ID: 1118734654

View in Genome Browser
Species Human (GRCh38)
Location 14:68692577-68692599
Sequence ATCCTGAATGAGGTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118734647_1118734654 3 Left 1118734647 14:68692551-68692573 CCCCAAAGCCAGCTTCCAGAGAG 0: 1
1: 0
2: 5
3: 28
4: 259
Right 1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1118734651_1118734654 -5 Left 1118734651 14:68692559-68692581 CCAGCTTCCAGAGAGGACATCCT 0: 1
1: 0
2: 1
3: 23
4: 236
Right 1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1118734650_1118734654 1 Left 1118734650 14:68692553-68692575 CCAAAGCCAGCTTCCAGAGAGGA 0: 1
1: 0
2: 0
3: 31
4: 278
Right 1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 169
1118734648_1118734654 2 Left 1118734648 14:68692552-68692574 CCCAAAGCCAGCTTCCAGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG 0: 1
1: 0
2: 1
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118734654 Original CRISPR ATCCTGAATGAGGTCTTGAG AGG Intronic
903570281 1:24299309-24299331 ATGCCAAATGAGGTCCTGAGTGG - Intergenic
904286824 1:29458256-29458278 ATTCTGAGTGGGGTTTTGAGAGG + Intergenic
910087875 1:83425566-83425588 AGCCAGAATGAGGAGTTGAGGGG + Intergenic
912681688 1:111733123-111733145 ATCATGAAGGAGGTCTGGGGAGG - Intronic
914745191 1:150496490-150496512 ATCCTTATGGAGGTCTTCAGGGG + Exonic
915135673 1:153729443-153729465 GACCTGAATGAGGACTTCAGGGG + Intronic
916945148 1:169718886-169718908 ATCTTGCATGAGGAGTTGAGAGG - Intronic
917248011 1:173025463-173025485 ATAGTGAATGAGTTCTTGAGAGG - Intergenic
919560744 1:199115390-199115412 ATCCTTAATGGGGGCTTAAGTGG + Intergenic
924176960 1:241400920-241400942 AGCCTGAGGGAGGTTTTGAGAGG + Intergenic
1063599124 10:7464069-7464091 ATAATGAATGAGTTCTTGAAAGG - Intergenic
1064042475 10:11980017-11980039 ATCCTGAATGAAGATCTGAGTGG - Intronic
1065683503 10:28261467-28261489 ATCCTAAATGTGGTCATAAGTGG + Intronic
1069107727 10:64404402-64404424 ATCCTGAATGGACTTTTGAGAGG - Intergenic
1071862095 10:89684843-89684865 ATCCTGAGTCATGTCTTGTGAGG + Intergenic
1072021015 10:91401520-91401542 ATCTTGAAATAGGTCTTGAAAGG + Intergenic
1073461079 10:103666207-103666229 ATCATGAATGATGTATTGAATGG - Intronic
1073748194 10:106493913-106493935 AACCTGAATGAGGCCTGAAGTGG + Intergenic
1075404001 10:122182325-122182347 CTCCTGAATGAGGCCTTCAGAGG - Intronic
1075761643 10:124862080-124862102 ATCCTTGATGAGCTCTTGAGTGG + Intergenic
1076311263 10:129509321-129509343 ATCCTGCATGTCGTCTCGAGGGG - Intronic
1078438067 11:11341821-11341843 AGCCTGATCAAGGTCTTGAGAGG - Intronic
1080608120 11:33881377-33881399 ATCTTGAAGGAGGTCTTGGCAGG + Intronic
1081516264 11:43833340-43833362 ATCCTGAATGACGGGTAGAGAGG - Intronic
1082889219 11:58120502-58120524 TTCATGAATGAGTTCTTTAGTGG + Intronic
1084108049 11:66993593-66993615 ATGCTGAATGAAGTTTTTAGGGG + Intergenic
1085126925 11:74008317-74008339 ATCCTGATTTAGGTCTGGGGTGG + Intronic
1085879478 11:80448919-80448941 ATGCTGAGTGAGCTCTTGGGTGG - Intergenic
1085898224 11:80665062-80665084 ATCCTGAATGAACTGGTGAGAGG + Intergenic
1091859399 12:3766227-3766249 ATCCTGAAAGAAGCCATGAGGGG + Intergenic
1097723060 12:63044754-63044776 ATCCTCAATGCAGTGTTGAGAGG + Intergenic
1098911079 12:76209518-76209540 ATTCTGAATCAGCTCTTGATCGG + Intergenic
1104542663 12:129681790-129681812 ACCTTGCATGAGGCCTTGAGTGG + Intronic
1106379762 13:29224869-29224891 ATCCAGAATGAGGTCTTCACAGG + Intronic
1113583197 13:111443489-111443511 AACCTGAGTGAGGCCTTGTGAGG - Intergenic
1115573155 14:34686126-34686148 ATCTTCAATGAGGTCTGCAGGGG - Intergenic
1116778652 14:49211595-49211617 ATCCTGAATGAGCTTGGGAGTGG - Intergenic
1117018845 14:51548891-51548913 ATTCTGATTCAGGTCTGGAGTGG - Intronic
1118481997 14:66176609-66176631 TTTCTGACTGAGGTCTTGGGAGG - Intergenic
1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG + Intronic
1119767584 14:77200144-77200166 AGGCTGAATGAGGACTTGAATGG - Intronic
1120727913 14:87966480-87966502 ATACTGGATGAGGACTTGATAGG - Intronic
1125006577 15:34823903-34823925 ATCCTTAATGAGGTCTTGTGAGG - Intergenic
1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG + Intergenic
1131751044 15:95508608-95508630 ATACTGCATGAGGTCAAGAGGGG - Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133829302 16:9306897-9306919 TGCCTGAATGGGGTTTTGAGGGG - Intergenic
1137589567 16:49685375-49685397 ATGCAGCATGGGGTCTTGAGGGG + Intronic
1141031772 16:80595422-80595444 ACCCTGAATGAAATCTTGATGGG - Intergenic
1146681479 17:34811381-34811403 ATCTTGAAACAAGTCTTGAGGGG - Intergenic
1156859423 18:41818683-41818705 AGCAGGAAAGAGGTCTTGAGAGG - Intergenic
1157112903 18:44837721-44837743 CTCCTGACTCAGGTCTTTAGAGG + Intronic
1158275117 18:55758510-55758532 GTCCTGAATGAGGTCATTATGGG + Intergenic
1159577051 18:70192051-70192073 ATCCTCATTGAGGTTTAGAGAGG - Intronic
1160897097 19:1408036-1408058 ATCCTGAAGGAGAGCCTGAGGGG + Intronic
1165511233 19:36267873-36267895 ATGCTGAAAGAGGTTTGGAGAGG - Intergenic
1165511781 19:36270400-36270422 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165512331 19:36272901-36272923 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165512878 19:36275442-36275464 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165513434 19:36277997-36278019 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165513984 19:36280531-36280553 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165514536 19:36283068-36283090 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165515088 19:36285601-36285623 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165515638 19:36288137-36288159 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165516190 19:36290674-36290696 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165516740 19:36293200-36293222 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165517293 19:36295723-36295745 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165517845 19:36298258-36298280 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165518397 19:36300793-36300815 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165518946 19:36303325-36303347 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165519496 19:36305840-36305862 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165520045 19:36308368-36308390 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
1165624023 19:37270213-37270235 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165624569 19:37272754-37272776 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165625112 19:37275281-37275303 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165625646 19:37277819-37277841 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165626186 19:37280344-37280366 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165626727 19:37282871-37282893 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165627267 19:37285392-37285414 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165627808 19:37287920-37287942 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165628346 19:37290444-37290466 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165628885 19:37292969-37292991 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165629428 19:37295495-37295517 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165629969 19:37298020-37298042 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165630512 19:37300548-37300570 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1165631048 19:37303086-37303108 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
1168521362 19:57053392-57053414 ATCCTCAATTTGGTCTTGAGTGG - Intergenic
926599285 2:14824599-14824621 ATTCTGACTCAGGTCTGGAGTGG - Intergenic
931891967 2:66683054-66683076 ATTCTGCTTGACGTCTTGAGGGG + Intergenic
933167127 2:79088443-79088465 CTTCTGAAGTAGGTCTTGAGAGG - Intergenic
933967732 2:87443572-87443594 AGCCTGACTGAGGGCCTGAGAGG - Intergenic
934556612 2:95289903-95289925 ATCCTGGATGAGATCTGCAGAGG - Exonic
936326067 2:111506924-111506946 AGCCTGACTGAGGGCCTGAGAGG + Intergenic
937475490 2:122211575-122211597 ATCATGAATGAGGTCTGATGGGG + Intergenic
938016931 2:127874940-127874962 TTTCTGAATGGGGTCTTGAAAGG - Intronic
939553411 2:143643534-143643556 ATCATAAAGGAGGTCTGGAGTGG - Intronic
942495571 2:176536423-176536445 ATCCTGAAAGTGGTTTTAAGTGG - Intergenic
942592743 2:177562982-177563004 ATCCTTCATGATGCCTTGAGTGG - Intergenic
948394444 2:237633826-237633848 AGCCTGAATGGGGTCTTGGAGGG - Intronic
948655294 2:239473156-239473178 ATCTTGAATGTGGTTTTCAGTGG + Intergenic
1171231964 20:23493921-23493943 ATTCTTAATGAGTTCCTGAGTGG + Intronic
1173199887 20:40946482-40946504 ATCTTGAATGAGATCTTCAGGGG - Intergenic
1176363970 21:6021477-6021499 ACCCTGAATGAGGTCTGGGCAGG + Intergenic
1177151580 21:17460425-17460447 ATAATGAGTGAGGGCTTGAGTGG + Intergenic
1179759548 21:43517068-43517090 ACCCTGAATGAGGTCTGGGCAGG - Intergenic
1183714948 22:39528147-39528169 ATCCTAAATGAGGACATGAGGGG - Intergenic
949279832 3:2332773-2332795 ATGCTAAATGAGGACTTGATGGG + Intronic
951174784 3:19586622-19586644 ATTCTGGGTGAGGTGTTGAGGGG - Intergenic
952198706 3:31102757-31102779 GTCCTGAATGGGGACTTGAATGG + Intergenic
952524093 3:34191698-34191720 ATACTGAATGAAGCCTTTAGTGG + Intergenic
953051691 3:39350022-39350044 ATCCTGTATGGGTTCTAGAGTGG - Intergenic
953378215 3:42446673-42446695 ACCCTGATTCAGGTCTTGATGGG - Intergenic
956397060 3:68837291-68837313 ATTCTGATTCAGGTCTGGAGTGG - Intronic
958077790 3:88706276-88706298 ATCCTAATTGAGGTCTTTTGGGG - Intergenic
961586893 3:127936894-127936916 ATCATAAATAAGCTCTTGAGTGG + Intronic
963385885 3:144593952-144593974 TTCCTGAATCAGATATTGAGAGG + Intergenic
965436924 3:168663776-168663798 ATCCTGAGAGAAGTCTTCAGTGG + Intergenic
966561938 3:181330969-181330991 ATCCTGAATGAAGTGGAGAGAGG + Intergenic
966904453 3:184511870-184511892 ATCCAGAATGAAGTCCAGAGAGG + Intronic
967213270 3:187187526-187187548 CTCCTGAATGAGGTCTACAAAGG + Intergenic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
980354293 4:131723839-131723861 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980354830 4:131726345-131726367 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980355367 4:131728822-131728844 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980355916 4:131731323-131731345 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980356449 4:131733811-131733833 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980358600 4:131743774-131743796 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980359143 4:131746247-131746269 ATCCAGAAAGAGGTGTCGAGAGG - Intergenic
980360221 4:131751210-131751232 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980362930 4:131763603-131763625 ATCCAGAAAGAGGTGTGGAGAGG - Intergenic
980378352 4:131977389-131977411 ATCCAGAAAGAGGTGTGGAGAGG + Intergenic
980664474 4:135911956-135911978 GACCTGTATAAGGTCTTGAGAGG + Intergenic
980981133 4:139655425-139655447 ATCCTGAATGAAGTCCGGTGTGG - Intergenic
981186285 4:141807736-141807758 ATCCCGCATTAGGTCTTCAGTGG + Intergenic
982302044 4:153889550-153889572 CTCCTAAATGAGGGCTTCAGTGG + Intergenic
986384340 5:7216912-7216934 ATCAGGAATGAGTTCTGGAGGGG + Intergenic
988231571 5:28486375-28486397 ATTCTGAATGAATTCTTCAGTGG + Intergenic
990783342 5:59392116-59392138 ATCCTGAGTGTGAACTTGAGTGG + Intronic
991669158 5:69030311-69030333 ATTCTGCATGGGTTCTTGAGGGG - Intergenic
993563598 5:89444278-89444300 TTCCTGTATGAGGTTTTGATTGG - Intergenic
998526880 5:142850628-142850650 TTCCTGATTGAGCTCTTGGGAGG + Intronic
1004459813 6:15825402-15825424 ATCCTGAATAAGGGCTTGAAAGG + Intergenic
1006264920 6:32912955-32912977 AACTGGAATGAGCTCTTGAGTGG - Intergenic
1010636634 6:78267384-78267406 CTCCTGGATGAGGTCTTCCGTGG + Intergenic
1011513820 6:88130226-88130248 AGCATGAATCATGTCTTGAGGGG - Intergenic
1012626755 6:101414222-101414244 CTTCTGAATGAGGTCCTCAGTGG - Intronic
1013097978 6:106963262-106963284 ATACTGTATGAGGTCATGGGGGG - Intergenic
1013912390 6:115292406-115292428 ATTTTAAATGAGGTCTTGAAAGG + Intergenic
1017559278 6:155609649-155609671 ATCCTGCATCAGTTGTTGAGGGG - Intergenic
1024453160 7:49572447-49572469 ATGCTGAATGTGTACTTGAGAGG - Intergenic
1027304756 7:76882040-76882062 AGCCAGAATGAGGAGTTGAGGGG + Intergenic
1028903558 7:96127949-96127971 ATCCTGAATGGGCTGTTGGGTGG - Intronic
1029536146 7:101159104-101159126 ATCCTGGATGAGTTTTTGATGGG + Exonic
1030004453 7:105103375-105103397 AAACTGAATGAGGCCTTTAGGGG - Intronic
1032094071 7:128928978-128929000 GGCCTGACTGAGGGCTTGAGGGG + Intergenic
1036091250 8:5668200-5668222 TTCCTGAATGAGGCCCTGACAGG + Intergenic
1036695006 8:10968496-10968518 ATCCAGAATGAGTTCTGCAGAGG - Intronic
1038037171 8:23696318-23696340 ATCCTAAGTGAGGACTTCAGTGG - Intergenic
1040032023 8:42833360-42833382 ATCTTGAGTGAGGTATGGAGAGG + Intergenic
1041206665 8:55506355-55506377 CTTCTGGCTGAGGTCTTGAGTGG - Intronic
1041217292 8:55613478-55613500 ATCCTGGAGGATGTCGTGAGGGG + Intergenic
1042346871 8:67736445-67736467 ATCATGAATGATGTCCTGAATGG + Intronic
1042752302 8:72171074-72171096 ATCCTGAAGAAGATCTTTAGAGG - Intergenic
1043261158 8:78198808-78198830 TTCCTGAATGAGTTTTTAAGTGG - Intergenic
1043672808 8:82909386-82909408 ACCCTGGGAGAGGTCTTGAGAGG + Intergenic
1043688799 8:83124434-83124456 ATCCTTAATAATCTCTTGAGAGG + Intergenic
1044230470 8:89770924-89770946 ATTCTGAATGATGTACTGAGGGG + Intronic
1046319216 8:112548666-112548688 TTCATGAATGAAGTCTTGATGGG - Intronic
1046687610 8:117244699-117244721 CTCCTGAATTAGGTGTGGAGGGG - Intergenic
1051100746 9:13518218-13518240 ATCCAAAAAGAGATCTTGAGAGG - Intergenic
1052634085 9:31078361-31078383 ACCCTGAATGAGGTCATCAAAGG - Intergenic
1057642037 9:96834021-96834043 ATCCTTAATGCAGTGTTGAGAGG + Intronic
1061383979 9:130277234-130277256 ATGCTGGAAGAGGGCTTGAGTGG + Intergenic
1062128440 9:134879621-134879643 AGCCTTAATTAAGTCTTGAGAGG + Intergenic
1062541061 9:137041747-137041769 TTCCTGGAGGAGGTGTTGAGAGG - Intronic
1192417069 X:70990781-70990803 ACCCTGAATAATGTCTTTAGAGG - Intergenic
1197576251 X:128215075-128215097 AACCTGAATAAGTTCTTTAGTGG - Intergenic
1199897018 X:152136078-152136100 CTCCTGAAAGAGGAATTGAGGGG + Exonic
1200829008 Y:7672932-7672954 ATCCAGAATGAGATACTGAGAGG + Intergenic