ID: 1118736562

View in Genome Browser
Species Human (GRCh38)
Location 14:68705395-68705417
Sequence ACAGAGAGGCAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1219
Summary {0: 1, 1: 0, 2: 13, 3: 122, 4: 1083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118736556_1118736562 9 Left 1118736556 14:68705363-68705385 CCAGTTTTGTCAGATGACAAGGA 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG 0: 1
1: 0
2: 13
3: 122
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118736562 Original CRISPR ACAGAGAGGCAGGTGGAGGA AGG Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900311957 1:2037777-2037799 ACACAGAGGCAGGGGGAAGAGGG + Intergenic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
900511955 1:3065019-3065041 ACAGAGGGGAACATGGAGGAGGG - Intergenic
900918223 1:5653078-5653100 AGGGAGGGGCAGGTGCAGGAGGG + Intergenic
900979695 1:6039352-6039374 GCAGCCAGCCAGGTGGAGGAAGG + Intronic
900985983 1:6072967-6072989 ACAAAGAGGCAGGTGGGAGGGGG + Intronic
901469191 1:9443880-9443902 ACAGAGAGGGAGGAGAAGGAGGG - Intergenic
901493776 1:9609921-9609943 ACAGAGAGCTAAGTGGGGGACGG + Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
901777570 1:11570822-11570844 AGAGAGAGGGAGGAGCAGGAAGG + Intergenic
901814749 1:11787769-11787791 ACAGTGAGGAGGGTGGAGGAAGG - Exonic
901916496 1:12504485-12504507 ACAGAAAGGTAAGTGGAGGAAGG - Intronic
902007782 1:13246041-13246063 TCCCAGAGGGAGGTGGAGGAAGG - Intergenic
902595839 1:17508933-17508955 ATGGAGAGGTAGGGGGAGGAAGG - Intergenic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902626146 1:17677554-17677576 TCAGAGAGGCAGGTCCATGAGGG - Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902666764 1:17944904-17944926 AAAGACAGCCAGGTAGAGGAAGG - Intergenic
902692936 1:18121643-18121665 ACAGCAGGGCTGGTGGAGGATGG - Intronic
902757343 1:18557654-18557676 ACAGGGTGGGAGGTGGAGAAAGG + Intergenic
903173123 1:21565719-21565741 ACGGAGAGGCAGGTGGGGCTGGG - Intronic
903210147 1:21813511-21813533 ACAGAGAGGAAAGAGGAGGTGGG - Intronic
903271407 1:22190593-22190615 TCAGGGAGGCAGGAGGAGGCTGG + Intergenic
903338378 1:22639422-22639444 CCAGAGAGGTGGGTGGGGGAGGG - Exonic
903480866 1:23652401-23652423 ACAGAGAGGGAGAGGGAGGAGGG + Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904393046 1:30198256-30198278 TGAGAGAGACAGGGGGAGGAGGG + Intergenic
904413519 1:30340498-30340520 ACCTAGAGGATGGTGGAGGATGG + Intergenic
904493931 1:30876510-30876532 ACAGGGAGGAGGGCGGAGGAGGG - Intronic
904631772 1:31848130-31848152 AGTTAGAGGCAGGTGGAGGGTGG + Intergenic
904642940 1:31944400-31944422 AGAAGGAGGCAGGGGGAGGAAGG + Intronic
904883322 1:33716996-33717018 AGGAAGAGGCAGGTGGAGGATGG + Intronic
905029375 1:34871342-34871364 ACAAGGAGCCAGGAGGAGGAAGG - Intronic
905237831 1:36562270-36562292 ACAGAGTGGCAGGTATAGGTGGG - Intergenic
905244909 1:36606052-36606074 ACAGAGAAGCAGATGGAAGGAGG + Intergenic
905844197 1:41213442-41213464 ACAGAGGAGGAGATGGAGGAAGG - Intronic
905886262 1:41493740-41493762 TGGGAGAGGCAGGTGGAAGAGGG + Intergenic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
905942920 1:41878686-41878708 AAAGAGAGGGAGGAGGAGGGAGG - Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906336871 1:44940529-44940551 AGACAGAGGCAGGTGGATCACGG + Intronic
906519243 1:46457544-46457566 AGAAAGAGGCAGGTGGAGTGCGG + Intergenic
906550199 1:46659327-46659349 CCACAGTGGCAGGTGGAGAATGG - Intronic
906907172 1:49908429-49908451 ATAGAGAGGAAGGGGGAGGAGGG - Intronic
906935787 1:50212960-50212982 ACTGTGAGGCAGGAAGAGGAAGG - Intergenic
906951799 1:50340934-50340956 ACAGTGAGGCAGGGAGAAGAGGG + Intergenic
907303797 1:53503007-53503029 ACAGAGAGAGAGGAGGAGGAGGG + Intergenic
907385872 1:54125049-54125071 CCAGAGAGGCAGGTGGGGACAGG - Intergenic
907812345 1:57883861-57883883 ACAGAGAGGCAGTTCCAGAAAGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907908682 1:58808423-58808445 CCAAAGAGGCAGGGGAAGGAGGG + Intergenic
908119397 1:60971476-60971498 ACAGATAGACAGATGGATGATGG + Intronic
908747975 1:67394182-67394204 AAAGACAGAGAGGTGGAGGAAGG + Intronic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
909141801 1:71876542-71876564 ACAGAGAGAGAGGAGAAGGAAGG + Intronic
909183697 1:72457803-72457825 AGAGAGAGGAAGGGAGAGGAGGG - Intergenic
910094079 1:83499903-83499925 ACAGAAAGGGAGGTGAAGAAGGG + Intergenic
910726505 1:90345471-90345493 ACATAGGGCCAGGTGGAGGCAGG - Intergenic
910736118 1:90459632-90459654 GAAGATAGGCAGGTGGATGATGG - Intergenic
911090489 1:94013414-94013436 GCCCAGAGGCAGGTGGAGGTGGG + Intronic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911643424 1:100313380-100313402 GCAAAGAGGCAGGTGCTGGAGGG + Intergenic
912389516 1:109292638-109292660 ACAGAGAGGGAGGTGAGGGAGGG + Intronic
912483766 1:110007291-110007313 GCAGGGAGGCTGGTGGAGGAAGG + Intronic
912950289 1:114116074-114116096 CAAGAGAGGCAGGTGGGGGCAGG - Intronic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915302169 1:154957925-154957947 ACAGATGGGCTGGGGGAGGAGGG + Exonic
915463274 1:156082035-156082057 AGAGAGAGAGAGGTGGTGGAAGG + Intergenic
915529731 1:156496433-156496455 AGAGAGGGGCACGTGGGGGAGGG + Intronic
915584328 1:156836074-156836096 ACAGACACGCAGGAGGAGAAAGG - Intronic
915656045 1:157361293-157361315 GCAGAGAGCCACGTGGAGGCAGG + Intergenic
915673287 1:157508610-157508632 GCAGAGAGCCACGTGGAGGCAGG - Intergenic
915900100 1:159840615-159840637 TGAGAGAGGCAGATGGTGGAAGG + Intronic
916419731 1:164625860-164625882 ACAGAAAGGCAGAAGGAGGGTGG - Intronic
916696499 1:167242937-167242959 GGAGAGAGGCAGGTGGAAGGAGG - Intronic
916723500 1:167503032-167503054 GAAGTGAGGCAGGTGAAGGAAGG + Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916826686 1:168448681-168448703 ACACAGAGTCAAGGGGAGGAAGG - Intergenic
916915002 1:169396801-169396823 AAAGAAAGGCAGGTGGACTAAGG - Intronic
917020719 1:170583366-170583388 GCAGGCAGGCAGGTGGAGGCAGG + Intergenic
917020724 1:170583384-170583406 GCAGGCAGGCAGGTGGAGGCAGG + Intergenic
917720124 1:177779462-177779484 AAAGAGGGGATGGTGGAGGAGGG - Intergenic
918399287 1:184147390-184147412 GCACAGGGCCAGGTGGAGGATGG + Intergenic
918446881 1:184625568-184625590 ACAGAGAGATACGTGGAGAAAGG + Exonic
918450708 1:184655091-184655113 ACTGAGATGCAAGTGGAGGTGGG + Intergenic
919139234 1:193549829-193549851 AAAGGGTGGAAGGTGGAGGATGG - Intergenic
919463542 1:197906409-197906431 AGAGAGAGGAAGGTGGTGGCGGG - Intronic
919725571 1:200880622-200880644 ACAGAGTGGCAGGATAAGGAAGG + Intergenic
919753117 1:201050546-201050568 ACAGAAAGGCAGGTGGTACAGGG + Intronic
919843509 1:201626435-201626457 AAAGAGAGGGCTGTGGAGGATGG - Intronic
920097534 1:203496328-203496350 ACAGAGAAAGAGGTGGAGGCTGG - Intronic
920365592 1:205446723-205446745 ACAATGAGGGAGGTGGAGGAAGG + Intronic
920554858 1:206897364-206897386 AAAAAGAGGGAGGTGGAGAAAGG - Intergenic
920717034 1:208349826-208349848 AAAGGGAGGCAGGCAGAGGAGGG + Intergenic
922321047 1:224487385-224487407 ACAGAAAGACAGAAGGAGGAAGG - Intronic
922544829 1:226448424-226448446 ACAGAGAAGGAGGTAGAGAAGGG + Intergenic
923003029 1:230023241-230023263 AGGAAGAGGCCGGTGGAGGAAGG + Intergenic
923426064 1:233871139-233871161 ACAGAGAGACAGAGGGAGGCAGG + Intergenic
923476087 1:234332593-234332615 AAAGAGAGGGAAGGGGAGGAAGG - Intergenic
923487179 1:234444751-234444773 AGAGAGAGGTAGGTGCAGGTAGG - Intronic
923499197 1:234550559-234550581 ACAGCCAGGCAGGAGGAGGGCGG + Intergenic
923525742 1:234771324-234771346 ACAGAGACGCTGGAGGAGGCTGG + Intergenic
924038526 1:239960063-239960085 AGAGAAAGGCAGGAGGAGAAAGG - Intergenic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
924486430 1:244487779-244487801 GCAGAGAGGCAGCAGGAGGCGGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924517770 1:244780609-244780631 ACGGAGGGGCAGGTGGGGGCAGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062992923 10:1836817-1836839 ACAGAGGTGCAGGTGGGAGAGGG - Intergenic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063225087 10:4008018-4008040 ACAGATAGGCAAATGGAGAATGG + Intergenic
1063526554 10:6792116-6792138 AAAAAAAGGCAGGTGGAGGTGGG + Intergenic
1063650148 10:7927507-7927529 ACTGAGATACTGGTGGAGGAGGG - Intronic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064414451 10:15136406-15136428 ACAGAGAGGGAGAGGGAGGAAGG + Intronic
1065241568 10:23710134-23710156 ATAGAGTGGCAGGTGTGGGACGG + Intronic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066380452 10:34896680-34896702 ACAGAGGGGGAGCTGGAGGCGGG + Intergenic
1067343132 10:45419928-45419950 AAAGAGAGGCCGGAAGAGGAGGG + Intronic
1067556953 10:47279260-47279282 ACAGAGGGGCAGGTGGGAAATGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067742354 10:48905241-48905263 ATAGAGGGGCAGGTAGAGGAGGG + Intronic
1068083359 10:52346820-52346842 ACAGAGAGGCAGGCAGAGAGGGG + Intergenic
1068743358 10:60500466-60500488 AAAAAGAGGTGGGTGGAGGAGGG + Intronic
1069386097 10:67884703-67884725 CCAGAGAGGCAGTTGGAAGATGG + Exonic
1069815640 10:71191970-71191992 CCAGAGAGGCAGGAGGAGAGGGG + Intergenic
1069917276 10:71795492-71795514 GAAGAGAGTCAGCTGGAGGAAGG - Intronic
1069951918 10:72024915-72024937 ACAGACAGGAAAGAGGAGGATGG + Intergenic
1070356626 10:75646337-75646359 GCAGAGAGGGAGGTGGAAGAAGG - Intronic
1070613355 10:77949655-77949677 CCTGAGGGGCTGGTGGAGGATGG + Intergenic
1070701271 10:78603359-78603381 ACAGAGACACAGGTTGAAGATGG - Intergenic
1070807809 10:79280798-79280820 ACACAGAGGGAGGTGGAGGCAGG - Intronic
1070811742 10:79301536-79301558 ACAGAGAGGCCAGTGGAGTGGGG - Intronic
1070912816 10:80132939-80132961 ACAGAGAGGCAGATGCAGGGAGG + Intronic
1070920994 10:80186340-80186362 GCAGTGTGACAGGTGGAGGATGG + Intronic
1071500823 10:86203256-86203278 ACAGTGAGTCAGTGGGAGGAGGG + Intronic
1071562898 10:86657065-86657087 TGAGACAGGCAGGTGGAGAAGGG + Intronic
1071566674 10:86674756-86674778 ACAGAAAGGAAAGAGGAGGATGG + Intronic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1071829959 10:89361860-89361882 AAAAAAAGGCAGGTGGAGGGTGG - Intronic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1072222476 10:93338514-93338536 ACATGGAGGCAGGTAGATGAAGG - Intronic
1072434680 10:95404204-95404226 GGAGAGTGGCAGCTGGAGGAGGG + Intronic
1072688067 10:97550484-97550506 GCAGGGAGGCAGGCGGAGGCAGG - Intronic
1072821297 10:98560378-98560400 ACAAACAGGCAGGTGGAGGAAGG + Intronic
1073120828 10:101121829-101121851 TCAGTGAGGTAGGTTGAGGAGGG - Intronic
1073788434 10:106915504-106915526 ACAGGTAGGGAGGAGGAGGAGGG - Intronic
1073943939 10:108729849-108729871 AGAGAGAGGAAGATGGAGGGAGG + Intergenic
1074226319 10:111487957-111487979 ACAGAGAGAGGGGAGGAGGATGG - Intergenic
1074315743 10:112360269-112360291 AGAAAGAGGGAGCTGGAGGAAGG - Intergenic
1074584845 10:114757874-114757896 TCAGAGAGGTAGTTGGGGGAAGG - Intergenic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1074724111 10:116289842-116289864 AGAGAGAGTCGGGAGGAGGAAGG - Intergenic
1074784389 10:116826179-116826201 GCAGAGATGAAGGTGGAGGGAGG - Intergenic
1074892353 10:117746247-117746269 ACAGCGGGGCATGGGGAGGAAGG - Intergenic
1075212138 10:120500417-120500439 ATAGAAAAGCAGGTGGATGAGGG - Intronic
1075320666 10:121489398-121489420 ACAGAGAGGCAGCTGAGGGAAGG - Intronic
1075410326 10:122223026-122223048 AGAGAGAGAGAGGAGGAGGAAGG - Intronic
1075452517 10:122561827-122561849 ACAGAGAAGGAGGAGGAGGGAGG - Intronic
1075470717 10:122687388-122687410 AGAGAGAGGCAGGGGGTGGGGGG + Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075743963 10:124713326-124713348 ACAGAGTGGCCTGGGGAGGAAGG - Intronic
1075766987 10:124900808-124900830 CCAGGGAGGGAGGTGGAGGTGGG + Intergenic
1075777942 10:125000054-125000076 ACAAAAAGGCAGGTTGAGGCAGG + Intronic
1076023680 10:127094548-127094570 ACAGCGAGGCAGCTGGAGGGTGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076540126 10:131208405-131208427 ACAGAGATGCATGTGAACGATGG + Intronic
1076574224 10:131453357-131453379 GCAGAGAGGCGGGAGGTGGATGG + Intergenic
1076944607 10:133637651-133637673 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077015918 11:399224-399246 AGAGGGGCGCAGGTGGAGGAAGG - Intronic
1077050504 11:564306-564328 ACAGAGAGTCAGGTGGGAGGGGG - Intergenic
1077457837 11:2691664-2691686 ACAGAGAACCAGGTGGGGAAGGG + Intronic
1077933821 11:6761718-6761740 AGAGAGAGACAGTTGGAGGTTGG - Intergenic
1077983969 11:7332119-7332141 AAAGGGAGGCAGGTGGGTGAAGG + Intronic
1078471161 11:11587881-11587903 AGAGAGAGGCAGGGGGAGAAAGG + Intronic
1078536602 11:12179890-12179912 ACAGAGAAGGAGGTAAAGGATGG - Intronic
1078846647 11:15124589-15124611 GCAGAGAGGCTGGGGGAGGGTGG + Intronic
1079085816 11:17444199-17444221 ACTGGGAGGCAGGTGGTGAAGGG - Intronic
1079114155 11:17630008-17630030 ACCGGGGTGCAGGTGGAGGATGG - Intronic
1079308130 11:19342627-19342649 AGAGAGAGAGAGGTGGGGGAGGG + Intergenic
1079587291 11:22141878-22141900 CCAGAGATGGAGGTTGAGGAGGG + Intergenic
1079601389 11:22316207-22316229 AGAGAGAGGCAGGGGGAGAGAGG - Intergenic
1079814634 11:25039824-25039846 AGAGAGAGGCAGGTAGAGCAAGG + Intronic
1080312786 11:30913573-30913595 AAAGAGAGGCAGTTAGTGGAAGG - Intronic
1081603986 11:44515385-44515407 ACAGAGGGACAGCTGGAGGGAGG - Intergenic
1081677140 11:44976820-44976842 ACTCAGTGGCTGGTGGAGGAGGG + Intergenic
1081814383 11:45930345-45930367 ACAGAGAGGCAGGTGTTGCAGGG + Intronic
1082266865 11:50128777-50128799 AGAGAGAGGCAGGTGATGGTAGG + Intergenic
1082289224 11:50349791-50349813 AGAGAGAGGCAGGTGATGGTAGG - Intergenic
1083000126 11:59283756-59283778 ACAGTGAGGCAGTAGGAGGTGGG + Intergenic
1083263258 11:61534504-61534526 CCAGAGGGGCAGGGAGAGGATGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084136137 11:67183811-67183833 ACAAAGAGGCAGGTGGGGCCAGG + Intronic
1084169854 11:67395854-67395876 GCAGAGTGGCAGGTGGGAGAGGG + Intronic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084613337 11:70218221-70218243 ATAGCTAGGCAGGTGGGGGAGGG + Intergenic
1084789609 11:71465124-71465146 GCAGAGAGGCAGGGGCTGGAGGG + Intronic
1084953932 11:72681384-72681406 GCAGACGGGCAGGGGGAGGAGGG + Intergenic
1085006849 11:73099854-73099876 ACCGAGAGGCCAGTGAAGGAAGG - Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085279231 11:75319476-75319498 ACAGAGAGGCAGGGTGGGAAGGG - Intronic
1085511336 11:77089615-77089637 GCAGGGAGACAGGTGAAGGAAGG + Intronic
1085764444 11:79270761-79270783 ACAGAGAGGCAGCCTGAGGCTGG - Intronic
1085825836 11:79846349-79846371 AGAGAGAAGAAGGTGGAGGGTGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086102423 11:83115081-83115103 ACAGAGAGGCAAATTGATGATGG + Intergenic
1086138414 11:83466664-83466686 ACAGGGAGTCAGTTGGATGAAGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086747588 11:90449533-90449555 GCAGAAAGCCAGGTGGAGGGAGG - Intergenic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087170834 11:95049135-95049157 ACAGAGCTGCAGGTGGAGCTGGG + Intergenic
1087636954 11:100712565-100712587 ACTGAGTGGCAGGTGGTGGGAGG + Intronic
1087694602 11:101362224-101362246 ACAGAAAGACAGATAGAGGAAGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088816767 11:113426591-113426613 TCAGAGAGGATGGTGGAAGAGGG + Intronic
1088980403 11:114858137-114858159 GGAGAGAGCCAGGTGGAGGCAGG - Intergenic
1089120457 11:116130844-116130866 AGAGAGAGAGAGGTGGAGGAGGG - Intergenic
1089200130 11:116719665-116719687 ACAGAAAGGCAGGTGGATGAAGG + Intergenic
1089258013 11:117204243-117204265 ACAGAGAGCCAGCTGCAGGAGGG + Exonic
1089305804 11:117525356-117525378 ACAGAGAGACAGATGGAAGAAGG + Intronic
1089326941 11:117663770-117663792 ACAGGGGGGCTGGGGGAGGAAGG + Intronic
1089678647 11:120107365-120107387 ACAGGGAGCCAGGTGAGGGAGGG - Intergenic
1089681691 11:120122238-120122260 AGAGGGAGGCTGGGGGAGGAGGG - Intronic
1089690544 11:120184398-120184420 ACAGAGAGGGAGAAGCAGGACGG - Intronic
1089723403 11:120451027-120451049 ACAGACAGACAGATGAAGGAAGG - Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090027513 11:123180412-123180434 ATAGAGAGCCACGTGGTGGAAGG - Intronic
1090254434 11:125273396-125273418 ACCGAGGGGCAGGAGGAGGCGGG + Intronic
1090528131 11:127559931-127559953 ACAGGAAGGAAGGTGGAGTATGG + Intergenic
1090601993 11:128382170-128382192 ACAGAGAGAGAGGTGGTGGTGGG - Intergenic
1090634507 11:128682344-128682366 AGAGAGAGGCAGCTGGGGGCAGG - Intergenic
1090747839 11:129721460-129721482 ACAAAGGGGCAGGTGGGAGAAGG - Intergenic
1090866295 11:130703815-130703837 AAAGACAGGGAGGTTGAGGAAGG - Intronic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091323886 11:134669892-134669914 ACAGGGAGGGGGGAGGAGGAGGG + Intergenic
1091362386 11:134987718-134987740 AGAGGGAGGAAGGTGGAGGAGGG + Intergenic
1091546236 12:1503114-1503136 AGAGCAAGGCAGGGGGAGGAGGG + Intergenic
1091761650 12:3091424-3091446 GCAGGGAGGCAGGAGGAGGCAGG + Intronic
1091780728 12:3213153-3213175 AAAGAACGCCAGGTGGAGGAAGG + Intronic
1091793552 12:3284843-3284865 TCAGACAGGCAGGTGGAGGCTGG - Exonic
1091799384 12:3315315-3315337 TCACAGAAGCAGGTGGAGGGAGG + Intergenic
1092062666 12:5564037-5564059 AGAGAGAGCCAGATGGAGGGAGG - Intronic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092137699 12:6161137-6161159 AGAGAGAGAAGGGTGGAGGATGG + Intergenic
1092230378 12:6772735-6772757 GCAGAGAGGGAGGTGGAGGAAGG - Exonic
1092276781 12:7067499-7067521 ACAGAGAGGCTGGTGTGGGGAGG + Intronic
1092284725 12:7122133-7122155 TCAGAGAAGGTGGTGGAGGAGGG + Intergenic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092997151 12:13961194-13961216 ACAGAGTGGCAGGGGAGGGAAGG + Intronic
1093097280 12:14985660-14985682 GGTGAGAGGCAGGTGGAGGCAGG + Intergenic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093973565 12:25397090-25397112 ACAGAGTTGCAGGTGGATTAAGG + Intergenic
1094498496 12:31004016-31004038 GCAGACAGGCAGGTGGAGGCTGG + Intergenic
1094809937 12:34126853-34126875 ATAGAGAGGCAAGTGCAGCAAGG - Intergenic
1095432159 12:42145319-42145341 ACTTAGAGGCTGGGGGAGGATGG - Intergenic
1095956912 12:47812171-47812193 CCAGTGAGGCAGGGCGAGGAGGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096243583 12:49972448-49972470 GCAGAGGGGCGGGTGGAGAAGGG - Intronic
1096468799 12:51863835-51863857 TCTGAGAGGCCGGGGGAGGAGGG + Intergenic
1096499749 12:52057491-52057513 GCAGAGAGGCAGGCGAAGGCAGG - Exonic
1096525319 12:52206909-52206931 ACAGAGAGGGAGGTGGGGGCCGG + Intergenic
1096782136 12:53997608-53997630 GCAGAGAGGGAGGCGGAGGAAGG - Intronic
1096869849 12:54586486-54586508 ACAGAGTGGCAGGCGGTGGAGGG - Intronic
1096967522 12:55639996-55640018 AGGGAGAGGCAGGTGGAACAGGG + Intergenic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097142293 12:56912168-56912190 ACAGAGAGGAAGATGGGGGCTGG + Intergenic
1097181543 12:57174771-57174793 ACAAACAGGCAAGGGGAGGAGGG + Intronic
1097200279 12:57272565-57272587 GCAGAGAGGCATGTGGAAAAGGG + Intronic
1097293924 12:57943070-57943092 TCAGGGAGGTAGGAGGAGGAAGG + Intronic
1097465760 12:59922645-59922667 TGAGAGTGGAAGGTGGAGGAAGG + Intergenic
1098817111 12:75181548-75181570 AATGAGAGGCTGTTGGAGGAAGG - Intronic
1099975871 12:89544957-89544979 GCAGAGAGGAAAGAGGAGGAGGG + Intergenic
1100312984 12:93414518-93414540 TCAGAGAGGTAGGTGGAGTGAGG - Intronic
1100334702 12:93618478-93618500 TCAGAGAGGCAGGTGGGGACTGG - Intergenic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100990189 12:100243623-100243645 AAAGAGATGCTGGTGGAGGCAGG - Intronic
1101255551 12:102973594-102973616 AGAGGGAGGCAGTGGGAGGAAGG - Intergenic
1101382189 12:104223754-104223776 ACTGAGAGGCAGCTGAAGGTGGG + Intronic
1101406146 12:104430550-104430572 ACGGTGGGGCAGGTGGAGGGGGG - Intergenic
1101674804 12:106908063-106908085 TCAGGGAGGCAGGTGTAGGCTGG - Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101931253 12:109015912-109015934 AAAGAGGAGCAGGTGGAGGACGG + Intronic
1102047667 12:109839984-109840006 GCTGAGAGGCTGGTGCAGGAGGG - Intergenic
1102190819 12:110986872-110986894 ACAGAGTGGCAGCTACAGGATGG - Intergenic
1102394208 12:112574075-112574097 ACAGATGGGTTGGTGGAGGAGGG + Intronic
1102394269 12:112574264-112574286 GGAGAGTGGGAGGTGGAGGAGGG + Intronic
1102394395 12:112574671-112574693 AGAGAGGGGGTGGTGGAGGAGGG + Intronic
1102426182 12:112846076-112846098 ACAGAGGGGCAGGTAAAGGACGG + Intronic
1102488782 12:113276451-113276473 ACAAAGGGGCAGGGGGAGGAAGG + Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102683131 12:114704038-114704060 ACAGAGAGGGAGGAGCAGGTGGG - Intergenic
1102720620 12:115013216-115013238 ACAGAGAGGGAGGTGGTGACAGG - Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1102923885 12:116812335-116812357 GCAGAGATGCAGGCAGAGGACGG + Intronic
1103763283 12:123266155-123266177 ACAGAGGCGGTGGTGGAGGAGGG - Intronic
1103932762 12:124459329-124459351 CCAGAGAGACAGGAGGAGGTGGG - Intronic
1104011112 12:124930852-124930874 ACACAGAGGCATGGAGAGGAAGG - Intergenic
1104170477 12:126275634-126275656 AGAGAGTGGGAGGTGGAGGGTGG + Intergenic
1104505021 12:129323846-129323868 ATAGAGAGGCATGTGAAGAAAGG - Intronic
1104651281 12:130536202-130536224 ACAGATAGGCAGGCGGAGCTGGG + Intronic
1104670671 12:130677939-130677961 AGAGGGAGCCAGGTGGAGGAGGG - Intronic
1104765665 12:131328383-131328405 CCAGAGATGCAGGTGGACGTGGG + Intergenic
1104949001 12:132430379-132430401 ACAGAGAGGCAGGTCTGGGAAGG + Intergenic
1105789879 13:23788000-23788022 ACTGGGAGTCAGCTGGAGGAGGG + Intronic
1105950922 13:25228932-25228954 ACAGTGAGGCAGGGGAAAGAGGG + Intergenic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106556095 13:30809897-30809919 AGCGAGTGGCAGGTGGAGAAGGG + Intergenic
1106614046 13:31310312-31310334 AGAGTGAGCCAGGTGGAGGAGGG - Intronic
1106622700 13:31386308-31386330 AGAGAGAGGCAGGAGAAGGGAGG - Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1107457508 13:40568373-40568395 AAAGAGAGGAAGGAGGAGGGAGG - Intronic
1108734124 13:53264597-53264619 ACAGAGAGATAGGTGCAGAAAGG + Intergenic
1109322001 13:60822367-60822389 GCAAAGTTGCAGGTGGAGGAGGG + Intergenic
1109771180 13:66975604-66975626 AAAGAGAGGGAGGTGGAACAGGG + Intronic
1110131491 13:72017211-72017233 GCAGAGAGAGAGGTAGAGGAAGG - Intergenic
1110171425 13:72505525-72505547 ACAAAAATGCAGGTGGGGGATGG - Intergenic
1110837948 13:80106479-80106501 ACAGAGAAACAGATGGATGAAGG - Intergenic
1111501441 13:89126073-89126095 GCAGAGAGGAAGGGGGATGAAGG + Intergenic
1111830367 13:93321967-93321989 AGAGAGCAGGAGGTGGAGGAGGG - Intronic
1112103784 13:96218399-96218421 GCAGAGAGGAGGGTGGAGAAGGG + Intronic
1112378171 13:98863091-98863113 AAACAGAGGCAGGTAGAGGGTGG + Exonic
1112434752 13:99383885-99383907 GTAGAGAGGCAGGTGGGGGAGGG - Intronic
1112578958 13:100662199-100662221 ACACAGGGTGAGGTGGAGGAGGG - Intronic
1112661332 13:101512165-101512187 ACACAAAGGCAAGTGGAAGAGGG - Intronic
1112775490 13:102839342-102839364 GTAGAGAGGCATGGGGAGGAAGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113221425 13:108107978-108108000 AAAGAAAGGAAGGAGGAGGAGGG + Intergenic
1113486611 13:110657422-110657444 AAAGGCAGGCAGGTGCAGGAGGG + Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113754841 13:112803999-112804021 GCAGGGAGGGAGGTGAAGGAGGG - Intronic
1113754898 13:112804156-112804178 GCAGGGAGGGAGGTGAAGGAGGG - Intronic
1113858044 13:113460210-113460232 AGAGTGTGGCAGGTGGAGGGCGG - Intronic
1113939963 13:114013611-114013633 AGAGAGAGACAGATGGAGGGGGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114272119 14:21107223-21107245 ACAATGAGGCAGGAGGCGGAGGG + Intergenic
1114549396 14:23524392-23524414 GCAGTGAAGCAGGGGGAGGAGGG - Exonic
1115306256 14:31936891-31936913 AAAGAGAGGCAGATGGAGAGAGG + Intergenic
1115475578 14:33810158-33810180 TGAAAGAGGCAGGTGGAGGTGGG + Intergenic
1115791773 14:36887630-36887652 CCAGAAAGGCAGCTGAAGGAGGG + Intronic
1115955548 14:38775120-38775142 ACATAGAGTCAGGTTGAGGCTGG - Intergenic
1115955566 14:38775282-38775304 ACAGAAATGCTGGAGGAGGAGGG - Intergenic
1117035699 14:51726415-51726437 AAAGAAAGGCAGGAGGAGGGAGG - Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118282581 14:64442895-64442917 ACAGAGAAACAGGTGGAGACTGG + Intronic
1118377560 14:65190445-65190467 AAAGAGAGGGACGTGGAAGAGGG - Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118815287 14:69308051-69308073 AAGGAGAGGAAAGTGGAGGAGGG - Intronic
1118838710 14:69495131-69495153 AAAGAGGGGCAGGGGAAGGAAGG - Intronic
1118918877 14:70131885-70131907 ACAGAGAAGGAAGTGGAGGTGGG + Intronic
1119166796 14:72501234-72501256 ACAGACAGCCAAATGGAGGATGG + Intronic
1119543325 14:75454843-75454865 TCAGAGAGGCAGGAGGAGCCAGG + Intronic
1119776055 14:77249484-77249506 ACAGTGGGGCAGGTGGAGGTGGG - Intronic
1119904850 14:78292437-78292459 ACAGATAGGCAGGTACAAGAAGG + Intronic
1120049263 14:79845947-79845969 ACAGGGAGAGAGATGGAGGAAGG + Intronic
1120333607 14:83125381-83125403 ACATAGAGGGAAGGGGAGGAGGG + Intergenic
1120431698 14:84426312-84426334 ACAGAGAGAGAGACGGAGGAAGG - Intergenic
1120551750 14:85881182-85881204 ACAAAGAGGCAGAGGGAGAATGG - Intergenic
1120718397 14:87864919-87864941 ACACAGAAGGAGGTGGAGAAAGG + Intronic
1120809211 14:88785808-88785830 GAAGAGAGGCAGGGGCAGGATGG - Intronic
1120823586 14:88935258-88935280 ACATGGAGGCACGTGGAGGCAGG - Intergenic
1121015064 14:90544083-90544105 TCAGAGTGGAAGGTGGAGGAAGG + Intronic
1121246838 14:92467041-92467063 AGAGAGATGCAGGTGGATGTTGG - Intronic
1121532280 14:94663586-94663608 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1121825790 14:97008467-97008489 ACACACAGGCAGGAGGATGAGGG - Intergenic
1122294978 14:100700311-100700333 ACAGCAAGGCAGGTGGATGGGGG + Intergenic
1122307805 14:100776722-100776744 GGACAGAGGCAGGTGCAGGAGGG - Intergenic
1122322277 14:100862238-100862260 AGAGAGGGGGAGGGGGAGGAGGG - Intergenic
1122493173 14:102133817-102133839 AAAGAGGGGCAGTTGGGGGAAGG + Intronic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122849993 14:104522902-104522924 ACAGAGACGGAGTTGGAGGGAGG - Intronic
1122867661 14:104614745-104614767 GCAGGGAGGAAGGAGGAGGAAGG + Intergenic
1122917932 14:104867348-104867370 ACACAGAGGCAGGGCGGGGATGG - Intronic
1123042648 14:105496679-105496701 ACAGACAGGCGGCTGGAGAATGG - Intronic
1123464515 15:20505661-20505683 AGAGAGAGGGAGGTGGGGAAGGG + Intergenic
1123653598 15:22495380-22495402 AGAGAGAGGGAGGTGGGGAAGGG - Intergenic
1123953477 15:25308937-25308959 AAAGAGGTGGAGGTGGAGGAAGG - Intergenic
1123998577 15:25735457-25735479 ACAGAAAGACAGGTGGATCAGGG - Intronic
1124111249 15:26790815-26790837 AGAGGGAGGGAAGTGGAGGAGGG + Intronic
1125477685 15:40058496-40058518 ACAGAGGGAGAGGTGGAGGAGGG + Intergenic
1125990866 15:44106513-44106535 AGAATGAGGCAGGTGAAGGATGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126361745 15:47853587-47853609 ACAGGGAGGCATGTAGAGGGTGG - Intergenic
1127116990 15:55738774-55738796 AGAGGGAGGGAGGGGGAGGAAGG + Intronic
1127544980 15:59984615-59984637 ACCAAAAGGAAGGTGGAGGAAGG + Intergenic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1127919472 15:63481991-63482013 ACGGAGAGGCAGGGGGATGGAGG - Intergenic
1128056171 15:64701927-64701949 AAAGAGAGGCATGTAGAGAAAGG + Intronic
1128072559 15:64806836-64806858 AGAGGAAGGCAGGCGGAGGAAGG + Intergenic
1128094501 15:64943745-64943767 AGAGAGGGGAAGGTGGTGGAAGG - Intronic
1128103790 15:65028533-65028555 ACAGAGGGGTGTGTGGAGGAAGG + Intronic
1128222286 15:65977852-65977874 ACAGAGAGGCAGGAGGAAATAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128331192 15:66756816-66756838 ACAGAGGTGAGGGTGGAGGATGG + Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1128732530 15:70030904-70030926 ACAGAAAGGAGGGAGGAGGAAGG - Intergenic
1128752854 15:70161388-70161410 GCAGCGAGGCAGGTGGGGGGCGG + Intergenic
1129360107 15:75019314-75019336 CAAGAGGGGCAGGTGGAGGGTGG - Exonic
1129694028 15:77730537-77730559 ACAGAGAGGCAGGGGCAGCCCGG - Intronic
1130057109 15:80536142-80536164 ACACAGAGGCACGTGGAGTGAGG + Intronic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1130862830 15:87906333-87906355 ACAGAAAGGCAGATGGGAGAAGG + Intronic
1131066348 15:89437073-89437095 ATAGAGAGGAAGGGAGAGGAAGG - Intergenic
1131228713 15:90645580-90645602 ACAGAGTATCTGGTGGAGGAAGG - Intergenic
1131328697 15:91474326-91474348 ACAGAAAGGCAGAAGAAGGAAGG - Intergenic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131569490 15:93520259-93520281 ACAGTGGGGCAGGGGGAGGCAGG + Intergenic
1131641502 15:94298823-94298845 AGAGAGAGGGAGGGGGAGGGGGG - Intronic
1131641513 15:94298847-94298869 AGAGAGAGGGAGGGGGAGGGGGG - Intronic
1131657825 15:94479825-94479847 TCAGAAAGGCAGGTGGGGGTAGG + Exonic
1131694773 15:94864663-94864685 ACAGAAAGGCTGGTGCAGGCTGG + Intergenic
1131975634 15:97943187-97943209 ACAGAGAGGCAGGGGCAGTGGGG + Intergenic
1132104283 15:99051493-99051515 GCAGAGAGGCAGGTGTTGGAGGG - Intergenic
1132250592 15:100332953-100332975 ACAGTGAGGGAGGAGGAGGCAGG - Intronic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132724270 16:1332150-1332172 ACAGCCAGGCCGGTGGGGGAGGG - Intergenic
1132801754 16:1758106-1758128 ACAGAGAGGCAGGGGAAGGAAGG - Intronic
1132949242 16:2551285-2551307 ACAGAAAACCAGGTGGAGGAAGG - Intronic
1132965346 16:2650843-2650865 ACAGAAAACCAGGTGGAGGAAGG + Intergenic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1134160134 16:11881183-11881205 ACATAGAGGCAGCTGGTGGGTGG - Intronic
1134316924 16:13127248-13127270 AGAGAGAGGGAGGTGGGAGAGGG + Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1134449260 16:14353855-14353877 AGAGGGAGGAAGGGGGAGGAAGG + Intergenic
1134523643 16:14929199-14929221 ACAGGGAGGCAGAGGGAGGGTGG - Intronic
1134549254 16:15131737-15131759 ACAGGGAGGCAGAGGGAGGGTGG + Intronic
1134711235 16:16327684-16327706 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134719089 16:16370986-16371008 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134948338 16:18340899-18340921 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1134955594 16:18381009-18381031 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1135163704 16:20120176-20120198 AGAGAGAAAGAGGTGGAGGAGGG - Intergenic
1135509141 16:23067327-23067349 ACAGATAGGAAGGTGGTGAAAGG + Exonic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135787835 16:25366403-25366425 AGAGAGGGAGAGGTGGAGGAAGG - Intergenic
1135975770 16:27108264-27108286 TCAGGCAGGCAGGTGGGGGACGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136538345 16:30913609-30913631 AGAGAGAGGCGGGTGGTGGTGGG - Intergenic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1137773783 16:51039544-51039566 AGAGAGAGCCACGTGAAGGATGG + Intergenic
1137963795 16:52911370-52911392 ACAAAAAGGCAGGTCCAGGAGGG - Intergenic
1138522326 16:57577992-57578014 AGAGAGAGGAAGGGGGAAGAGGG - Intronic
1138577139 16:57915255-57915277 ACAGCGGGGCAGGCGGAGGAGGG + Exonic
1138710084 16:58961381-58961403 ACAGAGAGAGAGGAGGAGGTTGG + Intergenic
1138719327 16:59060564-59060586 ACAGACAAAAAGGTGGAGGAAGG + Intergenic
1138765437 16:59597182-59597204 GCAGAGAGTAAGGTGGAGAAGGG - Intergenic
1138981554 16:62274871-62274893 GCAGAGAGAGAGGTGGGGGAGGG + Intergenic
1138988520 16:62361554-62361576 AGAGAGAGAGAGGTGGGGGAGGG + Intergenic
1139004190 16:62551239-62551261 GCAGGGAGGGAGGGGGAGGAAGG - Intergenic
1139603412 16:68000801-68000823 ACAGAGAGGCTGGCGGGGTAGGG - Intronic
1139734125 16:68972781-68972803 AAAGAGTGGCAGGGGAAGGAGGG + Intronic
1139972225 16:70783352-70783374 ACAGAGAGGCCGCGGCAGGAGGG - Intronic
1140069084 16:71633925-71633947 AGAGAGCGGCAGGAGGATGATGG - Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140258061 16:73353747-73353769 AAAAAGAGGCAGGAGGAGAAAGG + Intergenic
1140716370 16:77728944-77728966 GCAGGGAGGAGGGTGGAGGAGGG - Intronic
1140728920 16:77838656-77838678 ACAGAGAGGCAGGGAGGGAAAGG - Intronic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141293936 16:82749174-82749196 ACAGAGAGAGAGAAGGAGGAAGG + Intronic
1141369926 16:83477620-83477642 ACAGGGAGGTGGGAGGAGGAAGG + Intronic
1141428820 16:83960529-83960551 TCAGAGGGGCTGCTGGAGGAGGG - Intronic
1141524310 16:84601894-84601916 AGAGAAGGGCTGGTGGAGGAAGG - Intronic
1141906970 16:87033257-87033279 ACAAAAAGGCAGGCGGGGGATGG + Intergenic
1142103185 16:88286375-88286397 GCAGACAGGCAGGTGCAGAAAGG - Intergenic
1142327581 16:89426330-89426352 ACACAGGAGAAGGTGGAGGAAGG + Intronic
1142414859 16:89935821-89935843 AGTGAGAGGCAGGTGGCGGCCGG + Exonic
1142468003 17:147033-147055 GCAGACAGACAGGTGGAGGATGG - Exonic
1142767249 17:2071786-2071808 AAAGAGTGGCAGGCGGAGGAGGG + Intronic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143371966 17:6445896-6445918 ACAGAGAGCAAGGTAGAGCAGGG + Intronic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1143913776 17:10274095-10274117 GCAGAGAGGGAGGCTGAGGAAGG - Intergenic
1144327582 17:14196732-14196754 AGAGAGAAGGAAGTGGAGGAGGG - Intronic
1144789262 17:17848320-17848342 ACGGAGAGGCAGATGGAGTGGGG + Intronic
1144811177 17:17999895-17999917 ACAGAGATACAGGAGTAGGAGGG - Intronic
1144875372 17:18394561-18394583 AGGGAGAGGCAGGTGGATGCTGG + Intergenic
1145156853 17:20549860-20549882 AGGGAGAGGCAGGTGGATGCTGG - Intergenic
1145993800 17:29094284-29094306 ACAGAGAGGCAGCTGGGGTGGGG + Intronic
1146011197 17:29196203-29196225 ACAGCGAGGCAGGTGTATGTTGG + Intergenic
1146093472 17:29905658-29905680 ACAGAGTGCCAGGTGGAAGGGGG + Intronic
1146160042 17:30554859-30554881 AGGGAGAGGCAGGTGGATGCTGG + Intergenic
1146844374 17:36173952-36173974 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1146856679 17:36261887-36261909 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1146863938 17:36326488-36326510 AGGGAGAGGCAGGTGGATGCTGG + Intronic
1146872588 17:36385798-36385820 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1146879947 17:36436883-36436905 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1146883869 17:36458034-36458056 AGGGAGAGGCAGGTGGATGCTGG - Intergenic
1147066798 17:37927076-37927098 AGGGAGAGGCAGGTGGATGCTGG + Intronic
1147075473 17:37986422-37986444 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1147078330 17:38006637-38006659 AGGGAGAGGCAGGTGGATGCTGG + Intronic
1147086998 17:38065968-38065990 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1147094268 17:38130572-38130594 AGGGAGAGGCAGGTGGATGCTGG + Intergenic
1147102943 17:38189931-38189953 AGGGAGAGGCAGGTGGATGCTGG - Intergenic
1147384648 17:40074158-40074180 AGAGAGAGGCAGGGGTAAGAAGG - Intronic
1147429417 17:40362600-40362622 ACAGAGCGGAAGGTGGAGAGTGG - Intronic
1147536250 17:41324790-41324812 AGGGAGAGGCAGGTGGATGCCGG + Intergenic
1147600745 17:41743794-41743816 ACAGACAGGCAGGAGGAGCCAGG + Intergenic
1147667809 17:42159839-42159861 ACAGAGGGGGAGGTTGGGGAAGG + Exonic
1148114708 17:45168990-45169012 AAAGAGAGGGAGGAGGAAGAAGG - Intronic
1148127189 17:45242932-45242954 ACAGGGAGCCTGGAGGAGGAGGG - Intronic
1148199518 17:45740637-45740659 ACAGAAAGGCAGGTCCAGGAAGG + Intergenic
1148437403 17:47694630-47694652 CCAGAGAGGAATGCGGAGGAAGG + Intronic
1148561599 17:48609894-48609916 CTAGAGAGGCAGGTGGAGGGAGG - Intronic
1148824709 17:50384044-50384066 AGGGAGAGGCAGGTGAGGGAAGG - Intronic
1149540904 17:57467482-57467504 ACAGAAGGGCAGATGAAGGATGG + Intronic
1149592249 17:57839013-57839035 CCAGGGAGGCAGGTGGATGCTGG + Exonic
1149657974 17:58320189-58320211 CCAGAGAGGGAGGCGGAGAAGGG + Intronic
1149847515 17:60016398-60016420 AGGGAGAGGCAGGTGGATGCTGG - Intergenic
1150085873 17:62273015-62273037 AGGGAGAGGCAGGTGGATGCTGG - Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150411081 17:64941079-64941101 ACAGATAGGCAGGTGGATGGTGG + Intergenic
1150478045 17:65488837-65488859 AGAGAGAGGGAGATGGAGGGAGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1151197369 17:72441207-72441229 AGAGACAGGAAGGAGGAGGAAGG - Intergenic
1151197997 17:72445576-72445598 ACAGTGAGGGTGGTGGGGGAGGG + Intergenic
1151230261 17:72679678-72679700 GCTGGGTGGCAGGTGGAGGATGG + Intronic
1151351468 17:73534505-73534527 ACAGACAGGAGGGAGGAGGAAGG + Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151564818 17:74892191-74892213 ACAGAAAGGGAGGGGGAGGAGGG - Intronic
1151671570 17:75574152-75574174 AGAGAGAGCCAGGCCGAGGAGGG + Intronic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1151896149 17:76982210-76982232 ACAGAGAGGCAGCCGAAGGTGGG + Intergenic
1151917568 17:77129670-77129692 GCAGAGCTGAAGGTGGAGGAGGG + Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152336268 17:79701444-79701466 ACAGGTGGGAAGGTGGAGGAAGG + Intergenic
1152375296 17:79915724-79915746 GTCGAGGGGCAGGTGGAGGAGGG + Intergenic
1152406056 17:80098543-80098565 GCAGAGACGGAGGTGGAGAATGG + Intronic
1152535620 17:80948966-80948988 ACAGAGAGGAATGGGGCGGAGGG + Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152913029 17:83016427-83016449 ACAGAGGGGAAGTGGGAGGAGGG + Intronic
1153372491 18:4334758-4334780 AAACAGATGCAGGTGGAGGCAGG - Intronic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153527141 18:6008220-6008242 ACAGAGCGGAGTGTGGAGGAGGG - Intronic
1153534498 18:6086527-6086549 AAAGTGAGGCAGGTGGAGACTGG + Intronic
1153561066 18:6372134-6372156 TGAGAGAGGGAGGTGGAGAAAGG - Intronic
1153625721 18:7020688-7020710 ACAGGTTGGAAGGTGGAGGAAGG - Intronic
1154104272 18:11506597-11506619 ACACAGAGTCAGGTGGTGGTTGG - Intergenic
1154493101 18:14936355-14936377 AGAGGGAGGAAGGTGGAGGAGGG - Intergenic
1155505455 18:26528549-26528571 GCAGAGCAGCAGCTGGAGGAAGG - Intronic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1155924234 18:31637291-31637313 AGAGAGAACCAGGTGGAGAATGG - Intronic
1156462946 18:37331851-37331873 ACAGGCAGGCAGGTGGAGGTGGG + Intronic
1156992395 18:43425499-43425521 GGAGAGAGGGAGGTGGAAGAAGG - Intergenic
1156992414 18:43425634-43425656 GGAGAGAGGGAGGTGGAAGACGG - Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157110494 18:44816102-44816124 ACAGAGGGGGAGGTGAGGGAGGG + Intronic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157312197 18:46560688-46560710 GGAGAGAGGGAGGTGGTGGAAGG - Intronic
1158210210 18:55040585-55040607 AGAGACAGGGAGGTGAAGGAAGG - Intergenic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1159038213 18:63297830-63297852 ACAGAGAGGCAGGTTAAAGGTGG - Intronic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159313104 18:66736041-66736063 AGAGAGAGAAAGGAGGAGGAAGG - Intergenic
1159972086 18:74667158-74667180 GCACAGACGCAGGTGGAGAAGGG - Intronic
1160036760 18:75309037-75309059 AGAGAGAGGCAGGTGTAAGGTGG - Intergenic
1160172547 18:76566960-76566982 AGAGAGAGACAGGTAGGGGAAGG - Intergenic
1160560261 18:79751332-79751354 GCACAGAGGCAGGTCCAGGAGGG + Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160748705 19:723475-723497 GCAGCGAGGCAGGGAGAGGACGG - Intronic
1160872028 19:1282065-1282087 GGAGAGAGGAAGGAGGAGGAAGG + Intergenic
1160916018 19:1497145-1497167 AGAGAGGGGCGGGTGGGGGAGGG - Intronic
1161257968 19:3320334-3320356 ACAGAGGGGGAGGTGGCGGGTGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161421033 19:4175943-4175965 TCAGGGAGGAAGGGGGAGGATGG + Intronic
1161699554 19:5787367-5787389 AGAGACAGGCGGGTGGAGGGAGG + Intronic
1161800290 19:6413716-6413738 TCAGAGAGGCAGGTTCAGGAAGG + Exonic
1161877712 19:6924790-6924812 GCAGAGGTGCAGGTGGAGGTAGG - Exonic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162105806 19:8368976-8368998 ACAGCATGGCAGGAGGAGGATGG + Intronic
1162578477 19:11513307-11513329 TCAGAGATGGAGGGGGAGGAGGG + Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1162637652 19:11982895-11982917 ACAGAGAGAGTGGTGTAGGAAGG + Intergenic
1163053382 19:14701549-14701571 AGAGACATGGAGGTGGAGGATGG - Intronic
1163368068 19:16887426-16887448 ACAGAGAAGACGGTGGAGGGGGG + Intergenic
1163498872 19:17663606-17663628 ACAGAGGGGTGGGTGTAGGAAGG + Intronic
1163699667 19:18780987-18781009 AGGGAGAGGCTGGTGGAGTAAGG + Exonic
1164489854 19:28698713-28698735 GCAGAGAGGGAGGTGGATAAAGG + Intergenic
1164611128 19:29632432-29632454 ACAGAAAGGCAGGTGGTCCAGGG - Intergenic
1164635821 19:29790889-29790911 ACAGTCATGCAGGGGGAGGATGG - Intergenic
1165373341 19:35424264-35424286 ACAGAGAGGCAGCTGTGAGAGGG + Intergenic
1165453655 19:35899067-35899089 AAAGTGAGGAAGGGGGAGGAGGG + Intronic
1165800397 19:38546100-38546122 ACAGAGACCCAGGTCTAGGAAGG - Intronic
1165928348 19:39341407-39341429 CCAGGGAGGCAGCTGGGGGAGGG - Intronic
1166167656 19:41003743-41003765 ACAGAAAGGAAGGATGAGGAAGG + Intronic
1166213896 19:41323654-41323676 AGGGAGAGGAAGGCGGAGGAAGG - Exonic
1166276111 19:41755396-41755418 ACAGAAAGGGAAGAGGAGGAGGG + Intronic
1166301691 19:41914914-41914936 ACAGAGACGGAGATGGTGGAGGG - Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166377320 19:42334887-42334909 ACAGACAGGAAGGGAGAGGATGG - Intronic
1166540515 19:43602326-43602348 ACAGGGAGGGAGGTGGAGGTGGG - Intronic
1166694921 19:44846855-44846877 ACAGACAAGCAGGCGTAGGATGG - Intronic
1166871902 19:45876441-45876463 CCAGAGACCCAGGTGGAGGGAGG - Intergenic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167156566 19:47742663-47742685 ACAGACACGTGGGTGGAGGACGG - Exonic
1167191308 19:47991808-47991830 GAAGAGAGGAAGGAGGAGGAGGG - Intronic
1167295334 19:48646198-48646220 GGAGAGAGGGAGGGGGAGGAGGG - Exonic
1167366081 19:49055652-49055674 ACAGAGAGTAGGGTGTAGGAAGG + Exonic
1167397873 19:49243348-49243370 AGAGCGAGGGAGGAGGAGGAAGG + Intergenic
1167420005 19:49397279-49397301 GCAGAGAGTCAGGGGCAGGAGGG + Intronic
1167443055 19:49520877-49520899 CCAGAGAGGCAGCTCCAGGAGGG + Intronic
1167508181 19:49882103-49882125 AAAGAGCTGCAGGTGGTGGAAGG - Exonic
1167608297 19:50493346-50493368 GGGGAGAGGGAGGTGGAGGAAGG + Intergenic
1167946399 19:52992537-52992559 ACAGATGGCAAGGTGGAGGATGG - Intergenic
1168294444 19:55371981-55372003 TCAAAGAGGCAGGTGGAGACAGG + Intergenic
925034941 2:677607-677629 ACAGAGGAGCAGGCGGAGGCGGG + Intergenic
925157935 2:1661533-1661555 GCAGGGATGCAGGTGGAGGATGG + Intronic
925683592 2:6448574-6448596 ACAGTGAGGCAGGCACAGGAAGG + Intergenic
925783172 2:7402685-7402707 ACAGAGAGAAAGATGGAGGAAGG + Intergenic
926169460 2:10542950-10542972 ACAGAGAGCCAGAAGGAAGAAGG - Intergenic
926581025 2:14633102-14633124 ACAAAGAGGCAGGGGAAGGATGG - Intronic
926705270 2:15833140-15833162 AGAGAGAGAAAGTTGGAGGAGGG + Intergenic
927112294 2:19872110-19872132 ACACCGAGCCAGGTGGTGGAGGG + Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927683553 2:25155611-25155633 ACACAAAGGCACCTGGAGGAGGG - Exonic
927964727 2:27262077-27262099 TCAGAGGGGCAGGTGGACGGTGG + Intronic
928199277 2:29236909-29236931 ACAGGCAGACAGGTGGACGATGG - Intronic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
929189410 2:39125235-39125257 ACAGAGAGGGAGGAAGAGGGCGG - Intergenic
929310568 2:40419519-40419541 GCAGAGAAGGAGGTGGAGGCAGG - Intronic
929487790 2:42370237-42370259 ACAGTGAGGCAGTTGGTGGAAGG + Intronic
929563314 2:42969246-42969268 AAAGTGGGGCAGGGGGAGGAGGG + Intergenic
929801714 2:45110142-45110164 AGAGAGAGGCAGGTGAAAGAGGG + Intergenic
931123392 2:59246057-59246079 TCAGAGAGATAGGTGGAGGTTGG - Intergenic
931162066 2:59703177-59703199 AGGGAGAGCCAAGTGGAGGAGGG + Intergenic
932110872 2:68998767-68998789 AGAGAGAGGAAGGTGGGGAAGGG + Intergenic
932117958 2:69070224-69070246 ACAAGGACGCAGGTGGAAGAGGG - Intronic
932146320 2:69320864-69320886 AGAGAGGGAGAGGTGGAGGAGGG + Exonic
932193361 2:69760356-69760378 AGAGAGAGGGAGGAGAAGGATGG + Intronic
933094189 2:78157471-78157493 ACACAGACACAGGTGGAGTAAGG - Intergenic
933840944 2:86285087-86285109 CCAGTGAGGCCGGTGGAGAAGGG - Intronic
933998230 2:87685637-87685659 AAAGAGGGGCAGCTGAAGGAAGG + Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934230914 2:90181147-90181169 AGAGGGGGGGAGGTGGAGGAGGG - Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
935635749 2:105248566-105248588 GCAGAGAGGCAAGAGGAGGGTGG + Intergenic
935675982 2:105595326-105595348 ACAGAGAGGAAGGCCGAGGATGG - Intergenic
935757191 2:106285219-106285241 GCAGAGAGGCAGGGCGAGGAAGG + Intergenic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
936295620 2:111265236-111265258 AAAGAGGGGCAGCTGAAGGAAGG - Intergenic
936502959 2:113080972-113080994 AGGGAGAGGCATGTGGAAGAAGG - Intergenic
936837537 2:116726612-116726634 ACAGAGAAGAATGTGGAGAAGGG + Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937483510 2:122289458-122289480 AGAGAGAGGCAGGGAGAAGAGGG - Intergenic
938208467 2:129443708-129443730 ACAACAAGGCAGGTGGAGGCAGG - Intergenic
938384267 2:130853263-130853285 TCAGAGTAGCTGGTGGAGGAGGG + Intronic
938410430 2:131059291-131059313 AGAGAGGGGCAGGTGGGGCAAGG + Intronic
939404332 2:141736486-141736508 ACACAGAGACAGGTGGAAGATGG + Intronic
939500369 2:142976132-142976154 GCAGAGAGGCAAGGGGTGGAGGG + Intronic
939678216 2:145098286-145098308 TGAGTTAGGCAGGTGGAGGAAGG - Intergenic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941201818 2:162520883-162520905 ACAGAGATGAAGCTGCAGGATGG - Intronic
941679655 2:168383714-168383736 ACAGAGCAGCATGTGGAGGCTGG + Intergenic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942034301 2:171995968-171995990 ACAAAGAGGCAGGGTCAGGAAGG + Intronic
942423219 2:175830208-175830230 GGACAGAGGCAGGTGTAGGAAGG + Intergenic
942507354 2:176657062-176657084 ATAGAAAGGGAGGAGGAGGAGGG + Intergenic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
945086028 2:206133512-206133534 ACAGATAGGGAGGAGGAGGCAGG + Intronic
945188438 2:207163405-207163427 GCAGAGGAGCAGGGGGAGGAGGG + Intronic
945420140 2:209625564-209625586 AGAGAGAAGCAGGTGGATGCAGG + Intronic
945819143 2:214641775-214641797 CCAGAGAAGCAGGTGGTAGATGG - Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946045507 2:216817697-216817719 CCAGAAAGGGTGGTGGAGGAAGG + Intergenic
946058330 2:216920143-216920165 ACAGGGAAGCATGTGGATGAAGG + Intergenic
946109672 2:217403543-217403565 AGAGAGACTCAGTTGGAGGAGGG - Intronic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947624553 2:231611630-231611652 AGAGAGAGGCTGGGGCAGGATGG + Intergenic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948228828 2:236334878-236334900 GGAGAGAGGCAAGAGGAGGAGGG + Intronic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948272527 2:236685637-236685659 ACAGAGAGGCAGCTGAAGGAGGG - Intergenic
948346004 2:237298842-237298864 TCAGAGAGGCAGGTAGAGACAGG - Intergenic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948609608 2:239158562-239158584 GCAGAGCAGCAGGTGCAGGAGGG + Intronic
948853816 2:240720947-240720969 AGAGAGGGGCAAGTGGAGGAGGG + Exonic
948988239 2:241539078-241539100 AGAGAGGGGCAGGGGGAGGGGGG + Intergenic
949060688 2:241955333-241955355 ACAGAGAGGCAGGTGCTCAAGGG + Intergenic
1168801671 20:647275-647297 ACAGAGAGAAAGGGGGAAGAGGG + Exonic
1168956029 20:1834955-1834977 ACAGAGAGCAAGGAGAAGGATGG + Intergenic
1169247896 20:4038252-4038274 GCAGAGAGGCAGGGTGAGGGTGG + Intergenic
1169289394 20:4335769-4335791 AGAGAGAGGTAGGGGAAGGAGGG - Intergenic
1169398849 20:5262230-5262252 TCTGATAGGCAGTTGGAGGAGGG + Intergenic
1169470689 20:5882992-5883014 ACACAGAGGGAGGTGGTGGTGGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169626599 20:7578355-7578377 ACAGAGTGGCTAGTAGAGGAAGG - Intergenic
1170020297 20:11829962-11829984 ACAGAGAGCCATGTGAAGGATGG + Intergenic
1170605795 20:17874353-17874375 ACAGAGGGGCAGGGGAAGGGGGG - Intergenic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170981281 20:21215906-21215928 ACAGAGACGCAGGTGCTGAAAGG - Intronic
1171393384 20:24815655-24815677 CAACAGAGGCAGGTGGAGAAGGG - Intergenic
1171940351 20:31322900-31322922 ACACAGAGAGAGGTGCAGGAAGG + Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172619620 20:36310355-36310377 ACAGGGAGGCTGGTGGTGGAGGG + Intronic
1172689990 20:36783612-36783634 GCAGAGAGGCAGGAGGAAGGGGG + Exonic
1173064392 20:39696255-39696277 AGAGAGAGGGAGGAGGAGGGAGG + Intergenic
1173141964 20:40492414-40492436 CCAGAGAGGCTGGTGGAGGTGGG - Intergenic
1173165240 20:40683193-40683215 TCAGAGAGGCGGGTCGGGGAAGG - Intergenic
1173248778 20:41353706-41353728 CCAGAGGGGCAGGTGCAGGTTGG - Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173396933 20:42688786-42688808 ACAGTGAGGCAGGTACATGAAGG + Intronic
1173564825 20:44031156-44031178 ACACAAGGGCAGGTGGGGGAAGG + Intronic
1173568022 20:44055688-44055710 ACAGTGATCCAGGTGGGGGAAGG + Intronic
1173835074 20:46119440-46119462 ACAGGGAGGCAGGGGGAGGGCGG + Intronic
1173851339 20:46220357-46220379 ACAGAGAGGGAGACGCAGGAAGG + Intronic
1174484992 20:50855512-50855534 CCAGAGATGCAGGTGGAGGTGGG - Intronic
1174532066 20:51222048-51222070 AGAGAGAGCCAGGGGGAGGAGGG + Intergenic
1174554469 20:51383895-51383917 ACAGAGAGAGAGGTGGGGAATGG + Intergenic
1175073296 20:56352770-56352792 TCAGAGAGGAAGGTGAAGTAAGG - Intergenic
1175754138 20:61518680-61518702 ACAGATAGGTAGATGAAGGATGG - Intronic
1176065836 20:63194144-63194166 ACAGAGTGGGAGGTGGTGGCAGG - Intergenic
1176286047 21:5020302-5020324 ACAGCCAGGCAGGGGCAGGAAGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1177788464 21:25696389-25696411 ACAGAGAGGGAGGGAGAGGGAGG + Intronic
1178505252 21:33157391-33157413 AGAAAGAGGGAGGAGGAGGAGGG - Intergenic
1178678332 21:34649696-34649718 AGAGAGTAGCAGGTGGAGGTAGG + Intergenic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179015750 21:37593315-37593337 GCAGAGAGGCAGGGGCTGGAGGG - Intergenic
1179130316 21:38630451-38630473 ACAGGGAGGTGGGAGGAGGAAGG + Intronic
1179440910 21:41393512-41393534 AGAGAGAGAATGGTGGAGGAAGG - Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179554099 21:42161797-42161819 ACAGAGAGGCCTGTGGAAGGTGG - Intergenic
1179647329 21:42783987-42784009 GAAGAGAGGGGGGTGGAGGAAGG - Intergenic
1179658485 21:42860173-42860195 ACAGGGAGGAGGGTGGAGGGAGG + Intronic
1179712200 21:43269694-43269716 TCAAGGAGGCAGATGGAGGAAGG - Intergenic
1179871134 21:44243173-44243195 ACAGCCAGGCAGGGGCAGGAAGG + Intergenic
1179906411 21:44425442-44425464 ACAAAGAGGCAGGTGCCGGCGGG + Intronic
1180703129 22:17792560-17792582 CCAGAAAGGCAGGTGGAGAAAGG - Intronic
1180872036 22:19151654-19151676 ACCAAGAGGTGGGTGGAGGAGGG - Intergenic
1181349188 22:22243347-22243369 CCAGAGAGGCAGTGGGAAGAAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1182044577 22:27264226-27264248 AAAGGAAGGCAGGTGGAGGGAGG + Intergenic
1182260446 22:29070346-29070368 AGAGAGAGCCAATTGGAGGAGGG + Intergenic
1182413090 22:30203506-30203528 GCAGAGAAGCAGGGGAAGGATGG - Intergenic
1182477520 22:30584297-30584319 ACAGATATGGATGTGGAGGAAGG - Intronic
1182663962 22:31944261-31944283 GCAGAGATGGAGGTGGAGAAGGG - Intronic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1183078958 22:35444199-35444221 AGAGAGAGGAAAGGGGAGGAGGG + Intergenic
1183361144 22:37384144-37384166 GGAGAGAGGCAGGGGGTGGAAGG + Intronic
1183819947 22:40338082-40338104 ACAGAGCGGCAGGTAAAGTATGG - Intergenic
1183861967 22:40676877-40676899 TCAGAGAGGAAGGAGCAGGAAGG - Intergenic
1183967021 22:41447944-41447966 ACACAGAGCCAGGGGGAGGGAGG + Intergenic
1184080237 22:42214177-42214199 CCACAGAGGCAGCTGGAGAAGGG + Exonic
1184098590 22:42329807-42329829 GCAGGCAGGCAGGGGGAGGAAGG - Intronic
1184117033 22:42428224-42428246 ACAGAGCGGGAGGTGGCTGAGGG - Intronic
1184135931 22:42549907-42549929 GAAGAGAGGCAGGTGGGGAAAGG + Intergenic
1184208847 22:43023487-43023509 ACAGGGAGACAGGTGGGGGTGGG - Intergenic
1184262182 22:43324747-43324769 AGAAACAGGCAGGTGGAGCAGGG + Intronic
1184378924 22:44132918-44132940 AGAGACCAGCAGGTGGAGGATGG - Exonic
1184898411 22:47425960-47425982 ACTCAGAGTCAGGTGGAGGGAGG + Intergenic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
1185007251 22:48288200-48288222 AGGGAGAGAAAGGTGGAGGACGG + Intergenic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
949272596 3:2236984-2237006 GCAGAGAGCAAGATGGAGGATGG + Intronic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
951129475 3:19024682-19024704 ACAGAGAGGAAGGCAGAGAAGGG - Intergenic
951404998 3:22285268-22285290 ACAGAAAGGAATGTGGTGGAGGG - Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
952289775 3:32003825-32003847 ACAGAGAGCAAGGTGGAAAAGGG + Intronic
952293052 3:32037010-32037032 AGAAAGAGGCAGGTGGGGGTTGG - Intronic
952510720 3:34052303-34052325 CAAGAGAGGCAGGTGAATGAAGG + Intergenic
952958878 3:38577389-38577411 ACAGAGAGGCATGTGCATGCAGG + Intronic
953154476 3:40356667-40356689 ACACAGAGTCAGCTGGAGAAGGG + Intergenic
953519194 3:43625004-43625026 AAAGAGAGACAAGTGGAGAAAGG - Intronic
953916898 3:46926143-46926165 ACAGAGAAGCAGGTGCTGGAGGG + Intronic
954533584 3:51341323-51341345 ACAGAGTGGCAGCGGAAGGAGGG + Exonic
954535805 3:51358478-51358500 ACAGGGAGAGAGGAGGAGGAGGG - Intronic
954575872 3:51675941-51675963 GCTGAAGGGCAGGTGGAGGAGGG + Intronic
954876533 3:53806211-53806233 AGGGAGAGGAAGGGGGAGGAGGG - Intronic
955169774 3:56551897-56551919 ACAAAGAGGTAGGTTGGGGAAGG - Intergenic
955488063 3:59454761-59454783 ACAGAGGGGCAGGGGGAGATGGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956472663 3:69584355-69584377 ACAGTGAAGAAGGTGGAGTAGGG - Intergenic
956741576 3:72279965-72279987 GCAGGGAGGAAGGAGGAGGAGGG + Intergenic
957191116 3:77010946-77010968 ACAGAGAGGGAGAGGGAGAAAGG - Intronic
958415387 3:93867691-93867713 AAAGTGAGGCAGGAGGAAGAGGG - Intergenic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
958830983 3:99088888-99088910 AGAGTGAGTCAGGTAGAGGAAGG + Intergenic
958958703 3:100488739-100488761 CCAGAGGGCCAGGTGCAGGAAGG + Intergenic
959108979 3:102098819-102098841 AGAGAGAGAGAGGTGGAGTAAGG + Intergenic
960035722 3:113101352-113101374 CCAGATAGTCAGGTGGAGGGAGG - Intergenic
960248760 3:115428780-115428802 AAAGAGAGGAAGGGGGAAGAGGG - Intergenic
960552772 3:118994908-118994930 ACAGGGAAGAACGTGGAGGAAGG + Intronic
960673074 3:120170547-120170569 GAGGAGAGGCTGGTGGAGGAGGG - Intronic
960806402 3:121587534-121587556 ACAGAGAGAAAAGTGGATGATGG - Intergenic
961106115 3:124243096-124243118 ACAGACAGGCAGGTGGGTGAAGG - Intronic
961179910 3:124868344-124868366 GCAGAGAGGCAGGGGCAGCATGG + Intronic
961201680 3:125050443-125050465 ATAGACAGGGAGGTGGAGGATGG - Intronic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
961660999 3:128468746-128468768 ACAGAGTGGCAGGCGAATGAAGG + Intergenic
962003340 3:131323494-131323516 AAAGAGAGGAAGATGGGGGAAGG - Intronic
962014774 3:131428555-131428577 ACAGAGAGACAGTGGGAGAATGG + Intergenic
962381948 3:134905221-134905243 CCAAAGAGGAAAGTGGAGGAAGG - Intronic
962606305 3:137035479-137035501 GCAGACAGGCAGTTGGGGGATGG + Intergenic
962817957 3:139019950-139019972 ACGGAGAGGGAGGTAGAGGTTGG + Exonic
962892965 3:139688919-139688941 ACAGAGAGGGATGGAGAGGAAGG + Intergenic
964430028 3:156595613-156595635 AAAGAGAGGCAGTGGAAGGAGGG - Intergenic
964626154 3:158762043-158762065 ACAGAGTGGCAGGAGCAGGATGG + Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
966880126 3:184345354-184345376 AGAGAGAGGCATGGGGAGGGTGG - Intronic
966917513 3:184593196-184593218 ACAGAGTGGCAGGAGGAACAGGG - Intronic
967155714 3:186690166-186690188 CCAGTGAGGCAGGTGGAGAGGGG - Intergenic
967157003 3:186702331-186702353 CCAGTGAGGCAGGTGGAGAGGGG - Intergenic
967356501 3:188577889-188577911 AGAGAGAGGGAGATGGAGGTGGG - Intronic
967496160 3:190146324-190146346 ACCGATGGGCAGGTGGGGGAGGG - Intergenic
967616070 3:191568320-191568342 AGAAAGAGGCAGGAGGAGAAAGG + Intergenic
967767178 3:193293881-193293903 CCAGAGAAGGAGGTGCAGGAGGG - Intronic
967812917 3:193775542-193775564 AGGGAGTGGCAGTTGGAGGATGG - Intergenic
967850211 3:194076741-194076763 ACAGAGGGCCAGGTGCAGGAAGG + Intergenic
967875824 3:194267958-194267980 TCAGAGAGGCAGGGCCAGGAAGG + Intergenic
968653007 4:1767424-1767446 AGGGAGAGGGAGGGGGAGGAGGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968887406 4:3341809-3341831 ACAGAAGGGAGGGTGGAGGATGG + Intronic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969212364 4:5697505-5697527 AGAGTGAGGGAGCTGGAGGAAGG + Intronic
969232448 4:5841200-5841222 TCAGACAGGCAGCCGGAGGAGGG - Intronic
969299535 4:6289626-6289648 ACAGAGAGGCAGGGGAGGAAAGG + Intronic
969322305 4:6419853-6419875 ACAGAGACACAGGGAGAGGAAGG - Intronic
969331364 4:6474937-6474959 ACAGAGAGGCTGGGGGTGGCAGG - Intronic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
969623140 4:8288937-8288959 AGAGAGAGAGAGGGGGAGGAAGG - Intronic
969652187 4:8474407-8474429 ACAGAGAGGCAGCCGTGGGAGGG + Intronic
969884805 4:10205952-10205974 ACAAAGAGTCAGGTGGACAAGGG - Intergenic
970133867 4:12900615-12900637 ATAAAAAGGCAGGTAGAGGAGGG - Intergenic
970867772 4:20778989-20779011 AGAGACAGGGAGGAGGAGGAAGG + Intronic
971345645 4:25809645-25809667 AGAGAGAGAGAGATGGAGGAAGG - Intronic
971661912 4:29429539-29429561 TCAGAGAGGAAGGTGAAAGAAGG + Intergenic
972150348 4:36081732-36081754 AGAGAGGTGTAGGTGGAGGAGGG + Intronic
972657509 4:41078995-41079017 ATAAAGAGGCAGGAGCAGGAGGG + Intronic
972666413 4:41169243-41169265 ACAGAGAGGGAGGTAAAGTAAGG + Intronic
973832851 4:54779289-54779311 ACAGGGAGGGAGGAGGGGGAGGG + Intergenic
973884544 4:55307151-55307173 AGAGAGAGGGTGGTGGGGGAAGG - Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
975318770 4:72985346-72985368 AAAGAAACACAGGTGGAGGATGG - Intergenic
975633808 4:76425954-76425976 AGAGACAAGGAGGTGGAGGAAGG + Intergenic
975671573 4:76786180-76786202 AGAGAGACGCATGTGTAGGAAGG + Intergenic
975675860 4:76826959-76826981 AGAGAGAGATAGGTGGAAGAAGG - Intergenic
975740373 4:77423784-77423806 ACAAAGAGGCAGGAGAAGCAAGG - Intronic
975973377 4:80069159-80069181 ACAGAGAGGCCGGGGAAGGTAGG + Intronic
976293812 4:83449379-83449401 AGAGAGAAGCAGGGGAAGGAGGG + Intronic
976597596 4:86908630-86908652 AGAGAGAGTAAGGTTGAGGAGGG - Intronic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
977033882 4:91924826-91924848 GCTGAGGGGCAGGTGGAGGGTGG + Intergenic
977320823 4:95513674-95513696 AGAGAGAAACAGGTGAAGGAGGG + Intronic
979119089 4:116870803-116870825 GCAGAGAGGCAGGGGCTGGAGGG + Intergenic
979512089 4:121566479-121566501 AAAAAGAGAAAGGTGGAGGAAGG + Intergenic
980170663 4:129285928-129285950 ACAGATAGGCAGGTGGTAGCTGG + Intergenic
980437475 4:132796585-132796607 GCAGAGTGGAAGGTGGATGATGG + Intergenic
980753448 4:137123788-137123810 ACAGAGAGAGAGGAGAAGGAGGG + Intergenic
980877668 4:138678235-138678257 ACAGTGAGGCTGGAGGATGAGGG + Intergenic
980924297 4:139119357-139119379 ACAGAGAGCAAGGTGAAGAAGGG - Intronic
980977487 4:139625007-139625029 ACAGAGAGGAGGGGGAAGGAGGG + Intergenic
981491699 4:145346673-145346695 ACAGGCAGGCAGTTGCAGGAGGG + Intergenic
981589633 4:146345461-146345483 ATAGAGAGCCAGGTGGAGAATGG - Intronic
981839836 4:149098640-149098662 ACAGATAGGCAAGGGGAAGAGGG - Intergenic
982769685 4:159385603-159385625 AGAGAGTGGGAGGTGGAGGCTGG - Intergenic
983355760 4:166655720-166655742 AAAGAGAGAGAGGCGGAGGAAGG + Intergenic
983493690 4:168418749-168418771 CCAGAGAGGAAGGTGGCGAATGG - Intronic
983577544 4:169274682-169274704 ACAGAGAGGCTGGTTTAGGACGG - Intergenic
983875449 4:172869761-172869783 AGAGAGAATGAGGTGGAGGAGGG - Intronic
983891446 4:173034269-173034291 GCAGTGAGGAAGATGGAGGAGGG - Intronic
985278926 4:188268398-188268420 ACAGGGAGGGATGTGGAGGTAGG + Intergenic
985447993 4:190038161-190038183 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
1202762127 4_GL000008v2_random:121869-121891 AGAGAGAGGCAGGTGCATGCTGG - Intergenic
985519588 5:367235-367257 CCAGGGAGGCAGGGGGAGAACGG + Intronic
985589036 5:755364-755386 AGAGTGAGGCTGGTGTAGGATGG - Intronic
985603716 5:847880-847902 AGAGTGAGGCTGGTGTAGGACGG - Intronic
985677047 5:1237575-1237597 GGAGAGAGGCAAGTGGAGGTGGG + Intronic
985932805 5:3072382-3072404 AGAGAGAGGCAGGGGGGAGACGG - Intergenic
986011077 5:3715853-3715875 ATGGGGAGGCAGGTGGACGAGGG - Intergenic
986372901 5:7098542-7098564 ACAGGGATGCATGTGGATGAGGG + Intergenic
986570056 5:9155183-9155205 GGAGAGAGGGAGATGGAGGAGGG - Intronic
987694225 5:21307702-21307724 ACAGAGAGCCATGTGGAGTCTGG + Intergenic
988043151 5:25912978-25913000 ACAGAGTGGGGGGTGGTGGACGG - Intergenic
988227259 5:28428107-28428129 AAAGAGACGGAGGTGGAGTAAGG + Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988537963 5:32085976-32085998 CCAGAGAGTGAGGAGGAGGAAGG - Intronic
988714047 5:33807068-33807090 ACAGAGAGGCCAGAGGAGAAAGG - Intronic
988947316 5:36218717-36218739 GAAAAGAGGAAGGTGGAGGAAGG - Intronic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
989385023 5:40846353-40846375 AGAGAGAGCAAGGTGGAGGGGGG + Intronic
989676787 5:43982014-43982036 ACAGAGAGGAAGGAAGAGCAGGG - Intergenic
989955988 5:50360433-50360455 ACAGAGAGAGAGATGGAGGGAGG - Intergenic
990098498 5:52152197-52152219 TGAGAGAAACAGGTGGAGGATGG - Intergenic
991145776 5:63301950-63301972 AAACAGAGGCAGGTGGAGGGTGG - Intergenic
991153107 5:63395671-63395693 ACAGTGAGGCCAGTGGAGAAAGG - Intergenic
991686954 5:69190048-69190070 CCAGAGAGGTAGGGGGAGGGCGG - Intronic
991746021 5:69741767-69741789 ACAGAGAGCCATGTGGAGTCTGG - Intergenic
991751684 5:69813474-69813496 ACAGAGAGCCATGTGGAGTCTGG + Intergenic
991797623 5:70321725-70321747 ACAGAGAGCCATGTGGAGTCTGG - Intergenic
991825399 5:70617081-70617103 ACAGAGAGCCATGTGGAGTCTGG - Intergenic
991830971 5:70688367-70688389 ACAGAGAGCCATGTGGAGTCTGG + Intergenic
991889965 5:71321046-71321068 ACAGAGAGCCATGTGGAGTCTGG - Intergenic
992187257 5:74256273-74256295 AGATGGAGCCAGGTGGAGGAGGG - Intergenic
992643805 5:78793691-78793713 GCACACAGCCAGGTGGAGGAAGG + Intronic
992877827 5:81075362-81075384 GCAGAGAGGCAGGGGCTGGAGGG + Intronic
993744355 5:91577748-91577770 AGAGAGAGGGAGGAGGATGAAGG + Intergenic
994470646 5:100200651-100200673 TGAGAGAGGAGGGTGGAGGAGGG - Intergenic
994788719 5:104197147-104197169 ACACAGGGGCAGGTTGGGGATGG + Intergenic
995321159 5:110835746-110835768 AGAAAGAGACAGGTGGAGGGAGG - Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995795956 5:115941536-115941558 ACACTGGGGCAGGGGGAGGAAGG + Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
995955191 5:117769149-117769171 ACAGAGCAGCATGTGGAGGCTGG + Intergenic
996453568 5:123655376-123655398 ACATAGTGGCAGGAGGAGTAGGG + Intergenic
996580745 5:125029493-125029515 ACAGTGAGGCCGGGAGAGGAAGG - Intergenic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
998367932 5:141643034-141643056 ACACAGAGGTAGGTGCAGGTGGG + Exonic
999147595 5:149406414-149406436 ACACAGGGGCTGGGGGAGGAAGG + Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999891282 5:155981067-155981089 ACAGTGCAGCAGATGGAGGAGGG + Intronic
1000380981 5:160629148-160629170 CCAGATGGGCAGGTGCAGGAAGG + Intronic
1000602432 5:163290782-163290804 ACAGAGAAGAAAGTGGATGAGGG + Intergenic
1000793302 5:165633293-165633315 ACAGAAAGGAAGATGGAGGCAGG + Intergenic
1000906819 5:166974421-166974443 ACAGGGAGGCAGATGTAGGGAGG - Intergenic
1001081583 5:168671456-168671478 GCAGAGAGGCCGGTGGAGGTGGG + Exonic
1001118818 5:168962099-168962121 CCAGAGATGCTGGTGGAGGCAGG - Intronic
1001429433 5:171647604-171647626 CCACTGAGGCAGGTGGAGAAGGG + Intergenic
1001548589 5:172586326-172586348 ACAGTGAGGCAGGGCGAGGTGGG + Intergenic
1001620002 5:173075780-173075802 GAAGAGAGGCAGGGGAAGGAAGG - Intronic
1002255198 5:177953350-177953372 GGAGAGAAGCAGGTAGAGGAGGG - Intergenic
1002360630 5:178667875-178667897 CCAGAGAGGGAGCTGGTGGAAGG + Intergenic
1002432940 5:179213564-179213586 AAGGAGAGGCAGGTGCAGCAGGG + Intronic
1002482938 5:179515384-179515406 GGAGAGAAGCAGGTAGAGGAGGG + Intergenic
1002500037 5:179642458-179642480 ACATGCAGGCAGGTGGAGGCAGG - Exonic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002795269 6:466525-466547 CCAGGGAGGGAGGTGCAGGATGG + Intergenic
1003324506 6:5082475-5082497 GCAGGGAGGCAGGGGGAGGGAGG - Intergenic
1003351029 6:5317961-5317983 ACATATAGGCAGGTAGAGGTGGG + Intronic
1003514390 6:6805989-6806011 ACAGGGAGACACATGGAGGATGG + Intergenic
1003563665 6:7204302-7204324 ACAGAGAGGGAGGGGGCGGGGGG - Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1003963130 6:11227951-11227973 ACAGAGAGGCAGATGAATGGGGG + Intronic
1004590509 6:17047040-17047062 ACAGGTAGGCAGGTGGGTGACGG + Intergenic
1004700845 6:18078109-18078131 AAAATGAGGCTGGTGGAGGATGG + Intergenic
1004982583 6:21042626-21042648 ACAGTGGGGCAGGTAGGGGAAGG - Intronic
1005556682 6:26992232-26992254 ACAGAGAGCCATGTGGAGTCTGG - Intergenic
1005804567 6:29462248-29462270 ACAGAAGGGCAAGTGGAGGGTGG - Exonic
1005958574 6:30681169-30681191 CCAGAGAGGCAAGGGGAGGGTGG - Intronic
1006078140 6:31547551-31547573 GCAGAGACGCAGGTGGAGGACGG - Intronic
1006399839 6:33810930-33810952 TGTGAGAGGCTGGTGGAGGAGGG + Intergenic
1006443597 6:34066979-34067001 GCATGGAGGAAGGTGGAGGAAGG - Intronic
1006489951 6:34378754-34378776 GAAGAGAGCTAGGTGGAGGATGG + Intronic
1006648954 6:35535337-35535359 ACTGAGAGGCTGGGGTAGGAAGG - Intergenic
1006674122 6:35749863-35749885 ACAGAGACCCAGGTTGAGGGAGG + Intergenic
1006905095 6:37528000-37528022 ACTGAGAGCCAGCTGGAGTATGG - Intergenic
1006911670 6:37567185-37567207 ACAGAGAGGCCACTGGGGGATGG + Intergenic
1007186053 6:39973123-39973145 ACAGTGAGTCAGATGGGGGAAGG - Intergenic
1007271416 6:40640415-40640437 GGAGAGAGGGAGGTGGAGGTGGG - Intergenic
1007294966 6:40814649-40814671 AGAGAGAGGAAGTTGGAGGGTGG - Intergenic
1007450747 6:41939351-41939373 CCACAGAGCAAGGTGGAGGAAGG + Intronic
1007693377 6:43716970-43716992 ACAGGGAGGCATATGGAGGAGGG + Intergenic
1007736254 6:43984099-43984121 ACAGAGAGACAGAGGGAAGAAGG - Intergenic
1007768525 6:44176038-44176060 ACAGAGAGGGAGGGAGAGCATGG - Intronic
1007797344 6:44360583-44360605 GCACAGAAGCATGTGGAGGAGGG - Intronic
1007824755 6:44592121-44592143 AAAGAGAGGCAGGAGAAGGCAGG + Intergenic
1007839630 6:44705086-44705108 ACTGAGAGGCAGATGGAAGGTGG - Intergenic
1008052345 6:46913137-46913159 CCAGAGAGGCAGGAACAGGAGGG + Intronic
1008333531 6:50272085-50272107 GCAGAGAGACAGGTAGAGGTGGG - Intergenic
1008379042 6:50822198-50822220 ACAGAGAGACAGTGAGAGGAGGG - Intronic
1009031015 6:58058119-58058141 AAAGAGAAGGAGGTGGGGGAAGG + Intergenic
1009704031 6:67221447-67221469 AAAGAGAGGCAGATAGAGTAAGG + Intergenic
1010203865 6:73306348-73306370 ACGGAGAGGCTGGGGGAAGAGGG - Intronic
1011169981 6:84494809-84494831 ACAGAGATTAAGGTGGAGTAGGG - Intergenic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013999883 6:116352909-116352931 AGAGAGAGGAAGGAGGAGGGGGG - Intronic
1014225432 6:118841354-118841376 AGAGAGAGGCAGGGAGAAGAGGG - Intronic
1014522165 6:122457891-122457913 AGAGAGAGTCAGGTTGTGGAAGG - Intronic
1014982011 6:127955759-127955781 ACAGAGAGCCAAGTAGAGAAGGG + Intergenic
1015592357 6:134834050-134834072 ACAGAGAGAAAGGGGGAGGGAGG + Intergenic
1015793979 6:136992304-136992326 ATAGAGAGGCAGGAGGAGCCTGG - Intergenic
1016992129 6:149937835-149937857 AGAGAGAGGCAGGTGCAAGGGGG - Intergenic
1016994686 6:149953775-149953797 AGAGAGAGGCAGGTGCAAGGGGG - Intergenic
1017003922 6:150015660-150015682 AGAGAGAGGCAGGTGCAAGGGGG + Intergenic
1017385385 6:153876709-153876731 AGAGAGAGAGAGATGGAGGAAGG + Intergenic
1017445812 6:154506297-154506319 AAAGAGAGGAAAGGGGAGGAAGG + Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018335566 6:162785205-162785227 AGAGAAAGGCAGGTGCATGAGGG + Intronic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018973016 6:168541584-168541606 ACAGGAAGGCAGGGGCAGGAAGG + Intronic
1019047960 6:169162604-169162626 ACAGTGAGGGAGGGGGCGGATGG - Intergenic
1019158221 6:170052827-170052849 AGAGAGAGGGAGGGGGAGGGAGG - Intergenic
1019288163 7:234066-234088 CCAGAAAGGCAGGGGCAGGAAGG - Intronic
1019320830 7:414538-414560 ACGGAGAGGACGGGGGAGGAAGG - Intergenic
1019434688 7:1015864-1015886 ACAGAGGGGCCCCTGGAGGAAGG - Intronic
1019609379 7:1929234-1929256 GGAGGGAGGCAGGGGGAGGATGG - Intronic
1019736245 7:2651096-2651118 GCACAGAGGCAGGTGGACGTGGG + Intronic
1020109575 7:5440388-5440410 ACAGATAGGGAGGTGTCGGAGGG + Intronic
1021058665 7:16082311-16082333 ACTGATAGGCAGGTGGAGACAGG + Intergenic
1021612591 7:22472770-22472792 ACAGGGAAGGAGGGGGAGGATGG - Intronic
1021883621 7:25116986-25117008 ACTGAGAGGCTGGCCGAGGAAGG + Intergenic
1021900372 7:25279298-25279320 ACAAAAAGGCAGGCAGAGGAAGG + Intergenic
1022195180 7:28058381-28058403 AAATAGAGGCAGGTGCAGGCAGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022297144 7:29066863-29066885 ACAGAGAGGCAGATTGAGCCAGG + Intronic
1022444420 7:30457984-30458006 GCAGAGGGGCAGGAGGAAGAGGG + Intronic
1023155330 7:37245547-37245569 AAAGAAAGGCAGGTAAAGGAGGG - Intronic
1023201966 7:37707781-37707803 ACACAGAGGAAGATGGAGGTTGG + Intronic
1023533412 7:41183037-41183059 AGAGAGAGGGAGGGAGAGGAGGG - Intergenic
1024215295 7:47243382-47243404 AGAGAGAGGAGGGTGGTGGAAGG - Intergenic
1024361166 7:48470022-48470044 GCAGAGAGGCTGCTGGAGGAGGG - Intronic
1024396015 7:48867668-48867690 ACTTGGAGGCTGGTGGAGGATGG - Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1024803342 7:53107051-53107073 ACAGAGAGAAAAGTGGAGGATGG + Intergenic
1024961435 7:54980922-54980944 AGAGAGAGGCATAAGGAGGAAGG + Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1025639308 7:63352584-63352606 AGAGAGTGGGAGGTGGATGAGGG - Intergenic
1025643391 7:63395508-63395530 AGAGAGTGGGAGGTGGATGAGGG + Intergenic
1026284981 7:68955085-68955107 AGAGAGAGGGAGGGGGAGAAGGG + Intergenic
1026494129 7:70888101-70888123 AGAGAGAGGAAGGGGAAGGAAGG + Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1027416085 7:77976182-77976204 ACAAAGAGGCAGGGGCAGGAGGG + Intergenic
1027780777 7:82517317-82517339 AAAGAGAGGAAGGTGGAGGAAGG + Intergenic
1028061235 7:86319308-86319330 AGAGAGAGGGAGGGGGAAGAAGG + Intergenic
1029569851 7:101362370-101362392 ACAGCGGGGCAGGTGGGGGCTGG + Intergenic
1029609711 7:101620343-101620365 ACAAAGAGGCAGGTGGAGGGAGG + Intronic
1030228935 7:107184937-107184959 GAAGACAGCCAGGTGGAGGAGGG - Intronic
1030509918 7:110471390-110471412 AGAGAGAGAGAGATGGAGGATGG + Intergenic
1030836904 7:114298898-114298920 AAATAGAGGCACGTGGAGTAAGG + Intronic
1031370562 7:120960012-120960034 AAAGAGAGGAAGGGGGAGAAAGG + Intronic
1031806683 7:126316166-126316188 ACATGGTGGCAGGAGGAGGAGGG + Intergenic
1031991439 7:128201578-128201600 ACAGAGAAGCCGGCGGAGGAAGG - Intergenic
1032422479 7:131793768-131793790 AAAGAGAAGCAGGGGAAGGAAGG - Intergenic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032516758 7:132512153-132512175 CCAGACAGGCAGGTGCAGGTCGG + Intronic
1033023781 7:137753530-137753552 ACAGAGTGGGAGCAGGAGGAGGG + Intronic
1033329200 7:140404113-140404135 GCAGCGAGGCAGGAGGAAGAAGG + Exonic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1033596410 7:142862752-142862774 ACAGGGTGGCTGTTGGAGGAAGG + Exonic
1033596881 7:142865118-142865140 ACAGGGACGCAGGTAGAGGAAGG + Intronic
1033673033 7:143511392-143511414 GCAGAAAGGCAGGTGGAAGATGG + Intergenic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034142734 7:148837345-148837367 ACAGCGAGGAAGGTGCAGGAAGG + Intronic
1034222440 7:149456911-149456933 ACATCGAGGCAGGTGAAGGCAGG + Intronic
1034338907 7:150340211-150340233 ACAGACAGGCAGGCAGAGGATGG + Intronic
1034866892 7:154649658-154649680 AGAGAAAGGCAGGTGCAGGCTGG - Intronic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035070419 7:156140578-156140600 AGAAAGAGGCAGGTGGGGGGTGG + Intergenic
1035117816 7:156539676-156539698 AGAGAGAAGCAGGGGGAGGGAGG - Intergenic
1035280775 7:157776686-157776708 AGAGGGAGGCAGGAGGAGGGAGG - Intronic
1035362574 7:158323051-158323073 ACAGACAGGCTTGTGGGGGAGGG + Intronic
1035775758 8:2186835-2186857 ACAAAGAGACAGGGAGAGGAAGG + Intergenic
1036541399 8:9715633-9715655 ACCCAGAGCAAGGTGGAGGATGG + Intronic
1036549918 8:9806750-9806772 ACAGAAAGGCAAGTGGGGAAAGG - Intergenic
1036678945 8:10856664-10856686 AGAGAGGTGGAGGTGGAGGAGGG + Intergenic
1036785324 8:11681571-11681593 ACAGCGAGTGGGGTGGAGGAGGG - Intronic
1036903874 8:12691570-12691592 ACAAAGAGGCAAGGGAAGGAGGG - Intergenic
1037323941 8:17670063-17670085 ACTGACATGCACGTGGAGGATGG + Intronic
1037841638 8:22249253-22249275 ACAGAGGTGCAGGGCGAGGACGG + Exonic
1037878459 8:22561074-22561096 ACAGGGAGGGAGGAGCAGGAGGG + Intronic
1037898398 8:22673551-22673573 AGAGAGAAGGAGGGGGAGGAGGG - Intergenic
1037899616 8:22680050-22680072 AGAGAGGGGAAGGTGGAGGTTGG + Intergenic
1038124743 8:24660479-24660501 AGAGAGAGAGAGGGGGAGGAGGG - Intergenic
1038271805 8:26081585-26081607 ACAGAGAAGCAGGTGGAATCCGG - Intergenic
1038541030 8:28390208-28390230 GCAGAGGGGCAGGTAGAGGCTGG - Intronic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1041016318 8:53595622-53595644 ACATAGAGGCAGTTGAAGAAAGG - Intergenic
1041182841 8:55266348-55266370 AGACAGAGACAGCTGGAGGATGG - Intronic
1041256446 8:55983237-55983259 AGAGAGAGGCAAGTAGGGGAAGG - Intronic
1041262783 8:56036299-56036321 ACAGAGCAAAAGGTGGAGGAAGG + Intergenic
1041405958 8:57499633-57499655 ACAGAGATGCAGTTGGAATATGG + Intergenic
1041768917 8:61451771-61451793 ACAGAGGGGAAGGTGAGGGAAGG - Intronic
1042791209 8:72608279-72608301 GCAGAGAGGCAGGCAGAGGCTGG + Intronic
1042865938 8:73356775-73356797 ACACAGAGGAAGGAGGAGGCCGG - Intergenic
1042868970 8:73380385-73380407 AGAGCCAGGCAGGTGGAGCAGGG - Intergenic
1043313017 8:78886101-78886123 AGAGAGAGGGAGTTGGGGGATGG - Intergenic
1043551377 8:81376840-81376862 TCAGAGAAGAAGGTGGAGGATGG + Intergenic
1045057878 8:98384955-98384977 AAAGAAAGGAATGTGGAGGAGGG - Intergenic
1045430974 8:102114787-102114809 GCACAGAGCCAGGTGGAGAAGGG + Intronic
1045491297 8:102671323-102671345 ACAGAGAAGGGAGTGGAGGAGGG - Intergenic
1046778002 8:118184372-118184394 ACAGTGATGGAGGTGGAGGCAGG - Intergenic
1047325870 8:123835306-123835328 ACACTGAGACAGGTGGAGAAGGG - Intergenic
1047489582 8:125363559-125363581 AGAGGGAGGGAGGGGGAGGAGGG + Intronic
1047661194 8:127038812-127038834 TCAGAAAGGCAGCTGGAGGTGGG + Intergenic
1048048562 8:130796050-130796072 ACAGGGAGGCAGAGGGAGGGAGG - Intronic
1048210644 8:132451625-132451647 ACAGAAATGTAGGTGCAGGAAGG + Intronic
1048431791 8:134377601-134377623 ACAGGGATGCAGGTGGTAGAGGG - Intergenic
1048496791 8:134942245-134942267 ACAGAGAGGCAAGAAGAGCATGG + Intergenic
1048845083 8:138598235-138598257 AGAGAGACGCAGGGGGACGAAGG + Intronic
1049091990 8:140522697-140522719 AGAGAGAGGGAGGGGGAGGGGGG + Intergenic
1049143912 8:140983645-140983667 AGAGAGAGGGAAGTGAAGGAAGG + Intronic
1049249634 8:141581289-141581311 AGAGAGAGACAGGTGGAGACTGG + Intergenic
1049286921 8:141780846-141780868 CCAGAGAGGCAGGTGAAGTACGG + Intergenic
1049350724 8:142163161-142163183 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350754 8:142163332-142163354 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350784 8:142163468-142163490 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350828 8:142163722-142163744 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350857 8:142163893-142163915 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350898 8:142164081-142164103 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049350914 8:142164170-142164192 AGAGAGATGAAGATGGAGGATGG + Intergenic
1049350932 8:142164257-142164279 AGAGAGATGGAGATGGAGGATGG + Intergenic
1049361124 8:142213006-142213028 AGAGAGAGGGAGGAGGAGGGAGG - Intronic
1049442422 8:142615416-142615438 ACAGGGAGGGAGGTGGAAGGAGG + Intergenic
1049514394 8:143045703-143045725 AGAGAGAGGAAGGTGGGGCAGGG + Intronic
1049647973 8:143744992-143745014 ACAGAGAGGCTTTTCGAGGACGG - Intergenic
1050365634 9:4871019-4871041 ACAGAGAAGCAGGTCAAGCAGGG - Intronic
1050475925 9:6041031-6041053 AGAAAGAGGAAGGAGGAGGAAGG - Intergenic
1051020460 9:12536149-12536171 ACAGAGAAAGAGGTGGAGTAAGG + Intergenic
1052375440 9:27713419-27713441 ATGGAGAGGCAGGTGGTGAAGGG + Intergenic
1052381110 9:27772015-27772037 CCATAGAGACAGCTGGAGGATGG - Intergenic
1053302421 9:36961379-36961401 ACAGAGAGACAGCTGGGGAAGGG - Intronic
1053474496 9:38372344-38372366 ACAGAGAGGCAGGGTGGGCACGG + Intergenic
1053526937 9:38839936-38839958 ACAGTGAGGCCGGTGGAGCTTGG + Intergenic
1054199164 9:62064367-62064389 ACAGTGAGGCCGGTGGAGCTTGG + Intergenic
1054639192 9:67523990-67524012 ACAGTGAGGCCGGTGGAGCTTGG - Intergenic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055490904 9:76804581-76804603 ACAGAGAACAGGGTGGAGGAAGG - Intronic
1055533312 9:77210146-77210168 AGAGAGAGGGAGGTGGGGGGAGG - Intronic
1055641075 9:78319477-78319499 ACAGAGAAGCAAGTGCAGGCTGG + Intronic
1055698047 9:78909848-78909870 ACAGAGAGAGAGATGGAAGAGGG + Intergenic
1055740603 9:79384066-79384088 ACATAGAGGAAGGTAGAGGATGG - Intergenic
1057134499 9:92677919-92677941 AAAGAGAGGCAGGTGGAGGGTGG - Intergenic
1057270007 9:93645320-93645342 ACAGAGAGGCAGGAGGCGCCTGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1057469247 9:95342936-95342958 ACAGAGAGCAAGGGGGATGAAGG + Intergenic
1057498147 9:95576169-95576191 ACAGAGAGGGAAGGGGATGATGG - Intergenic
1057810528 9:98253705-98253727 CCAGAAAGGCATCTGGAGGAGGG - Intronic
1057888864 9:98852915-98852937 CCAGGGAGGCAGGTGGGGGCAGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058560134 9:106219383-106219405 GCAGAAAGGAAGGAGGAGGAAGG - Intergenic
1058959264 9:109977757-109977779 AGAGAGAGGCAGGGGGTGAAGGG - Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1059259265 9:112960156-112960178 ACAGAGATGCTGCTGGAGGTGGG - Intergenic
1059396249 9:114035776-114035798 ACAGAGAAGCAGGAGGAAGTGGG - Intronic
1059634160 9:116155311-116155333 AGAGAGAGGGAGGTTGAGGAGGG - Intronic
1059998764 9:119939458-119939480 TCAGAAAGGCAGCTGGAAGATGG + Intergenic
1060010843 9:120041665-120041687 AGAGTGTGGCAGGGGGAGGAGGG - Intergenic
1060103955 9:120862137-120862159 ACAGGGAGGCCTGGGGAGGAGGG + Intronic
1060224785 9:121784144-121784166 AGACAGATGCTGGTGGAGGAAGG + Exonic
1060541463 9:124433350-124433372 AAAGAGAGAGAGATGGAGGAAGG + Intergenic
1060794888 9:126506794-126506816 TCAGAGTGGCAGGAGGAGGCCGG - Exonic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060971276 9:127739618-127739640 GCAGTGAGGCAGGTGGAGGGAGG + Intronic
1061044970 9:128160111-128160133 ACTGTGAGGGAGGTGGAGGCGGG + Intergenic
1061255855 9:129453955-129453977 ACAGACAGGCAGTTGATGGATGG + Intergenic
1061678119 9:132229658-132229680 CCAGACATGGAGGTGGAGGAAGG + Intronic
1062050525 9:134444451-134444473 AGAGGGAGGCAGGGGAAGGAAGG - Intergenic
1062054577 9:134464175-134464197 ACAGTGGGGGAGATGGAGGATGG + Intergenic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062158177 9:135065654-135065676 AGAGAGAGGCAGGGTAAGGAAGG - Intergenic
1062324606 9:136006050-136006072 ACAGAGAGACAAGTGCAGGTGGG - Intergenic
1062627547 9:137450077-137450099 ACAGAGCGGACCGTGGAGGAGGG + Intronic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1203542892 Un_KI270743v1:106750-106772 AGAGAGAGGCAGGTGCATGCTGG - Intergenic
1185648013 X:1628791-1628813 GGAGAGAGGCAGGTGAAGGGAGG - Intronic
1185695773 X:2193316-2193338 ACAGAGAGATGGGTGAAGGAAGG - Intergenic
1186672517 X:11781663-11781685 GAAGAGAGGGAGGAGGAGGATGG + Intergenic
1187205269 X:17175863-17175885 TCAGAAAGGCAGGTGGGGGAAGG + Intergenic
1187239319 X:17498350-17498372 AGATAGAGGCAGGTGTGGGAAGG - Intronic
1187466825 X:19534829-19534851 AGAGGAAGGCAGGGGGAGGAAGG + Exonic
1187676992 X:21726146-21726168 CCAGAGCTGCAAGTGGAGGACGG + Intronic
1188019804 X:25144736-25144758 ACAGCGAGACAGGAGGAGGGTGG + Intergenic
1188480452 X:30631832-30631854 GGAGAGAGGAATGTGGAGGAAGG - Intergenic
1188819503 X:34756920-34756942 ACAGAGAGGAAGGTAAATGACGG - Intergenic
1189264062 X:39700105-39700127 ACAGAGGGGCAGGGACAGGAAGG + Intergenic
1189289103 X:39872781-39872803 AGAGAGAGGTGGGTGGGGGAAGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189655054 X:43236256-43236278 TGAAAGAGGCAGTTGGAGGAAGG - Intergenic
1190220790 X:48511221-48511243 AAAGAGAGGGAGTGGGAGGAAGG - Intronic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190456675 X:50634405-50634427 GCACAGAGGCAGGTGAAGAAGGG - Exonic
1190509657 X:51162584-51162606 GCAGGGAGGAAGGAGGAGGATGG - Intergenic
1190953006 X:55164173-55164195 AGAGAGAGAGAGTTGGAGGAGGG + Intronic
1191641784 X:63434341-63434363 ACAGAGAGGAAAGAGGGGGAAGG + Intergenic
1192201884 X:69071453-69071475 GCAAGGAGGCTGGTGGAGGAAGG - Intergenic
1192287782 X:69756522-69756544 ACAGGGAAGCAGATGGATGAGGG - Intronic
1192353157 X:70373289-70373311 ACAGAGAAGGAGGGGGAGAACGG + Intronic
1193938741 X:87654289-87654311 ATAGTGAGGCAGGTGGAGGGTGG - Intronic
1194827136 X:98577491-98577513 ACAAAGAGACAGGAGGAGGCAGG - Intergenic
1195056286 X:101148618-101148640 ATATGCAGGCAGGTGGAGGAGGG + Intronic
1195680595 X:107543280-107543302 TCAGAGAGGCAGCTGGGGGCTGG - Intronic
1195785087 X:108510637-108510659 ACAGAGAGAAAAGGGGAGGAAGG + Intronic
1196828239 X:119757857-119757879 ACAGAGAGGGCGGTGCAGAAGGG + Intergenic
1196944676 X:120811940-120811962 GCAGTGAGGCTGGGGGAGGAAGG + Intergenic
1196965182 X:121047666-121047688 ACATCGCGGCAGGCGGAGGAGGG - Exonic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198481912 X:137049326-137049348 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1198506983 X:137310671-137310693 AGAGAGAGGCAGGGGGAGATTGG + Intergenic
1199480326 X:148291454-148291476 TTGGAGAGGCAGGTGTAGGAAGG - Intergenic
1199511671 X:148629866-148629888 ACAGAGAAGAAGGTGTATGATGG - Intronic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199557021 X:149120617-149120639 ACAGACAGGGACCTGGAGGAAGG - Intergenic
1199671990 X:150155353-150155375 AAGAAGAGGCAGGTGGAGAAGGG - Intergenic
1200267943 X:154655890-154655912 ACAGAGGCGCAGGAGGAGGCCGG - Intergenic
1201060140 Y:10037444-10037466 ACAGAGAGGGAGGACCAGGAAGG + Intergenic
1201146486 Y:11067739-11067761 AGAGAGAGGAAGGGAGAGGAAGG + Intergenic
1201755883 Y:17484826-17484848 ATAGAGAGGCAAGTGCAGCAAGG - Intergenic
1201845669 Y:18421159-18421181 ATAGAGAGGCAAGTGCAGCAAGG + Intergenic