG + Intronic
1022899356 7:34787723-34787745 GAGGAGAGGGAGACAGATGGAGG + Intronic
1023752477 7:43385490-43385512 CATGTGAGTCAGACTGGGGGTGG - Intronic
1023831007 7:44039016-44039038 AATGAGGGCGGGACTGGGGGGGG + Intergenic
1023860940 7:44217460-44217482 GGTGAGAGGGAGAGGAGGGGAGG + Exonic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024920031 7:54545845-54545867 GAAGAGAGGGAGAATTGGAGTGG + Intronic
1025258235 7:57399601-57399623 GATGGGAGTGAGCCTGGGGCAGG + Intergenic
1026133149 7:67636818-67636840 GAAGAGAGGGAGGAAGGGGGAGG - Intergenic
1026195947 7:68173920-68173942 GATGGGGGGCAGACTGGGGGAGG - Intergenic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1026827847 7:73595414-73595436 GCAGAGAGGGAAACTGAGGGAGG - Intronic
1026829119 7:73600612-73600634 GATGAGAGGGGGCCTAAGGGTGG + Intronic
1027611038 7:80360809-80360831 GATGACAGGCAGAATGGGTGAGG + Intergenic
1028086558 7:86644293-86644315 TATAAGAGGGAGGGTGGGGGAGG + Exonic
1028115315 7:86990373-86990395 CATGGGAGTGAGACTGGTGGTGG + Intronic
1028497871 7:91482381-91482403 GGTGGCAGGGAGGCTGGGGGAGG - Intergenic
1028592413 7:92511988-92512010 GAGGAAAGGGAGAATGGGGTTGG - Intronic
1028619585 7:92810487-92810509 GCAGTGAGGGAGACTGGGGGAGG - Intronic
1029122495 7:98278284-98278306 GATGGGCGGGGGGCTGGGGGGGG + Intronic
1029448228 7:100626718-100626740 GAGGGGCGGGACACTGGGGGCGG + Intronic
1029704464 7:102268792-102268814 GAAGAGAGAGAGAATGGGGGTGG + Intronic
1029941550 7:104485761-104485783 GAGGGGTGGGAGGCTGGGGGAGG - Intronic
1030963790 7:115962993-115963015 GGGGAGAGGGGGACTGGGGGAGG - Intronic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1031995519 7:128227867-128227889 GATAAGAGGGACACAGGGTGTGG + Intergenic
1032440964 7:131942892-131942914 GATAAGAGGGAGGGTGGGGAGGG + Intergenic
1032467270 7:132153897-132153919 GATGATAGGAAGACTGGAAGTGG - Intronic
1032486595 7:132292271-132292293 AATCAGAGGGAGGCTGGAGGTGG + Intronic
1032797648 7:135290517-135290539 GCTGAAAAGGGGACTGGGGGTGG - Intergenic
1032955140 7:136961862-136961884 GAGGAGAAGGAGACGTGGGGAGG + Intronic
1032993945 7:137424816-137424838 GGTGGGAGCGAGACTGGGGGAGG + Intronic
1033208343 7:139441470-139441492 GGTGGGTGGGGGACTGGGGGAGG + Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033395751 7:140972219-140972241 GATGGGGGGAAGACTGGGTGTGG - Intergenic
1033794423 7:144831022-144831044 GATGAGAGGCAGGCTGGAGTCGG - Intronic
1033902270 7:146157667-146157689 GGTGGCAGCGAGACTGGGGGAGG + Intronic
1033932975 7:146546998-146547020 GAAGAGAGGGAGACAGGCAGGGG + Intronic
1033962216 7:146928864-146928886 GGTGGCAGGGAGGCTGGGGGAGG + Intronic
1034024874 7:147690027-147690049 GAAGGAAGGGAGACTGGAGGCGG - Intronic
1034290023 7:149923007-149923029 GCTGAAAGGGAGAAAGGGGGAGG + Intergenic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034460682 7:151196300-151196322 GATGAGCTGGGGACTGGGGTTGG + Intronic
1034540561 7:151755389-151755411 GAGCAGAGGAAGACAGGGGGTGG + Intronic
1034574778 7:151987600-151987622 GAGGAGAGCAAGACTGGGGGTGG + Intronic
1035111226 7:156483709-156483731 GAGGAGGGGGAGACAGGAGGGGG + Intergenic
1035280777 7:157776690-157776712 GAGGAGAGGGAGGCAGGAGGAGG - Intronic
1036129686 8:6097584-6097606 GAGGAGAGAGAGACCGAGGGGGG + Intergenic
1036218905 8:6904019-6904041 GATGAGACAGAGACTCAGGGAGG - Intergenic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1036708081 8:11059743-11059765 GGTGAGAGGGAGCCGCGGGGCGG - Intronic
1036752657 8:11453089-11453111 GAGGAGAGGAAGCCTGGAGGAGG - Intronic
1036797736 8:11768495-11768517 GAGGAGAGGGAGGCCTGGGGAGG - Intergenic
1037437553 8:18879293-18879315 GATAAGAGGGAGACAGGGCAAGG + Intronic
1037506786 8:19538637-19538659 GAACTGAGGGAGACCGGGGGAGG + Intronic
1037724163 8:21469268-21469290 GAAGAGAGGGAGAAGTGGGGAGG + Intergenic
1038029670 8:23626774-23626796 GATGAAAGTGGGGCTGGGGGTGG + Intergenic
1038124745 8:24660483-24660505 GAAGAGAGAGAGAGAGGGGGAGG - Intergenic
1038190786 8:25318483-25318505 GAGGAGAGGAAAAGTGGGGGAGG - Intronic
1038319377 8:26513745-26513767 GAGGAGAGGGGCACTGGGGCTGG + Intronic
1038607144 8:29018822-29018844 GATGTGGCAGAGACTGGGGGAGG - Exonic
1038862103 8:31398949-31398971 AAAGAGAGAGAGACTTGGGGTGG - Intergenic
1039236591 8:35509059-35509081 GAGGAGAGGGAGGCTTGAGGAGG + Intronic
1039237453 8:35517432-35517454 GAGGAAAGTGAGACTGGGGATGG + Intronic
1039323517 8:36459939-36459961 GAGGGGTGGGAGACTAGGGGAGG + Intergenic
1039413581 8:37375457-37375479 GAGGAGAGGGGGCCTGGGGGTGG - Intergenic
1039893350 8:41699134-41699156 GATAAGAGGGAGAGGGGGTGTGG + Intronic
1041045353 8:53881901-53881923 GGAGGGCGGGAGACTGGGGGCGG + Intronic
1041167094 8:55101787-55101809 GATTTGAGCGACACTGGGGGAGG - Intergenic
1041203781 8:55476825-55476847 GATGGTAGCGAGGCTGGGGGAGG + Intronic
1041216487 8:55606715-55606737 GATGAGAGTGGGGCTGGGGTAGG - Intergenic
1041734819 8:61098748-61098770 TCAGAGAGGCAGACTGGGGGTGG - Intronic
1041919152 8:63163888-63163910 GAAGAGGGGGAGAATGGGTGGGG - Intergenic
1042680497 8:71378197-71378219 AATGGCAGGAAGACTGGGGGTGG - Intergenic
1043123457 8:76360425-76360447 GGTGGGAGTGAGGCTGGGGGAGG + Intergenic
1043700390 8:83280275-83280297 AGTGAGTGGGAGCCTGGGGGAGG - Intergenic
1043958713 8:86390694-86390716 GACGAGAGGGAGACGGGAGAGGG + Intronic
1044254574 8:90045461-90045483 GGTGGCAGTGAGACTGGGGGAGG + Intronic
1044326429 8:90864336-90864358 GAAGAGAGGGAGGGAGGGGGAGG + Intronic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1045127125 8:99104561-99104583 GATGAAAGGGAGAGGGGAGGGGG - Intronic
1045154789 8:99455456-99455478 GAAGAGAGGGAGGGTTGGGGAGG + Intronic
1045319692 8:101072667-101072689 GATGAGAGGAAGAGAGGGAGCGG + Intergenic
1045419531 8:102000307-102000329 GATGGCAGCGAGGCTGGGGGAGG + Intronic
1045755703 8:105538719-105538741 AATGAGATGGAGGCTGGGTGTGG + Intronic
1046148614 8:110194005-110194027 GAGGGTGGGGAGACTGGGGGTGG + Intergenic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1047157162 8:122332282-122332304 AAAGAGAAGGAGAGTGGGGGTGG - Intergenic
1047374057 8:124279327-124279349 GATGAGAGGGAGAATGTTTGGGG + Intergenic
1047741892 8:127813296-127813318 GGTGATGGGAAGACTGGGGGAGG + Intergenic
1047754259 8:127906596-127906618 GTTGAGAGGGGGATGGGGGGTGG + Intergenic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049361149 8:142213075-142213097 AAAGAGAGGGAGAGTGAGGGAGG - Intronic
1049406692 8:142454767-142454789 GAAGAGAGGGAGGGTGGGGCAGG - Intronic
1049499220 8:142952560-142952582 GCTGAGGGGGTGGCTGGGGGTGG + Intergenic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1049700438 8:144008907-144008929 GAGGAGAGGAAGCCTGGCGGAGG + Intronic
1050019702 9:1270095-1270117 GCAGAGAGGGAGAGAGGGGGTGG - Intergenic
1050301298 9:4261370-4261392 GAAGAAAGGGAGACAGGGGAGGG + Intronic
1050422184 9:5477541-5477563 GGTGGTAGGGAGGCTGGGGGAGG - Intergenic
1050497931 9:6264024-6264046 GATGGCAGTGAGGCTGGGGGAGG - Intergenic
1050766497 9:9141229-9141251 GGGGAGAGGAAGACGGGGGGAGG - Intronic
1051314782 9:15817627-15817649 GGTGGCAGGGAGGCTGGGGGAGG + Intronic
1051388635 9:16539538-16539560 GAAGAGAGGGAGAGAGGGGGAGG + Intronic
1052987433 9:34498043-34498065 GATGAGAGCAAGGCTGGAGGAGG + Intronic
1053016954 9:34667314-34667336 AATGAGAGGGAGAAAGAGGGTGG - Intergenic
1053157760 9:35792216-35792238 GATGGGAGGAAGGCGGGGGGCGG - Exonic
1053424646 9:38003177-38003199 GATGAGAGTGAGAAGGGGGCAGG + Intronic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1054377136 9:64457953-64457975 GATGGGAGGGGGACCGGGGTTGG + Intergenic
1054454091 9:65420594-65420616 GAAGGAAGGGAGACTGGGAGGGG + Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1054946894 9:70805206-70805228 GGTGAGAGAGAGACTGGGGTGGG + Intronic
1055760888 9:79606518-79606540 GGGGAGTGGGGGACTGGGGGAGG - Intronic
1055877675 9:80962813-80962835 TATGAGAGGGACCCTGTGGGAGG - Intergenic
1055998660 9:82190807-82190829 CATGAGAGGGACCCAGGGGGAGG + Intergenic
1056094031 9:83232796-83232818 GAGGAGAGGGGGAGTGGGGGTGG - Intergenic
1056126108 9:83537850-83537872 GAGGGGAAGGAGACTGGGCGCGG + Intronic
1056316560 9:85395997-85396019 GCTGAGAAGGAGACTGCAGGTGG + Intergenic
1056701799 9:88917446-88917468 GGTGAGAAGGAGGCTGAGGGTGG + Intergenic
1056711333 9:88994238-88994260 GAGGAGACCGAGGCTGGGGGAGG - Exonic
1057226059 9:93293778-93293800 GATGAGAGGCAGACAGGGTGAGG - Intronic
1057722924 9:97547212-97547234 GATGAGGGGGATATTGGAGGGGG - Intronic
1058139505 9:101342516-101342538 GATGGGGGGGAGAGTGGGAGGGG + Intergenic
1058270691 9:102968149-102968171 TATGAGAGTGAGGCTGAGGGGGG - Intergenic
1058314536 9:103548350-103548372 AAAGAGAGGGAGAGTGGGAGGGG + Intergenic
1058642980 9:107105225-107105247 CATGAGAGGGAGTCTGCTGGGGG - Intergenic
1058687302 9:107489865-107489887 GATGGAAGGGAGCCTCGGGGGGG - Intronic
1059426378 9:114223340-114223362 GCTCAGAGGGAGGCTGGAGGAGG + Intronic
1059453254 9:114383905-114383927 GTAGAGAGGAAGACTGGGCGGGG - Intronic
1059507497 9:114813177-114813199 GATGATAGGGAGAGTGAAGGCGG + Intergenic
1060750686 9:126166439-126166461 GGGGAGAGGGACACTGGGGAGGG + Intergenic
1060998974 9:127891714-127891736 GAGGAGAGGGAGAAGGGGAGGGG + Intronic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061119689 9:128635321-128635343 GAAGAGAGGGAGGGTAGGGGTGG - Intronic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061462053 9:130747707-130747729 TATAAGAGGAAGACTGGGGCTGG - Intronic
1061628309 9:131855559-131855581 GCTGGGAAGGAGAGTGGGGGAGG + Intergenic
1061743947 9:132726255-132726277 GAAGAGAGGGAGGATAGGGGAGG - Intronic
1061775325 9:132959176-132959198 CATGGTAGGGAAACTGGGGGAGG + Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1061974179 9:134060054-134060076 GCTGAGTGGGAGACCCGGGGAGG - Intronic
1062084923 9:134643534-134643556 GATGAGCTGGAGTCTGGGTGTGG + Intronic
1062522990 9:136966466-136966488 AGCGAGAGGGAAACTGGGGGAGG + Intergenic
1062527695 9:136984965-136984987 GAAGAGAGGGAGAGAGGGGCAGG - Exonic
1062638024 9:137501628-137501650 GGTGAGCGGGGGTCTGGGGGGGG - Exonic
1203785475 EBV:125186-125208 GGTAAGAGGGAGATGGGGGGAGG + Intergenic
1185431341 X:13653-13675 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185431367 X:13717-13739 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185431447 X:13942-13964 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185431490 X:14066-14088 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185432178 X:17625-17647 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185432675 X:18802-18824 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185440631 X:226114-226136 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185440657 X:226178-226200 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185440724 X:226463-226485 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185442026 X:231624-231646 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185775541 X:2800185-2800207 GATGAGAGGGAGACAGGAAGAGG + Intronic
1185815375 X:3150271-3150293 GAGGAGAGGAGGACTGGGTGTGG - Intergenic
1186174108 X:6907093-6907115 AATGGGAGGGAGACGGTGGGAGG + Intergenic
1187026595 X:15441672-15441694 GATGAGGGGGAGGCAGGAGGTGG + Intronic
1187033130 X:15509227-15509249 CCTGAGAGGGAGATTGGGGTGGG - Intronic
1187316410 X:18199328-18199350 GAGGCAAGGGAGATTGGGGGAGG + Intronic
1187464301 X:19514703-19514725 GAGACGAGGGGGACTGGGGGAGG + Intronic
1187505305 X:19874419-19874441 GAGGAGAGGAAGAGTTGGGGGGG + Intronic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190179213 X:48177475-48177497 GAGGAGAGGGAGAGGAGGGGAGG + Intergenic
1190329178 X:49225181-49225203 GATGAGGGGCAGAGTCGGGGTGG + Intronic
1190488655 X:50957783-50957805 GGTGGGTGGGAGATTGGGGGAGG + Intergenic
1190519450 X:51262437-51262459 GGTGACAGCGAGGCTGGGGGAGG + Intergenic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1190903104 X:54697908-54697930 GATGGCAGCGAGGCTGGGGGAGG + Intergenic
1191221215 X:57989974-57989996 GCTAAGTGGGAGACTGAGGGGGG + Intergenic
1192145436 X:68679335-68679357 TATCATAGGGAGGCTGGGGGAGG - Intronic
1192170364 X:68851063-68851085 GATCAGAGGGACTCTGGGGCGGG + Intergenic
1192175069 X:68880306-68880328 GCAGAGAGGCAGACTGGGAGGGG - Intergenic
1192412149 X:70943673-70943695 GATGGCAGCGAGGCTGGGGGAGG - Intergenic
1193051360 X:77103111-77103133 GATGGCAGCGAGGCTGGGGGAGG - Intergenic
1193071618 X:77312130-77312152 AATAAGAGGGAGGCTGGGTGCGG + Intergenic
1193238285 X:79135670-79135692 GATGAGATGGATACATGGGGAGG + Intergenic
1193395813 X:80982367-80982389 GGTGACAGCGAGGCTGGGGGAGG - Intergenic
1194222972 X:91219095-91219117 GAGGGGTGGGAGGCTGGGGGAGG - Intergenic
1194524307 X:94959018-94959040 GATGGGAGTGTGAATGGGGGTGG - Intergenic
1194556085 X:95361822-95361844 AGTGAGAGAGAGAGTGGGGGCGG - Intergenic
1194573583 X:95583203-95583225 GATGAGTGAGAGACTGAGGCAGG - Intergenic
1194960094 X:100224919-100224941 GAGTAGAGGTGGACTGGGGGAGG - Intergenic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195468687 X:105210019-105210041 GATGGGGTGGAGACTGGAGGAGG - Intronic
1195698244 X:107682707-107682729 GATGAGTGGCAGTCTGGGTGAGG - Intergenic
1195886584 X:109645075-109645097 GGTGGCAGGGAGGCTGGGGGAGG + Intronic
1195967290 X:110440058-110440080 GATGAGAGACATCCTGGGGGTGG - Intronic
1195983662 X:110606246-110606268 GGTGGCAGGGAGGCTGGGGGAGG + Intergenic
1196481897 X:116159615-116159637 GATGGCAGCGAGGCTGGGGGAGG + Intergenic
1196768641 X:119272208-119272230 GAGGGGAGAGAGGCTGGGGGAGG - Intergenic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1196985959 X:121271124-121271146 CATGTCAGGGAGACAGGGGGAGG + Intergenic
1197862139 X:130982385-130982407 GATGAGAGGCAGAGTGAGAGGGG + Intergenic
1198425226 X:136511909-136511931 GATGAGAGGGGGACTTTGGGTGG + Exonic
1199324462 X:146481132-146481154 GTTGGGTGGGAGAATGGGGGTGG - Intergenic
1199536674 X:148910561-148910583 GATGGAAGGGACAATGGGGGAGG + Intronic
1199893213 X:152108972-152108994 GTTGAGAGTGAGAGTGGAGGAGG - Intergenic
1200559450 Y:4682550-4682572 GAGGGGTGGGAGGCTGGGGGAGG - Intergenic
1200732120 Y:6753539-6753561 GATGGGTGGGGGACTAGGGGAGG - Intergenic
1201265923 Y:12206460-12206482 GAGGAGAGGAGGACTGGGTGTGG + Intergenic
1201294377 Y:12451172-12451194 GATGAGAGGGAGACAGGAAGAGG - Intergenic
1201347861 Y:13004647-13004669 GATGGCAGCGAGGCTGGGGGAGG + Intergenic
1201971463 Y:19802025-19802047 GCTGGCAGCGAGACTGGGGGAGG + Intergenic
1201975036 Y:19839805-19839827 GATGGCAGGAAGGCTGGGGGAGG - Intergenic