ID: 1118737362

View in Genome Browser
Species Human (GRCh38)
Location 14:68711621-68711643
Sequence CAGGGCAAGCAGATGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 648}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118737362_1118737374 13 Left 1118737362 14:68711621-68711643 CCTTCCCCCATCTGCTTGCCCTG 0: 1
1: 0
2: 1
3: 54
4: 648
Right 1118737374 14:68711657-68711679 AACACAGGTAAAAAGTGGAGAGG 0: 1
1: 1
2: 1
3: 32
4: 324
1118737362_1118737373 8 Left 1118737362 14:68711621-68711643 CCTTCCCCCATCTGCTTGCCCTG 0: 1
1: 0
2: 1
3: 54
4: 648
Right 1118737373 14:68711652-68711674 ACTGAAACACAGGTAAAAAGTGG 0: 1
1: 0
2: 1
3: 32
4: 371
1118737362_1118737371 -2 Left 1118737362 14:68711621-68711643 CCTTCCCCCATCTGCTTGCCCTG 0: 1
1: 0
2: 1
3: 54
4: 648
Right 1118737371 14:68711642-68711664 TGCCTGGGATACTGAAACACAGG 0: 1
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118737362 Original CRISPR CAGGGCAAGCAGATGGGGGA AGG (reversed) Intronic
900148397 1:1168025-1168047 CGGGGCCAGCAGACGGGTGAGGG + Intergenic
900148409 1:1168060-1168082 CGGGGCCAGCAGACGGGTGAGGG + Intergenic
900148421 1:1168095-1168117 CGGGGCCAGCAGACGGGTGAGGG + Intergenic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900351701 1:2238115-2238137 CAGGGCCAGCTGGTGAGGGAGGG - Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
900710417 1:4109785-4109807 CAGGGCGAGCGGATGGCGGGGGG - Intergenic
901149578 1:7092309-7092331 CAGGTCAAGCTGATGGGCCACGG - Intronic
901157524 1:7150399-7150421 GGGGGCAAGCAGATGGGGAGGGG + Intronic
901238775 1:7681051-7681073 CCGGGCGTGGAGATGGGGGAAGG + Intronic
901370032 1:8789200-8789222 TTGGGGAAGCCGATGGGGGAGGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902211857 1:14910317-14910339 TAGGGCACCCACATGGGGGAAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903260754 1:22130506-22130528 CTGGGCAAGCCCCTGGGGGAGGG - Intronic
903474063 1:23607381-23607403 CAGGGCTGGGAGGTGGGGGAAGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903684372 1:25120164-25120186 CAGGGCCAGGAGATCAGGGAGGG - Intergenic
903967448 1:27099613-27099635 CAGGGGAAGCTGCTAGGGGAAGG - Exonic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904263940 1:29306998-29307020 CAGGGCAGGCAGAGCGGAGACGG - Intronic
904443089 1:30544781-30544803 CAGGGCCACCAGATGTGGGCTGG - Intergenic
904873618 1:33636773-33636795 CAAGGCAAGAACATGGGGGGAGG - Intronic
905841202 1:41180362-41180384 CAGGGCAATCAGACAGGAGAAGG + Intronic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
905913054 1:41666974-41666996 CTGGCCAAGCAGATGGGTGAGGG - Intronic
906140453 1:43531135-43531157 GAGGGCAAGGAGAGCGGGGAAGG - Intronic
907184030 1:52595330-52595352 CAGGGGGAGCAGATGAGGAATGG + Intergenic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907501499 1:54884910-54884932 CAGGGCCAACAGATGGCAGAGGG + Intronic
907646089 1:56244994-56245016 CAGGGCAATCAGGCGGGAGAGGG - Intergenic
907986547 1:59536994-59537016 CAGGGCAATCAGGTAGGAGAAGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
909676629 1:78245543-78245565 CAGGGCAATCAGACAGGAGAAGG - Intergenic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
910625658 1:89303597-89303619 CAGTGCTAGCAGGTGGGAGATGG + Intergenic
910843474 1:91583786-91583808 CAAGGCCAGAGGATGGGGGAAGG - Intergenic
911430262 1:97776021-97776043 GAGGGAAAGCAGGTGGGGAAAGG + Intronic
911715443 1:101127420-101127442 CAGGGCCAGAAAATGGGGGGGGG + Intergenic
912094484 1:106121340-106121362 CAGGACAACCAGCTGTGGGAAGG + Intergenic
914826913 1:151143562-151143584 CAGAGGCAGCAGATGAGGGAAGG - Intronic
915798564 1:158763661-158763683 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
916853019 1:168723275-168723297 CATGGCTAGCAGATGGCAGACGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920369227 1:205467282-205467304 AAGGTCAAACAGATGTGGGAGGG + Intergenic
920386711 1:205575066-205575088 CAGGCCAGGCTGATGGGGAAGGG - Intronic
920724307 1:208419508-208419530 TTGGGGAAGCAGATGGGGGTGGG - Intergenic
922209753 1:223478390-223478412 CAGGTCAATGAGGTGGGGGATGG - Intergenic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
923261504 1:232272335-232272357 CAGGCCAAGCAGGTGGGGCAGGG - Intergenic
923688668 1:236172486-236172508 CTGAGCTAGCAGATGTGGGAGGG - Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1063662436 10:8043705-8043727 CAGGGCAGGAAGGTGGAGGAGGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1065320242 10:24502586-24502608 CAGGGCAGGGAGGTGGGAGAAGG - Intronic
1065818998 10:29507871-29507893 CCGGGCAGGGACATGGGGGAGGG + Intronic
1066243644 10:33561504-33561526 GTGGGCACTCAGATGGGGGAAGG + Intergenic
1066246542 10:33589060-33589082 CAGGGCCTGGAGCTGGGGGAAGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067081919 10:43216964-43216986 CAGGGTCAGAAGATGGGGAAGGG - Intronic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1067260545 10:44686334-44686356 CATGGCAACCATATGGGGGAGGG + Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067440431 10:46306314-46306336 CAAGGAAAGCAGGTGGGGGCAGG - Intronic
1067759442 10:49032651-49032673 GAGGCCAGGCAGATGGGGGTGGG - Intronic
1068147599 10:53090969-53090991 TAGTGCAAGCTGATGGGGGTGGG - Intergenic
1068987479 10:63120673-63120695 CAGGGCCAGCAGATGGGAGGAGG + Intergenic
1069894390 10:71671601-71671623 CATGACAAGCAGATTGGGGCTGG + Intronic
1070306095 10:75240022-75240044 CAGGGCAAGGTGATAGGGGGTGG + Intergenic
1070397644 10:76025349-76025371 CAGGACAAGCATAGGAGGGATGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071074966 10:81739049-81739071 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
1071494878 10:86161376-86161398 CAGGACAGGCAGCTGCGGGAAGG + Intronic
1072190738 10:93074521-93074543 CAGCGCAAGAAGGTGGGGGCAGG + Exonic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074198126 10:111207280-111207302 CAGTGCTAGCAGCTGGGTGAAGG - Intergenic
1074365806 10:112856487-112856509 CGGGGCAGGCAGATGGGTGGGGG + Intergenic
1074666482 10:115731823-115731845 CAGGGCTAGGAGATGGGTGTGGG - Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074808730 10:117081028-117081050 CAGGGCAATTAGGTGGGAGAAGG - Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076791626 10:132779719-132779741 CAGGACAAGCAGACGGGCGCCGG + Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077343367 11:2035796-2035818 CAGGCCAGGCTGATGGGGGTTGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079641908 11:22816183-22816205 GGGGGCAGGGAGATGGGGGAGGG - Intronic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1080746324 11:35111617-35111639 CAGTGCCAGCCCATGGGGGAAGG - Intergenic
1081206747 11:40284280-40284302 CATGGCAGGCAGATGGGAGAGGG + Intronic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081588304 11:44402848-44402870 GAGGCCAAGTAGATGGGGGTGGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1081911929 11:46705295-46705317 CAGTTCAGGCAGCTGGGGGAAGG - Exonic
1082140193 11:48599949-48599971 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1084008743 11:66336280-66336302 CAGGGCAGCCAGGTGGGGCAGGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084593950 11:70106152-70106174 CAGGGCAGGCAGGTGTGGGCAGG + Intronic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085147188 11:74212135-74212157 CACTGCCAGCAGATGGGGAAGGG - Intronic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086339123 11:85829232-85829254 CAGGACTACCAGATGAGGGAGGG - Intergenic
1087499690 11:98933963-98933985 CAGGGCAAGAACATGGAGAAAGG + Intergenic
1087695940 11:101376098-101376120 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1089286149 11:117409387-117409409 CAGGGCAAGGTGCTGGGTGAAGG - Intronic
1089346900 11:117796715-117796737 GAGGGCAAGGGGCTGGGGGAGGG + Intronic
1089561216 11:119344180-119344202 GAGATCAAGCAGACGGGGGATGG - Intronic
1089634838 11:119805431-119805453 CAGGGACAGTTGATGGGGGAAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090256904 11:125290945-125290967 CAGGAGAAGCTGATGGGAGAAGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090927142 11:131259154-131259176 CAGGGCATGGAAATGAGGGATGG + Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091051106 11:132373553-132373575 CACTGCCAGGAGATGGGGGAGGG - Intergenic
1202826353 11_KI270721v1_random:90985-91007 CAGGCCAGGCTGATGGGGGTTGG - Intergenic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092045576 12:5430229-5430251 CAGGGCGAGAAGCTGGAGGAGGG + Intergenic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1093108409 12:15118135-15118157 CAAGGGAAGGAAATGGGGGAGGG - Intronic
1093330021 12:17824769-17824791 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
1093639622 12:21511298-21511320 TAGGGCAAGGAAAGGGGGGAGGG + Intronic
1094728119 12:33143758-33143780 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096407416 12:51354101-51354123 TAGGGAAGGCAGCTGGGGGAGGG - Exonic
1096807209 12:54148234-54148256 CAGGGCAGGAAGATGGCTGAAGG + Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097963042 12:65551408-65551430 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100785075 12:98070227-98070249 CAGGACCAGAAGATGAGGGAAGG - Intergenic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102225827 12:111227673-111227695 CAGGGCAGCCAGCTGGGGGCAGG + Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1103197547 12:119058031-119058053 CTGGGAAAGAAGATGGGGAAGGG + Intronic
1103409956 12:120703816-120703838 CAGGGCAGGCGCATGGGGCAGGG - Intergenic
1103725592 12:122996014-122996036 CAGGGCAGGTACATGGGGGCAGG - Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106466233 13:30016813-30016835 GAGGCAAAGGAGATGGGGGAGGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108530155 13:51320944-51320966 CAGGGACAGCACATGGGGGAAGG - Intergenic
1108623065 13:52202841-52202863 GATGGCAAGGAGATGGGGGAAGG - Intergenic
1108663660 13:52608201-52608223 GATGGCAAGGAGGTGGGGGAAGG + Intergenic
1110276214 13:73644532-73644554 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1111331260 13:86763481-86763503 CAGGCCAAGGAGCTGCGGGAGGG + Intergenic
1111337404 13:86840910-86840932 CAGGGCCATCAGCTGGGAGAGGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114150383 14:20031883-20031905 AAATGCAAGCAGGTGGGGGATGG + Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114833593 14:26176072-26176094 CAAAGTAAGAAGATGGGGGAAGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115410895 14:33073429-33073451 CAGGGCAAGGAGATAGAGGGTGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1116716892 14:48439041-48439063 CAGGGCAATCAGACAGGAGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117651038 14:57905671-57905693 CAGCTCCAGCAGATGAGGGAGGG + Intronic
1117740684 14:58816352-58816374 CAGAGCAAGCAAATAGGGGAAGG - Intergenic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122436765 14:101706133-101706155 CAGGGAAAGCACGTGGGTGAAGG + Intergenic
1123830416 15:24130306-24130328 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123850671 15:24352912-24352934 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123860443 15:24460718-24460740 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1123864073 15:24499337-24499359 CAGGGCATGCAGAAGGGGTGTGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125458461 15:39885409-39885431 TAGAGCAAGGAGGTGGGGGATGG - Intronic
1125611873 15:40976958-40976980 CGTGGCAAGCTGCTGGGGGATGG - Intergenic
1125765428 15:42132268-42132290 CCAGGCCAGCAGATGAGGGAGGG + Intergenic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1128706097 15:69838398-69838420 CAGGGAAGGGAGCTGGGGGAGGG - Intergenic
1129199092 15:73988244-73988266 TGGGGCAGGCAGATGGGTGATGG - Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130706400 15:86236988-86237010 AAGGGCAAGAAGATGTGGGTGGG + Intronic
1130770609 15:86919939-86919961 AAGGGCAGGCTCATGGGGGAGGG + Intronic
1130915696 15:88302817-88302839 CAGGGGATGCAGTTTGGGGATGG + Intergenic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132281207 15:100617476-100617498 CAGAGCAAGGTGATGGGGCAGGG - Intronic
1132336264 15:101050434-101050456 TGGGGCAAGCAGCTGTGGGAGGG + Intronic
1132340914 15:101078170-101078192 CAGTGCAGGGAGATGGGGGTGGG - Intronic
1132626408 16:893735-893757 CAGGGAAAGCAGACGGGTGTGGG - Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1133650907 16:7813980-7814002 AAGGGCAAGAAGATGAGGGTGGG - Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135704445 16:24662670-24662692 CAGTGCAAGCAGGTGGTGAAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136381475 16:29898066-29898088 CAGGCCCAGCTGATGGAGGAGGG - Intronic
1137027216 16:35489035-35489057 CAGGCCATGCAGATCTGGGAGGG + Intergenic
1137766663 16:50982642-50982664 CAGGGCGAGAAGAAAGGGGAAGG + Intergenic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139053761 16:63156814-63156836 AAGGGCAAGCAGCTGGGTAATGG + Intergenic
1139467989 16:67164380-67164402 CAGGGCAAGCAGATAGGAAGGGG - Intronic
1139594418 16:67949761-67949783 CAGGGCAGGGGGATGGGGAAAGG - Intronic
1140462175 16:75148686-75148708 GAGGGGAAGGAGATGAGGGATGG + Intronic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1142562132 17:816476-816498 CGGACCAAGCAGATGGTGGAGGG - Intronic
1143520414 17:7441185-7441207 CAGCTCAACCAGAAGGGGGAAGG - Intronic
1143816771 17:9522772-9522794 AAGGGCAAGAGGTTGGGGGAAGG + Intronic
1143864851 17:9916475-9916497 CCGAGGAAGCAGCTGGGGGAAGG + Exonic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144730637 17:17523918-17523940 AGGGGCCGGCAGATGGGGGATGG - Intronic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1145053844 17:19685200-19685222 CAAGGCAGGCAGCTGGGAGATGG - Intronic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146559403 17:33855114-33855136 CAGGCCAAGTTGCTGGGGGAAGG + Intronic
1147384966 17:40075654-40075676 GAGGGGAAGGTGATGGGGGAGGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147855952 17:43480178-43480200 GAGGGCAGGCAGATTGGGGTTGG - Intergenic
1148351175 17:46943148-46943170 CAGGGGAAGTGCATGGGGGACGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148955015 17:51346318-51346340 TGGGGATAGCAGATGGGGGAGGG + Intergenic
1149046271 17:52249456-52249478 TAGGGCATGCAGTTGGGGGCTGG + Intergenic
1149502201 17:57162030-57162052 CAGGGCAATTAAATGGGGGCTGG - Intergenic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1150210163 17:63437473-63437495 CAGGCCCAGCAGCTGGGAGAAGG + Exonic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151472729 17:74327921-74327943 GAGGACAGGCAGATGGGGGTGGG + Intronic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151819833 17:76491419-76491441 CAGGGCAATCAGTTGGGGGGGGG + Intronic
1151898099 17:76993969-76993991 CAGGGCAAGGCCCTGGGGGAGGG - Intergenic
1152060967 17:78074929-78074951 CACGGCAAGGGGATGGGGGTTGG - Intronic
1152301040 17:79495476-79495498 AAAGGCAAGAAGGTGGGGGAGGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1152698456 17:81807557-81807579 AGGGGCAAGGAGATGGGCGAAGG - Intronic
1152794027 17:82298182-82298204 CAGGGCAAGCATCTGGGGTGGGG - Intergenic
1153101389 18:1474160-1474182 CAGGGCAGGCAGGTAGGGGAAGG - Intergenic
1153715216 18:7840095-7840117 GAGGGCAGGGTGATGGGGGAGGG + Intronic
1155574689 18:27231802-27231824 CAGGGGAGGCAGATGGGGTGGGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157489073 18:48109690-48109712 CAGGGCCTGCAGAGGAGGGAGGG + Intronic
1157570041 18:48706137-48706159 CAGGGCAAGGGGATGAGAGAGGG - Intronic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158153714 18:54401725-54401747 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158176776 18:54666183-54666205 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158682000 18:59576681-59576703 CAGAGCAAGTAGACGGGGCATGG - Intronic
1160382562 18:78471762-78471784 CAGGGCCAGGGCATGGGGGAGGG + Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160972248 19:1774809-1774831 CAGGGAAAGCAGATGCGGTGGGG - Intronic
1161703415 19:5806585-5806607 CAAGGCAAGAAGCTGGGGGTGGG - Intergenic
1161704896 19:5815047-5815069 GAGGGGAAGCAGATGGGGCCGGG - Intergenic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163424978 19:17236145-17236167 GAGGGACAGGAGATGGGGGAGGG + Intronic
1164390305 19:27814034-27814056 CATGGGAAGCTGTTGGGGGATGG - Intergenic
1165098516 19:33424155-33424177 CAGGGCCAGCTGCTTGGGGAGGG - Intronic
1165122589 19:33570223-33570245 CGGGGCTGGCAGGTGGGGGATGG - Intergenic
1165992722 19:39825656-39825678 CAGGGCCCCCAGATGGGGGAGGG + Exonic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166219509 19:41355428-41355450 CAGGGCAGGGACATGAGGGAAGG - Intronic
1166885884 19:45960819-45960841 CTGGCCGAGCAGATGGGGGTGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1168073522 19:53965765-53965787 GAGGACAAGGAGTTGGGGGAGGG + Intronic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168713039 19:58512574-58512596 CAGAGCAAGCACATGGGTGGGGG - Intergenic
925005651 2:441185-441207 CAGGGCAAGAAAACGGGAGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925269293 2:2590978-2591000 CACTGCCAGGAGATGGGGGAGGG - Intergenic
925304744 2:2840156-2840178 CAGGCCAAGCAGAGTGGGCAGGG + Intergenic
926228179 2:10983247-10983269 CAGGGCAGGGAGGTGGGAGAGGG - Intergenic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929480001 2:42296595-42296617 CAGGGAAAGCTTATTGGGGAAGG - Intronic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
930022100 2:47007750-47007772 CATGCCCAGCAGATGGGGGTAGG - Intronic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
930610460 2:53537265-53537287 CAGGGCAAGCTCATTGAGGAAGG + Intronic
932024168 2:68116745-68116767 CAGGGCAGGCAGCTGGGCCAGGG - Intergenic
932144160 2:69304436-69304458 GAGGGCAGGCAGTTGGGGAAGGG + Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932520599 2:72407862-72407884 CAGGGCAATCAGACAGGAGAAGG + Intronic
932528056 2:72494331-72494353 GAGGCCAGGCAGGTGGGGGATGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
933127038 2:78621676-78621698 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
933404770 2:81844055-81844077 CAGGGCAATCAGGTGAGAGAAGG + Intergenic
933767220 2:85718527-85718549 CAGGACAGGCAGCTGGGAGAGGG - Intergenic
933780849 2:85799854-85799876 CAGGGCAGGCAGGTGGGGCGGGG - Intergenic
934945621 2:98539279-98539301 AAGTGCAAGCAGCTGGGGGCAGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935505193 2:103891609-103891631 GAAGTCAAGCAGGTGGGGGAGGG + Intergenic
935601601 2:104927785-104927807 CAGGACAAGGAGTTAGGGGAGGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936692857 2:114913224-114913246 GAGTGCACGCCGATGGGGGAAGG - Intronic
936907717 2:117556363-117556385 GAGGGGATGCAGATGGGGGCAGG - Intergenic
937678096 2:124613941-124613963 CAGGGCTATCAGATGGGAGACGG + Intronic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938379427 2:130828276-130828298 CAGGCCAGGCAGTTGGGGAAGGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
939024194 2:136992486-136992508 CAGGAAAAGCCTATGGGGGATGG + Intronic
939177953 2:138772040-138772062 GAGGACAAGCAGGTGGGTGAGGG - Intronic
940497630 2:154453538-154453560 TAGGGAAGGCAGATGGGAGAAGG - Exonic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941159825 2:162023624-162023646 AAGGGCAGGCAGACTGGGGAAGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941623603 2:167806322-167806344 CAGGGCAATCAGACAGGAGAAGG - Intergenic
941788778 2:169527711-169527733 CATGGACAGCAGTTGGGGGATGG - Intergenic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943681615 2:190774242-190774264 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
943814807 2:192238979-192239001 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
944389564 2:199203521-199203543 CAGGGAAAGCAGTTGGGAGTGGG - Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946306054 2:218857656-218857678 CAGGGCTAGGGCATGGGGGAGGG + Intergenic
947383790 2:229570773-229570795 GAGGCAAAGCAGGTGGGGGAGGG + Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947859546 2:233348894-233348916 CAGGGCACGCAGACAAGGGATGG + Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
1168841930 20:915226-915248 CAGGCCATGCAGCTGGGGGGGGG - Intronic
1170940679 20:20845625-20845647 CAGGGAAAGGAGATGGGGAGAGG + Intergenic
1170953410 20:20956575-20956597 CAGGGAATGCAGACGTGGGAGGG + Intergenic
1171076627 20:22133322-22133344 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171772495 20:29334600-29334622 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172056866 20:32160122-32160144 CAGGGCCAGGAGGCGGGGGAGGG + Intronic
1172536164 20:35675005-35675027 CAGGGGAAGAAGTTGTGGGAGGG + Intronic
1172993199 20:39050761-39050783 CAGGAGAAGCAGATGGGCCATGG + Intergenic
1173150972 20:40566174-40566196 CAGAGCTGGCAGATGGGGAATGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174151993 20:48492516-48492538 CAGGGCAGGAAGATTGGGGGTGG + Intergenic
1174442338 20:50566165-50566187 TAGGGGAGGCTGATGGGGGAGGG + Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174724489 20:52846953-52846975 CAAGGCAGGCAGAACGGGGAAGG + Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175892505 20:62321773-62321795 AAGGGCCAGCAGATGGGGTGGGG + Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176309710 21:5143037-5143059 CATGGCAGACAGCTGGGGGAGGG + Intronic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1178372993 21:32042709-32042731 CAGGGCGGGCAGAAGGGGGTGGG + Intronic
1178395014 21:32235405-32235427 GAGGGCAACCAGATAGGGCAGGG - Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179189581 21:39112009-39112031 CCGGGAAGGCAGATGGGGTAGGG + Intergenic
1179452972 21:41478175-41478197 CAGGGCAAGCCCAGTGGGGAGGG - Intronic
1179847348 21:44118996-44119018 CATGGCAGACAGCTGGGGGAGGG - Intronic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180999735 22:19982419-19982441 CAGGCCATGCAGCTTGGGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181960164 22:26617045-26617067 CAGAGGAAGCAGACGGGGAAAGG - Intronic
1182251500 22:29004669-29004691 CAGGGGAAGCCACTGGGGGAGGG - Intronic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1182698200 22:32210304-32210326 CAGGTCAAGCCCATGGGAGAGGG + Intergenic
1182717106 22:32365919-32365941 CGGGGCTATCGGATGGGGGACGG + Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183063453 22:35348955-35348977 CAAGGAAAGCAGCTGGGGGCAGG + Intergenic
1183511690 22:38239164-38239186 AGGGGCAGGCAGATGGGGGCAGG - Intronic
1184053537 22:42027308-42027330 AAGGGCAATCTTATGGGGGAAGG + Exonic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184865656 22:47200613-47200635 TCGGGCCAGCAGATGTGGGACGG + Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
950100066 3:10351251-10351273 CAGGGCCAGCTGCTGGGGTAGGG - Intronic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951929310 3:27945722-27945744 CGGGGCAAGCAGGTGGGCTAAGG + Intergenic
953146003 3:40275493-40275515 CAGGGCAATCAGACAGGAGAAGG + Intergenic
954326756 3:49868270-49868292 AAAGGATAGCAGATGGGGGAGGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954987245 3:54806200-54806222 CAGGGCAATCAGGCGGGAGAAGG + Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956289690 3:67648402-67648424 AAGGGCAAAAAGATGGGGAAAGG + Intronic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
956926527 3:73994845-73994867 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958870946 3:99558322-99558344 CTGGGACAGTAGATGGGGGAAGG + Intergenic
959472837 3:106773730-106773752 CAGGGCAAGCAGAGGAGGTGGGG + Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960277958 3:115748529-115748551 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
960359911 3:116698529-116698551 CAGGGCAATCAGGTAGGAGAAGG + Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961345410 3:126260544-126260566 GAGGGGAAGAAGATGGGGGGAGG - Intergenic
961377649 3:126476996-126477018 GAGGGCAAACAGGTAGGGGAGGG - Intergenic
961641697 3:128368803-128368825 CGGTGCAGGCAGATGAGGGAAGG - Intronic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962667062 3:137664713-137664735 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962697920 3:137969271-137969293 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
963088041 3:141456333-141456355 CAAGGCAAGCAGAGGCGTGAGGG - Intergenic
963282109 3:143394599-143394621 CAGGGCAATCAGACAGGAGAAGG + Intronic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
964244373 3:154633601-154633623 CACGGCAAGGGGATGGGGGAGGG + Intergenic
964626134 3:158761935-158761957 CAAGGCAAGGAGGTGGGGAAGGG + Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966816926 3:183896990-183897012 CAGACCAAGCAGATGGGAGCAGG + Intergenic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
968270467 3:197399528-197399550 CAGGGGTAGCAGTTGGGGGTTGG - Intergenic
969122615 4:4921080-4921102 CAGGTGAAGAAGATGGGGAAAGG - Intergenic
969202707 4:5618416-5618438 TAGGGCCAGCAGCTGGGAGACGG + Intronic
969583682 4:8080033-8080055 CAGGGCCAGGAGCTGGGGGTCGG - Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
969869684 4:10096901-10096923 CAGCGCAAGCACAAGCGGGATGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970925303 4:21444773-21444795 CAGGGCAATCAGGTAGGAGAAGG + Intronic
971141409 4:23928973-23928995 CAGGGGATGCGGTTGGGGGAGGG + Intergenic
971477802 4:27088752-27088774 CATGGCAAGGTGTTGGGGGAGGG + Intergenic
973116426 4:46465786-46465808 CAGGGCAATCAGACAGGAGAAGG - Intronic
973824137 4:54688149-54688171 AATAGCATGCAGATGGGGGAGGG - Intronic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
976084114 4:81389608-81389630 GAGGGCAAGAAGATCGGGTAAGG + Intergenic
976870579 4:89788498-89788520 CATGGCAAGAACAAGGGGGAAGG + Intronic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977108308 4:92918345-92918367 CAGGGCAATCAGGTAGGAGAAGG - Intronic
977487216 4:97664880-97664902 AAGGGCAAGCAGAGTGGCGAGGG + Intronic
977553791 4:98468575-98468597 CAAGGCAGTCAGATGGGGGTGGG - Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977782772 4:100997179-100997201 CAGGGAAGGCAGATGGGGTGGGG + Intergenic
977897034 4:102376745-102376767 CAGGGCAATCAGGTGGGAGAAGG - Intronic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978004472 4:103599448-103599470 CAGGGCAATCAGACAGGAGAAGG - Intronic
980607378 4:135110609-135110631 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
981026950 4:140086269-140086291 CAGGGGACGCTGATGGGGCAGGG - Intronic
981493550 4:145367043-145367065 CAGGGCAATCAGACAGGAGAAGG - Intergenic
981605080 4:146531640-146531662 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
981752078 4:148102443-148102465 CAGGGCCAGGAGATCTGGGAGGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983159625 4:164395908-164395930 CAGGGCAAGAAAATGGGCAAAGG - Intergenic
983544924 4:168953023-168953045 AAGGACTAGCAGGTGGGGGAAGG + Intronic
983585856 4:169353724-169353746 CAAGGCAGGGAGATGGGGGTGGG - Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985615731 5:919886-919908 CAAGGCAAGAAAATGGGGGGGGG - Intergenic
985675756 5:1230512-1230534 CAGGGCCAGCATGTGGGGGCCGG - Intronic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
987574512 5:19707909-19707931 CATGGCATGCAGATGGAGAAGGG - Intronic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
989162223 5:38402320-38402342 CAAGGCAGACAGATGGGGAATGG - Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
989797623 5:45495594-45495616 CAGGGCAATCAGTTAGGAGAAGG - Intronic
991377715 5:65984002-65984024 CACGGGAAGCAGGTGGGAGAAGG - Intronic
991386603 5:66097607-66097629 CAAGTGAAGTAGATGGGGGAAGG + Intergenic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
992341826 5:75832182-75832204 CAAGGCCCGCAGATGTGGGATGG + Intergenic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
993222877 5:85124933-85124955 CAAGGCAATCTGATGGGGAAAGG - Intergenic
993961046 5:94296698-94296720 GAGGGCAAGCAGAAGTGGGGAGG - Intronic
994042825 5:95276985-95277007 CAGGTCAAGGAGATGGGTCAAGG + Intronic
994175872 5:96710443-96710465 AAGGGCAAGAAGAAGAGGGAAGG - Intronic
994201528 5:96982147-96982169 CATGGCAAGCAGATAGCAGAGGG + Intronic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
996003094 5:118387105-118387127 CAGGGCAATCAGACAGGAGAAGG + Intergenic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996987581 5:129585192-129585214 GAGGGCAAGCAGAAGCGGGCAGG - Intronic
997106870 5:131030709-131030731 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
997796564 5:136816805-136816827 CAGGGGAGGCAGATGTGGAAGGG - Intergenic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
998703545 5:144732489-144732511 CATTGCAAGCAAATGGGGCAGGG - Intergenic
998736793 5:145151249-145151271 CAGGGCAATCAGGCGGGAGAAGG + Intergenic
999244691 5:150147553-150147575 CAGGGCCTGCAAATAGGGGAGGG + Intronic
1000051243 5:157564618-157564640 AGGAGAAAGCAGATGGGGGAAGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000768135 5:165317582-165317604 CAGGACATGCAAATGAGGGAGGG - Intergenic
1001052465 5:168424047-168424069 GAGGGCAAGCAGCTGGGCCAAGG + Exonic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002594084 5:180311105-180311127 CAGAGCAGGCAGTTGGGGAAGGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003922448 6:10846086-10846108 CAGGGCAGGTAGATGCTGGACGG - Intronic
1005228318 6:23669816-23669838 CAGAGCAACAAGATGGGTGAGGG - Intergenic
1005766920 6:29020902-29020924 CAGGCCAGGTAGATGTGGGATGG - Intergenic
1006021712 6:31121346-31121368 CAGGGCCAGCAGATGGGCTATGG - Intronic
1006142761 6:31940611-31940633 GAGGGCCAGGTGATGGGGGAGGG - Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006342855 6:33456095-33456117 CAGGGCCAACATCTGGGGGAGGG + Exonic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006388048 6:33742956-33742978 AAGGGCAAGGAGATGGTGGGAGG + Intronic
1006406034 6:33845573-33845595 CAGAGGAAGCAGATGTGAGAAGG - Intergenic
1006514746 6:34539566-34539588 CAGGGCAAGGAGAGGGGGTTGGG + Intronic
1006738146 6:36289686-36289708 CAGGGAAAGAAGGTGGGGTATGG + Intronic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007727058 6:43922931-43922953 CAGGGCAACCAGCTGGGAGATGG + Intergenic
1008829413 6:55739665-55739687 CAGGGCAATCAGGTAGGAGAAGG + Intergenic
1009510512 6:64545518-64545540 CAGGGCAATCAGACAGGAGAAGG + Intronic
1009517184 6:64635316-64635338 CAGGGCAATCAGGCGGGAGAAGG - Intronic
1009536589 6:64896279-64896301 GAGGGCAAGCAGATGCAGGGTGG + Intronic
1009596103 6:65738852-65738874 CAGAGCAGGAAGATGGGGCAAGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010180840 6:73085163-73085185 CAGATCAAGCAGATGGGTCAGGG + Intronic
1010671546 6:78692503-78692525 CAAGGGCAGCAGTTGGGGGAAGG + Intergenic
1011550031 6:88523200-88523222 CAGGGCAATTAGACGGGAGAAGG - Intergenic
1013703079 6:112797357-112797379 CAATGCAAGAAGGTGGGGGATGG + Intergenic
1014059049 6:117049917-117049939 CAGGGAATGCTGATGGGAGAGGG + Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016307897 6:142702665-142702687 TAGGGAGAGCAGCTGGGGGAGGG - Intergenic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1017542077 6:155413328-155413350 GAGAGCAAGGAGATGGGCGAGGG + Intronic
1017680982 6:156863339-156863361 TAGGGCAAGAAGGTGTGGGATGG + Intronic
1018004941 6:159613008-159613030 CATGGCCAGGAGATGGGGGGTGG + Intergenic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018825890 6:167407639-167407661 CAGGGCAGGCAGAGCGGTGAAGG + Intergenic
1018829213 6:167429690-167429712 CATGGCAAGCACATAGTGGATGG - Intergenic
1019117273 6:169775097-169775119 CAGTACATTCAGATGGGGGAAGG - Intronic
1019318044 7:400496-400518 CAGGGCGAGCAGATAGGACAGGG + Intergenic
1019354217 7:570513-570535 CTGGGCAGGCAGTGGGGGGACGG - Intronic
1019613024 7:1946367-1946389 CAACTCAAGCAGATGGGAGATGG + Intronic
1020385919 7:7602221-7602243 CAGGGCAATCAGACAGGAGAAGG + Intronic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1022140204 7:27487055-27487077 CAGAGCAGGTAGATGTGGGAGGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022648779 7:32256070-32256092 CAGGGCAAGGAGATCAGGGAAGG + Intronic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023858255 7:44199748-44199770 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
1024178546 7:46864378-46864400 GAGGGCATTCAGCTGGGGGAGGG - Intergenic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1026004944 7:66592972-66592994 CAGGGAAGGCAGATAGGGGTGGG - Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1027681893 7:81232596-81232618 CAGGGCAAGCAGGGGTGGGAGGG + Intergenic
1028227698 7:88268070-88268092 TAGGGCTAGAAGGTGGGGGAGGG + Intergenic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1029245024 7:99193037-99193059 CAAGGCTAGGAGATGTGGGATGG + Exonic
1029661525 7:101965437-101965459 CAGGGCATGGTGGTGGGGGAAGG + Intronic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031790270 7:126093626-126093648 CATGGCAAGGACATGGTGGAAGG - Intergenic
1032083989 7:128874210-128874232 GAGGGCAAGCGGAAGGGGCAGGG - Intronic
1032466486 7:132148886-132148908 CACAGCAAGCAGATGGGCAAGGG - Intronic
1032478743 7:132229803-132229825 TGGGGCAAGGAGATGAGGGAAGG + Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033473034 7:141665919-141665941 TGGGGCCACCAGATGGGGGACGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034815518 7:154169074-154169096 CAGCGCAATCAGAAGGGGTATGG - Intronic
1034932381 7:155172805-155172827 CAGGGGAAGCAGATGTGTGGAGG - Intergenic
1035027598 7:155836118-155836140 CAGAGCAAGCAGTTGTGGGGCGG - Intergenic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1037183149 8:16031228-16031250 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
1037709960 8:21347637-21347659 CAGGGGAGGGACATGGGGGAGGG + Intergenic
1037832193 8:22196356-22196378 CAGGGAAAGCAGTTCAGGGAGGG - Intronic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1038354372 8:26813552-26813574 CAGGCCAAGCACCTGAGGGATGG - Intronic
1038919508 8:32067182-32067204 CAGGGCAATCAGACAGGAGAAGG - Intronic
1039361043 8:36877167-36877189 CTGGGCTAGCAGTTGGGGTAAGG + Intronic
1039387304 8:37147441-37147463 ACTGGCAAGCAAATGGGGGACGG - Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039964224 8:42271870-42271892 CACAGCAACCGGATGGGGGAGGG + Intronic
1040539103 8:48335937-48335959 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1040568610 8:48588910-48588932 CTGGGCCAGCATATGGGGAAGGG - Intergenic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1040644252 8:49379944-49379966 TAGGGCATGCATGTGGGGGAGGG - Intergenic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041990288 8:63980239-63980261 AAGGGAAAAAAGATGGGGGATGG - Intergenic
1043619040 8:82165020-82165042 CAGGTAAAGAAGATGGGAGAAGG + Intergenic
1045252098 8:100490796-100490818 CAGGGGCAGCAGATCTGGGATGG + Intergenic
1046907186 8:119586614-119586636 CAAGTCAAGCAGTTGGGGGTGGG + Intronic
1047646823 8:126878547-126878569 CATGGCAGGCAGGTGGAGGAAGG + Intergenic
1047762446 8:127964111-127964133 CAGGACAAGCAGATGGGTTCAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048358519 8:133674233-133674255 CAGGGGAAGCAGATGAGCAAGGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048894437 8:138977343-138977365 TAAGGCCACCAGATGGGGGAAGG + Intergenic
1049181720 8:141226389-141226411 CAGGGAAAGCACGTGGGGCAGGG - Intronic
1049609973 8:143550352-143550374 CAGGGCAATGAGATGGGGTTAGG - Intergenic
1049828569 8:144685631-144685653 CGGGCCAAGAAGATGGCGGAGGG - Intergenic
1049840385 8:144767317-144767339 CATGGGAAGCAGAGGTGGGAGGG - Intergenic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1050262986 9:3860604-3860626 CAGGAGAAGCAGATGGGCAAAGG + Intronic
1051029549 9:12658122-12658144 AAGGGCAAGCAGAGTGGTGAGGG + Intergenic
1051499754 9:17764309-17764331 CAGGGCAAGAAGCTGGTGGAGGG - Intronic
1053283948 9:36838688-36838710 CCAAGCAAGCAGATGGGGGTGGG - Exonic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1056300359 9:85233736-85233758 GAGGGAAAGGAGATGGGAGAAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059520193 9:114933658-114933680 CCGGGCAAGCAGAGGGGGTTGGG - Intergenic
1060110778 9:120904912-120904934 CAGGGCACAAAGATGGGTGAAGG - Exonic
1060245193 9:121939928-121939950 CAGGGAAAGAGGCTGGGGGAGGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060789973 9:126479316-126479338 CAGGTCAGGCAGATGGTGGTGGG + Intronic
1060795109 9:126507913-126507935 CAGGGCAAGCCATTGAGGGAGGG - Intergenic
1060881113 9:127118755-127118777 GACAGCAGGCAGATGGGGGAGGG - Intronic
1061119287 9:128633351-128633373 CAGGGCAAGCAGCGAGGGGTGGG - Exonic
1062118192 9:134820418-134820440 CAGGGCATGGAGCTGGGAGACGG - Intronic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185581203 X:1212899-1212921 GAGGGGGAGGAGATGGGGGAGGG - Intergenic
1185862523 X:3592438-3592460 AAGGGCAAGAAGAAGAGGGAGGG + Intergenic
1186653892 X:11592150-11592172 CAGAGGAGGAAGATGGGGGAAGG + Intronic
1186697665 X:12054331-12054353 AAGGACAAGCAGGTGGGGAAAGG + Intergenic
1187082143 X:16002120-16002142 CAGTACAAGCACATGAGGGAAGG - Intergenic
1187200225 X:17127541-17127563 AAGGGCATGGAAATGGGGGATGG + Intronic
1187537336 X:20154420-20154442 CATGGTAAGGAGATGGGTGAAGG - Exonic
1189009683 X:37034783-37034805 CAGGGGAAGGAAATGGGGCAGGG - Intergenic
1189038884 X:37520933-37520955 CAGGGCAAGGAAATGGGGCCGGG + Intronic
1189133019 X:38519876-38519898 CAGGGCAGGCAGTTAGGGAAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189463457 X:41260747-41260769 AAGGCCAAGAAGATGGGGCATGG - Intergenic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1190550241 X:51572242-51572264 CGGGGCAGGGAGTTGGGGGAGGG + Intergenic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190607916 X:52164051-52164073 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1191091811 X:56631567-56631589 CAGGGCAATCAGGTAGGAGAAGG - Intergenic
1191104590 X:56764644-56764666 GAGGGAAAGAAAATGGGGGAAGG - Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191783006 X:64888670-64888692 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193188810 X:78545181-78545203 CAGTGCATGCTGGTGGGGGAAGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193476628 X:81974105-81974127 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1193725541 X:85034615-85034637 GAGGACTAGTAGATGGGGGAGGG - Intronic
1194944858 X:100054909-100054931 CAGGGCAAGCAGGCAGGAGAAGG + Intergenic
1194954499 X:100162856-100162878 GAGGGCAAGCAGAAGCGGGGTGG - Intergenic
1195019464 X:100812367-100812389 AAGGACCATCAGATGGGGGAAGG + Intergenic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196633091 X:117966052-117966074 CAGGGCAATCAGGTAGGAGAAGG + Intronic
1196783244 X:119400838-119400860 GAGGGCAAGCAGAGGTGGGGAGG - Intronic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198762527 X:140047881-140047903 GAGGACAAGCTGGTGGGGGAAGG - Intergenic
1199908331 X:152259009-152259031 CAGTGACAGCAGATTGGGGAGGG - Intronic
1200267269 X:154653139-154653161 CAGGGCCAGGAGGTGGGTGAGGG - Intronic
1200394931 X:155979444-155979466 CAGGGCAGGCAGCTTGGGGTGGG - Intergenic
1201320483 Y:12693440-12693462 CTGGGCAAGCATATGGGGTGGGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic