ID: 1118738927

View in Genome Browser
Species Human (GRCh38)
Location 14:68724178-68724200
Sequence CAACCAGGAGGGAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1737
Summary {0: 1, 1: 0, 2: 5, 3: 113, 4: 1618}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118738927_1118738934 -6 Left 1118738927 14:68724178-68724200 CCTCCCATCCTCCCTCCTGGTTG 0: 1
1: 0
2: 5
3: 113
4: 1618
Right 1118738934 14:68724195-68724217 TGGTTGTCAAAACAAGTCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 164
1118738927_1118738935 -5 Left 1118738927 14:68724178-68724200 CCTCCCATCCTCCCTCCTGGTTG 0: 1
1: 0
2: 5
3: 113
4: 1618
Right 1118738935 14:68724196-68724218 GGTTGTCAAAACAAGTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 147
1118738927_1118738937 10 Left 1118738927 14:68724178-68724200 CCTCCCATCCTCCCTCCTGGTTG 0: 1
1: 0
2: 5
3: 113
4: 1618
Right 1118738937 14:68724211-68724233 TCTGTGGGAGAGGCATTCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1118738927_1118738936 0 Left 1118738927 14:68724178-68724200 CCTCCCATCCTCCCTCCTGGTTG 0: 1
1: 0
2: 5
3: 113
4: 1618
Right 1118738936 14:68724201-68724223 TCAAAACAAGTCTGTGGGAGAGG 0: 1
1: 0
2: 1
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118738927 Original CRISPR CAACCAGGAGGGAGGATGGG AGG (reversed) Intronic
900401146 1:2473446-2473468 CACCCAGATGGGCGGATGGGTGG - Intronic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
900611463 1:3546361-3546383 CATGCAGGAGGAAGGAGGGGCGG - Intronic
900779594 1:4609115-4609137 GGACCAGGAGGGAGGATGGGAGG - Intergenic
901100365 1:6715139-6715161 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
901100514 1:6715496-6715518 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
901436670 1:9250864-9250886 CACCCAGCATGGAGGATGGAGGG - Intronic
901632936 1:10656733-10656755 GAACCTGGAGGGAGGAGGGGTGG + Exonic
901787775 1:11636070-11636092 CAACCAGGCTGGAGGATGGAAGG - Intergenic
902018787 1:13328737-13328759 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
902018862 1:13328911-13328933 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
902062706 1:13658420-13658442 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
903081434 1:20815763-20815785 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
903081655 1:20816259-20816281 CATCCGGGAGGGAGGTGGGGAGG + Intronic
903103609 1:21053830-21053852 CATCCGGGAGGGAGGTGGGGGGG + Intronic
903148228 1:21388242-21388264 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
903526169 1:23994034-23994056 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
903526292 1:23994309-23994331 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
903637745 1:24833488-24833510 CATCCGGGAGGGAGGTGGGGGGG - Intronic
903637770 1:24833537-24833559 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
903637845 1:24833712-24833734 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
903923604 1:26818054-26818076 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
903923728 1:26818329-26818351 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
903924044 1:26819024-26819046 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
903978912 1:27171018-27171040 CAACCAGGGGAGAGGCAGGGTGG + Intergenic
903993293 1:27289085-27289107 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
904074353 1:27829133-27829155 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904077402 1:27853052-27853074 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904077504 1:27853278-27853300 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
904077555 1:27853405-27853427 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
904077656 1:27853631-27853653 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
904077910 1:27854202-27854224 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
904276866 1:29390629-29390651 CAGCCAGGTTGGAGGAGGGGCGG - Intergenic
904285560 1:29451357-29451379 CCTCCAGGAGGGAGTACGGGTGG + Intergenic
904784708 1:32974896-32974918 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
904810866 1:33162667-33162689 CAAGGACGAGAGAGGATGGGAGG + Intronic
905041954 1:34967711-34967733 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
905192173 1:36243928-36243950 CATCCGGGAGGGAGGTGGGGGGG - Intronic
905315978 1:37081486-37081508 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
905339908 1:37271453-37271475 CATCCACGTGGGAGCATGGGTGG + Intergenic
905342926 1:37291670-37291692 CAACCAGGAAGAAGGTTGGTTGG + Intergenic
905427667 1:37897093-37897115 CGTCCAGGAGGGAGGTCGGGGGG + Intronic
905596962 1:39215794-39215816 CAGACTGGCGGGAGGATGGGGGG + Intronic
906128223 1:43440640-43440662 GAAGCAGGAGGGAGTGTGGGAGG - Intronic
906287015 1:44594263-44594285 TAACAAGGAGGGAGGGGGGGAGG - Intronic
906486858 1:46241132-46241154 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
906486880 1:46241181-46241203 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
906487185 1:46241887-46241909 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
906487370 1:46242293-46242315 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
906761638 1:48382911-48382933 CATCCGGGAGGGAGGTGGGGGGG - Intronic
906761762 1:48383184-48383206 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
907053382 1:51344628-51344650 GAACCAGGTGAGAGGATGGAGGG + Intronic
907329116 1:53659945-53659967 CAGCCAGGAGGGAGCAGGGCAGG - Intronic
907453577 1:54562096-54562118 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
907453748 1:54562497-54562519 CATCCGGGAGGGAGGTGGGGGGG - Intronic
907517254 1:55000546-55000568 CACCCAGGTGGGAGGAGAGGAGG - Intronic
908370280 1:63473457-63473479 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
908446217 1:64201406-64201428 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
908650932 1:66332277-66332299 CATCCAGGCGGGGGGTTGGGGGG + Intronic
909640999 1:77869968-77869990 CATCCGGGAGGGAGGTGGGGGGG - Intronic
909641051 1:77870095-77870117 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
909641107 1:77870226-77870248 CGACCGGGAGGGAGGTGGGGGGG - Intronic
910344041 1:86216497-86216519 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
910758055 1:90711951-90711973 CAAGCAGGAGGGAGGGAGGGGGG - Exonic
911183809 1:94884172-94884194 CAGCCAGGTGGGAGGTGGGGTGG - Intronic
911351616 1:96762400-96762422 CATCCGGGAGGGAGGTGGGGGGG - Intronic
911351738 1:96762675-96762697 CATCCAGGAGGGAGGTGGGGGGG - Intronic
911486690 1:98512870-98512892 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
912298198 1:108489257-108489279 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
912298488 1:108489932-108489954 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
912629346 1:111233551-111233573 CATCCAGGAGGGAGGTGGGGGGG + Intronic
912715584 1:111981577-111981599 AAACCAGGACGGAGGTTGGAGGG - Intronic
912751765 1:112293521-112293543 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
912790036 1:112640582-112640604 CATCCGGGAGGGAGGTGGGGGGG + Intronic
912825128 1:112898308-112898330 CGTCCAGGAGGGAGGTTGGGGGG - Intergenic
912825278 1:112898660-112898682 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
912844865 1:113069446-113069468 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
912844887 1:113069495-113069517 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
912845306 1:113070442-113070464 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
913021129 1:114790645-114790667 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
913305857 1:117429585-117429607 CATCCGGGAGGGAGGTGGGGGGG - Intronic
913993833 1:143638014-143638036 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
914002183 1:143702973-143702995 CATCCGGGAGGGAGTTTGGGGGG + Intergenic
914002306 1:143703275-143703297 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
914002379 1:143703450-143703472 CATCCGGGAGGGAGGTGGGGAGG + Intergenic
914231291 1:145766628-145766650 CATCCGGGAGGGAGGTGGGGGGG - Intronic
914231434 1:145766947-145766969 CGACCGGGAGGGAGGTGGGGGGG - Intronic
914324259 1:146595954-146595976 CAACCAGGAGGGTGCACAGGTGG + Intergenic
914468107 1:147949627-147949649 CATCCGGGAGGGAGGTGGGGGGG - Intronic
914775112 1:150728809-150728831 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
914775213 1:150729036-150729058 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
914893792 1:151651334-151651356 CATCCGGGAGGGAGGTGGGGGGG - Intronic
915204197 1:154257354-154257376 ACCCCAGGAGGGAGGTTGGGAGG - Exonic
915326720 1:155084670-155084692 CAGCCGGGAGGAGGGATGGGAGG - Intronic
915467159 1:156104487-156104509 CAACCATGAGGGAGGGGGTGAGG - Intronic
915509487 1:156378709-156378731 CAGCGAGGAGGGAGGAGGAGGGG - Intronic
915539416 1:156557596-156557618 CATCCGGGAGGGAGGTGGGGGGG + Intronic
915539586 1:156557961-156557983 CATCCGGGAGGGAGGTGGGGGGG + Intronic
915733218 1:158068612-158068634 CAAGAAGGAGGGAGGAAGGGAGG - Intronic
915901961 1:159854194-159854216 TAAGCAGGAGGGAGGAGAGGGGG + Intronic
915912514 1:159923649-159923671 CAGCCAGCAGCAAGGATGGGGGG + Exonic
916104865 1:161423258-161423280 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
916105020 1:161423612-161423634 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
916779446 1:168008904-168008926 CAAGCAAGTGGGAGGAAGGGAGG - Intronic
917089758 1:171341322-171341344 CAAAATGGTGGGAGGATGGGTGG + Intronic
917375786 1:174349590-174349612 CATCCGGGAGGGAGGTGGGGGGG - Intronic
917375904 1:174349864-174349886 CATCCAGGAGGGAGGTGGGGGGG - Intronic
917564378 1:176196935-176196957 CCAGCAGGAGGGAGGGAGGGAGG + Intronic
917582883 1:176396208-176396230 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
917582982 1:176396432-176396454 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
917583056 1:176396609-176396631 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
917860074 1:179135941-179135963 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
917860125 1:179136069-179136091 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
918018287 1:180659486-180659508 CAACAGAGAGGGAGGAAGGGAGG - Intronic
918228705 1:182509721-182509743 CATCCGGGAGGGAGGTGGGGGGG - Intronic
918252050 1:182711523-182711545 GACCCAGGAGGGAGGAAAGGAGG + Intergenic
918255027 1:182741188-182741210 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
918357113 1:183715305-183715327 CAACAACGAGGGAGGAAAGGGGG - Intronic
919080157 1:192857521-192857543 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
919485578 1:198143102-198143124 AAAGCAGGAGGGAGGAGAGGAGG - Intergenic
919879885 1:201894569-201894591 CAGGCAGGAGTGAGGGTGGGAGG + Intergenic
919925800 1:202191457-202191479 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
920152268 1:203919454-203919476 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
920152293 1:203919503-203919525 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
920353850 1:205356082-205356104 CAAAAAGGAGGGAGGGGGGGAGG - Intronic
920508551 1:206534159-206534181 CAACCAGGAGCTGGGATGGAGGG - Intronic
921140223 1:212298931-212298953 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921142371 1:212320640-212320662 CATCCGGGAGGGAGGCGGGGAGG - Intronic
921142394 1:212320689-212320711 CATCCGGGAGGGAGGTGGGGGGG - Intronic
921142446 1:212320816-212320838 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921177550 1:212607798-212607820 CAACCCGGTGGGAGGGTAGGAGG - Intronic
921198333 1:212779717-212779739 CATCCGGGAGGGAGGTGGGGGGG + Intronic
921198717 1:212783119-212783141 CAACAAGGAGGGAAGAAGGGAGG + Intronic
921237721 1:213150948-213150970 CATCCGGGAGGGAGGTGGGGGGG - Intronic
921237800 1:213151125-213151147 CATCCGGGAGGGAGGTGGGGGGG - Intronic
921237825 1:213151174-213151196 CATCCGGGAGGGAGGTGGGGGGG - Intronic
921238151 1:213151932-213151954 CATCCGGGAGGGAGGTGGGGGGG - Intronic
921599200 1:217089198-217089220 TATCCAGGAAGGGGGATGGGAGG + Intronic
921638310 1:217523807-217523829 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
921902618 1:220466317-220466339 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
921902743 1:220466620-220466642 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
922102527 1:222487942-222487964 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
922102664 1:222488249-222488271 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
922192206 1:223329170-223329192 TAAACAAGAGGGAGAATGGGGGG + Intronic
922503768 1:226114983-226115005 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
922762700 1:228142485-228142507 CCCTCAGGAGGGAGGAGGGGAGG + Intronic
922762841 1:228143078-228143100 CCCTCAGGAGGGAGGAGGGGAGG + Intronic
923268165 1:232332462-232332484 CGTCCAGGAGGGAGGTCGGGGGG + Intergenic
923546017 1:234923796-234923818 CCAGCAGGAGGCAGGATGAGGGG - Intergenic
923710923 1:236387032-236387054 CATCCGGGAGGGAGGTGGGGGGG + Intronic
923767906 1:236910011-236910033 CAGGCATGAGGGAGGATTGGAGG - Intergenic
924374347 1:243389794-243389816 CATCCAGGAGGGAGGAGAGTAGG + Intronic
924788389 1:247220607-247220629 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1063340619 10:5259969-5259991 CCACCAGGTGGGATGATGAGGGG - Intergenic
1063449510 10:6142123-6142145 AAACTGGGAGGGAGGGTGGGGGG - Intergenic
1063957537 10:11280779-11280801 CAACCAGGACTGAGGCTGGAGGG - Intronic
1064108360 10:12519448-12519470 CATCCGGGAGGGAGGTGGGGAGG - Intronic
1064108580 10:12519944-12519966 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1064970108 10:21056850-21056872 CATCCAGGAGGGAGGAGGTGTGG + Intronic
1065335888 10:24656197-24656219 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1065336012 10:24656501-24656523 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1065336429 10:24657411-24657433 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1065541003 10:26767555-26767577 TAACCAGGAAGGAGCATGAGGGG + Intronic
1065594275 10:27296370-27296392 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1065594347 10:27296546-27296568 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1065754909 10:28922266-28922288 AATCCAGGAGGGAGGGTGAGAGG - Intergenic
1066085461 10:31970174-31970196 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1066085536 10:31970349-31970371 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1066085561 10:31970398-31970420 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1066191472 10:33059868-33059890 GAATCAGGTGGGAAGATGGGAGG - Intergenic
1066431091 10:35352600-35352622 CATCCAGCAGGGAGGCTGGACGG - Intronic
1067026574 10:42847696-42847718 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1067119938 10:43465097-43465119 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1067119986 10:43465195-43465217 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1067147546 10:43704198-43704220 AAACCAGCAGGGAGGAGGAGAGG - Intergenic
1067354538 10:45512380-45512402 CGTCCAGGAGGGAGGTCGGGGGG + Intronic
1067428326 10:46225872-46225894 CAACCAGGAGTGGGGATATGGGG - Intergenic
1068206150 10:53856945-53856967 CCAAAAGGAGGGAGGATGGGAGG + Intronic
1068230903 10:54168508-54168530 CGACCAGGTGTGAGGAGGGGAGG - Intronic
1068520585 10:58073117-58073139 TAATTAGGAGGGAGGGTGGGAGG - Intergenic
1068592412 10:58864976-58864998 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1069741213 10:70687515-70687537 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1069741366 10:70687868-70687890 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1069895835 10:71679519-71679541 CAGCCAGGAGGAGGGCTGGGGGG + Intronic
1070135484 10:73689841-73689863 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1070317862 10:75333109-75333131 CGTCCAGGAGGGAGGTTGGGGGG - Intergenic
1070966526 10:80534298-80534320 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1070966672 10:80534650-80534672 CGTCCAGGAGGGAGGCGGGGGGG + Intergenic
1070966722 10:80534777-80534799 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1070966747 10:80534826-80534848 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1070966770 10:80534875-80534897 CATCCGGGAGGGAGGCGGGGAGG + Intergenic
1071616652 10:87081179-87081201 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1071773693 10:88760126-88760148 TAACCAGGAGGCAGGTTGGAAGG + Intergenic
1071968389 10:90876847-90876869 CATCCAGGAGGGAGAATTGATGG + Intronic
1072019495 10:91384002-91384024 CAAGCAGAAGGGAGGAAGGAAGG - Intergenic
1072116588 10:92375139-92375161 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1072116612 10:92375189-92375211 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1072116634 10:92375238-92375260 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1072117128 10:92376354-92376376 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1072117304 10:92376742-92376764 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1072180377 10:92975509-92975531 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072180419 10:92975599-92975621 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1072180496 10:92975775-92975797 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1072213467 10:93268258-93268280 CATCCAGGAGAGATGGTGGGAGG - Intergenic
1072648277 10:97275736-97275758 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1072648635 10:97276536-97276558 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1072648833 10:97276991-97277013 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072949317 10:99838157-99838179 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1072949551 10:99838687-99838709 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1072956579 10:99892155-99892177 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1072980255 10:100093172-100093194 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1072980577 10:100093905-100093927 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1073386136 10:103129059-103129081 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1073476562 10:103757466-103757488 CATCCAGGACGGAGGGTTGGGGG + Intronic
1073594335 10:104785083-104785105 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1073807386 10:107112708-107112730 CAACCAAAAGAGAGCATGGGTGG + Intronic
1073865630 10:107800893-107800915 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1074151996 10:110767118-110767140 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1074538129 10:114343545-114343567 CAGCAAGGAGGGAGGGAGGGAGG + Intronic
1075137029 10:119794904-119794926 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1075137082 10:119795031-119795053 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1075336824 10:121614796-121614818 CAGTCAGGAAGGAGGCTGGGAGG - Intergenic
1075410853 10:122226940-122226962 CAACCAGGAGGGGGTACAGGTGG - Intronic
1075447255 10:122521712-122521734 CACACAGCAGGGAGGAGGGGTGG + Intergenic
1075618386 10:123907922-123907944 GAAGCAGGAGGAAGGAAGGGAGG + Intronic
1076724725 10:132407995-132408017 CAGCCGGGAGGGAGGACGGGAGG + Intronic
1077328395 11:1973433-1973455 CCACCCCGAGGGAGGAAGGGAGG + Intronic
1077397592 11:2332650-2332672 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1077397616 11:2332700-2332722 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1077548295 11:3186539-3186561 CCAAAAGGAGGGAGGGTGGGAGG - Intergenic
1077668785 11:4138077-4138099 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1077869564 11:6250505-6250527 GAAGCAGGAGGCAGGGTGGGAGG + Intergenic
1078176908 11:8978226-8978248 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1078177071 11:8978610-8978632 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1078177096 11:8978659-8978681 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1078177119 11:8978708-8978730 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1078627289 11:12969027-12969049 AAATTAGAAGGGAGGATGGGGGG - Intergenic
1079020640 11:16907194-16907216 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1079039818 11:17050592-17050614 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1079039866 11:17050691-17050713 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1079174003 11:18121437-18121459 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1079249997 11:18780363-18780385 AAAGCAGGAGGGAGCATGGCTGG - Intronic
1079444909 11:20548727-20548749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1080098361 11:28431140-28431162 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1080583799 11:33664409-33664431 CATCCAGCAGGGAGGAGAGGGGG + Intronic
1080860232 11:36145091-36145113 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1080874736 11:36265394-36265416 CAATGAGGAGGAAGGATGGGAGG + Intergenic
1081288990 11:41304655-41304677 CATCCGGGAGGGAGGTTGGGGGG + Intronic
1081289062 11:41304802-41304824 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1081289108 11:41304900-41304922 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1081600388 11:44488609-44488631 GAGCCAGGAGGGAGGGAGGGAGG - Intergenic
1081627469 11:44663982-44664004 CCTCCAGGAGGGAGGTGGGGGGG + Intergenic
1081641319 11:44756300-44756322 CAAAAAGGAGGGAGGGAGGGAGG + Intronic
1081784623 11:45738211-45738233 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1081784772 11:45738565-45738587 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1081934915 11:46898007-46898029 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1081934963 11:46898105-46898127 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1081950123 11:47037980-47038002 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1081950176 11:47038107-47038129 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1082844505 11:57716267-57716289 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1082844766 11:57716845-57716867 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1083030283 11:59585527-59585549 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1083052815 11:59792245-59792267 CAACCAGGTGGCAGGAAAGGTGG - Intronic
1083091170 11:60201247-60201269 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1083115085 11:60451709-60451731 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1083130960 11:60622781-60622803 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1083131009 11:60622879-60622901 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1083171789 11:60927622-60927644 CCACCTGGAGGGAGAATGAGAGG - Exonic
1083190534 11:61048731-61048753 CAGCCAGGAGGGAGGGGTGGGGG - Intergenic
1083333322 11:61909180-61909202 CAACCAGGGCTGGGGATGGGGGG + Intronic
1083382372 11:62278913-62278935 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1083382575 11:62279364-62279386 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1083382719 11:62279689-62279711 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1083645633 11:64171350-64171372 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1083645831 11:64171805-64171827 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1083648213 11:64185449-64185471 CAGCCAGGAGGCAGGAGGGCCGG + Exonic
1083739648 11:64701937-64701959 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1083782011 11:64923613-64923635 CAACCGGGAGGATGGCTGGGTGG + Intronic
1083832106 11:65239561-65239583 CGTCCAGGAGGGAGGTCGGGGGG + Intergenic
1084088236 11:66864552-66864574 CTTCCAGAAGGGAGGATGGGAGG + Intronic
1084214417 11:67639816-67639838 GGACAAGGAGGGAGGAAGGGGGG - Intergenic
1084264567 11:67998171-67998193 CAGCCAGGAGAGTGGGTGGGCGG - Intronic
1084450302 11:69232872-69232894 GACCCAGGTGGGAGGATGGAGGG + Intergenic
1084457115 11:69274249-69274271 GCACCAGGTGGGTGGATGGGTGG + Intergenic
1084624197 11:70295286-70295308 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1084624222 11:70295336-70295358 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1084624323 11:70295563-70295585 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1084924606 11:72502245-72502267 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1085111896 11:73896983-73897005 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1085292479 11:75410170-75410192 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1085360063 11:75877916-75877938 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1085410334 11:76287104-76287126 GAGCCTGGAGAGAGGATGGGAGG - Intergenic
1085513301 11:77098733-77098755 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1085905542 11:80757113-80757135 TAAGCAGCATGGAGGATGGGAGG + Intergenic
1086104534 11:83133541-83133563 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1086122308 11:83316289-83316311 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1086122379 11:83316465-83316487 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1086395363 11:86409909-86409931 CAACCAGGACGTGGGATGGGTGG + Intronic
1086881736 11:92158270-92158292 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1087948788 11:104194987-104195009 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1088353986 11:108922304-108922326 AAAGCACGAGGGAGGAAGGGAGG + Intronic
1088583087 11:111334245-111334267 CATCCAGGAGGAAAGCTGGGTGG + Intergenic
1088989978 11:114944845-114944867 CAACTAAGAGGGAGTGTGGGAGG + Intergenic
1089420874 11:118331368-118331390 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1089642820 11:119858989-119859011 CACCCAAGTGGGAGGATGGATGG - Intergenic
1090201952 11:124863778-124863800 CACCCTGGAGCGAGGAAGGGAGG + Intergenic
1090426094 11:126608043-126608065 AACCCAGGAGGGAGGGTTGGTGG + Intronic
1090526880 11:127546712-127546734 TAACCAGGTGTGAGGAGGGGAGG + Intergenic
1090617224 11:128526140-128526162 CAGTCAGGAGGGAAGAAGGGAGG + Intronic
1090790932 11:130091371-130091393 CATCCGGGAGGGAGGTAGGGGGG - Intronic
1091166691 11:133482509-133482531 CAACCAGAAGGGAGGGTGGCCGG + Intronic
1091286864 11:134412573-134412595 CAGCCAGGATGGAGGCGGGGTGG - Intergenic
1202811373 11_KI270721v1_random:28612-28634 CCACCCCGAGGGAGGAAGGGAGG + Intergenic
1091507889 12:1091455-1091477 GAAACAGGAGGGAGGCTGGAGGG + Intronic
1091727312 12:2855084-2855106 CATCCAGGAGGGAGGGGGGATGG + Intronic
1091845822 12:3655724-3655746 CCTCCAGGAGGCAGGCTGGGTGG - Intronic
1092043808 12:5410230-5410252 CATCCAAGAGGGAGTGTGGGAGG + Intergenic
1092331404 12:7590163-7590185 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1092343938 12:7699914-7699936 CGAAAAGGAGGGAGGGTGGGAGG + Intergenic
1092401848 12:8184330-8184352 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1092401954 12:8184585-8184607 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1092402003 12:8184712-8184734 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1092453899 12:8625954-8625976 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1092827580 12:12414114-12414136 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1092827604 12:12414163-12414185 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1092827779 12:12414564-12414586 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1092827831 12:12414692-12414714 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1093453359 12:19340350-19340372 CGTCCAGGAGGGAGGCGGGGAGG + Intronic
1094004206 12:25730152-25730174 AAACCAAGAGTGAAGATGGGAGG - Intergenic
1094016893 12:25874377-25874399 CACACAGGAGGGAGGAGGGTCGG + Intergenic
1094103384 12:26785413-26785435 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1094103437 12:26785539-26785561 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1094238953 12:28200957-28200979 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1094238977 12:28201006-28201028 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1094329145 12:29273372-29273394 CACCAACGAGGAAGGATGGGTGG + Intronic
1095100788 12:38181381-38181403 AAACCAGAAGGAAGGAAGGGAGG + Intergenic
1095439953 12:42228772-42228794 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1095571226 12:43685514-43685536 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1096022292 12:48333147-48333169 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1096039285 12:48500358-48500380 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1096082412 12:48842208-48842230 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1096082436 12:48842256-48842278 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1096082507 12:48842433-48842455 CATCCGGGAGGGAGGTAGGGGGG + Intronic
1096167240 12:49436276-49436298 CATCCGGGAGGGAGGTGGGGAGG - Intronic
1096167509 12:49436914-49436936 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1096194646 12:49642183-49642205 CACCCAGGAGGGTGGATGCCAGG - Exonic
1096441245 12:51645315-51645337 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1096557072 12:52409972-52409994 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1096562737 12:52448407-52448429 CAAGCAGGTGAGAGGATGTGAGG - Intronic
1096856539 12:54488165-54488187 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1097028485 12:56075790-56075812 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1097042493 12:56164238-56164260 CCACCTGGAGGGAGGGTGAGCGG - Intronic
1097127798 12:56789086-56789108 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1097149170 12:56963786-56963808 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1097218730 12:57434315-57434337 ACCCCAGGAGGGAGGATGGAGGG + Intergenic
1097230374 12:57507488-57507510 CATGCAGGAGGGAGGTGGGGGGG - Intronic
1098360372 12:69648594-69648616 GATCCATTAGGGAGGATGGGAGG + Intronic
1098412684 12:70202109-70202131 CATCCGGGAGGGAGGCGGGGGGG + Intergenic
1098412757 12:70202276-70202298 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1098412881 12:70202549-70202571 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1098835458 12:75419282-75419304 CACCCTGGAAGGAGGATAGGAGG + Intronic
1098883789 12:75941942-75941964 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1098883887 12:75942167-75942189 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1098884016 12:75942473-75942495 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1099247709 12:80214075-80214097 TAATCAGGAAGGAGGAAGGGTGG + Intronic
1099255224 12:80307442-80307464 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1099255277 12:80307569-80307591 CGTCCAGGAGGGAGGTTGGGGGG - Intronic
1099255299 12:80307618-80307640 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1100570528 12:95841048-95841070 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1100570553 12:95841097-95841119 CGCCCAGGAGGGAGGTCGGGGGG - Intergenic
1100570627 12:95841272-95841294 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1100577535 12:95907457-95907479 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1100582096 12:95947607-95947629 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1100582237 12:95947923-95947945 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1100582361 12:95948197-95948219 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1100817006 12:98396390-98396412 GAAGCAGGAAGGAGGATGGCAGG - Intergenic
1100869820 12:98898051-98898073 CCAAAAGCAGGGAGGATGGGAGG + Intronic
1100914323 12:99401707-99401729 AAACGAGGTGGGAGGATGGATGG + Intronic
1100994961 12:100294211-100294233 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1100994985 12:100294260-100294282 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1101194268 12:102366760-102366782 TAACCAGCAGGGAGGGTTGGGGG - Intergenic
1101317624 12:103643814-103643836 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1102089359 12:110173100-110173122 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1102089383 12:110173149-110173171 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1102293906 12:111723197-111723219 CGTCCGGGAGGGAGGAGGGGGGG - Intronic
1102294007 12:111723423-111723445 CGTCCAGGAGGGAGGCGGGGGGG - Intronic
1102578823 12:113873040-113873062 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1102923284 12:116808751-116808773 CAAACGGCAGGGAGGAGGGGCGG + Intronic
1103507120 12:121449125-121449147 GAGCCAGGTGGCAGGATGGGAGG + Intronic
1103641727 12:122357491-122357513 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1103641856 12:122357798-122357820 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1103775716 12:123364970-123364992 CACCTAGGAGGGAGGCGGGGCGG - Intergenic
1104220655 12:126781686-126781708 CAACAAGAAGGAAGGAGGGGTGG - Intergenic
1104223209 12:126806245-126806267 TCACCAGGAGTGAGGAAGGGAGG - Intergenic
1104299314 12:127549793-127549815 AGACCAGGAGGGAAGAAGGGAGG - Intergenic
1104603589 12:130170751-130170773 CAAGCTGGAGGGAGGAGGGAAGG + Intergenic
1104712687 12:130996965-130996987 CATCCGGGAGGGAGGTTGGGGGG - Intronic
1104747784 12:131220997-131221019 CACCCTGGAGGGAGGGAGGGAGG - Intergenic
1105367983 13:19779845-19779867 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1105527065 13:21186596-21186618 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1105805598 13:23950236-23950258 GCACTAGGAGGGAGGCTGGGAGG - Intergenic
1105808391 13:23972603-23972625 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1105980364 13:25512689-25512711 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1105980388 13:25512739-25512761 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1105980460 13:25512915-25512937 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1106408781 13:29496716-29496738 CATTCAGGAGGCAGGATGGCAGG + Intronic
1106495326 13:30270057-30270079 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1106495398 13:30270233-30270255 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1106746867 13:32716600-32716622 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1106885587 13:34181396-34181418 CTACCGGGAGGGAGGTAGGGGGG + Intergenic
1106918661 13:34540824-34540846 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1106918786 13:34541100-34541122 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1107493186 13:40900730-40900752 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1107493237 13:40900857-40900879 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1107493416 13:40901257-40901279 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1107499064 13:40955708-40955730 CATCCGGGAGGGAGGCGGGGAGG + Intronic
1107499141 13:40955884-40955906 CATCCAGGAGGGAGGCGGGGAGG + Intronic
1107588803 13:41881733-41881755 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1107683213 13:42871372-42871394 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1107727958 13:43318962-43318984 CAACCTGGAGGGAGAGAGGGAGG + Intronic
1107953241 13:45485236-45485258 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1108304246 13:49115168-49115190 CAACCCTGAGGGATGAGGGGGGG + Intronic
1108330307 13:49378346-49378368 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1108351504 13:49593359-49593381 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1108351603 13:49593584-49593606 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1108502106 13:51078272-51078294 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1108512922 13:51171620-51171642 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1108608641 13:52064034-52064056 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1108608769 13:52064337-52064359 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1108610601 13:52080250-52080272 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1108791444 13:53973278-53973300 GGAACAGGAGTGAGGATGGGAGG + Intergenic
1108814058 13:54268610-54268632 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1109166866 13:59046281-59046303 CAACAAGGATAGAGGATGGATGG - Intergenic
1109716818 13:66230333-66230355 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1110269361 13:73574887-73574909 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1110269660 13:73575567-73575589 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1110306617 13:73995310-73995332 CAAAAATGAGGGAGGAAGGGAGG + Intronic
1111418148 13:87976244-87976266 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1111418172 13:87976293-87976315 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1111458912 13:88516782-88516804 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1111631776 13:90852545-90852567 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1112056084 13:95691021-95691043 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1112414732 13:99194874-99194896 CAGGCAGGAGGGAAGATGGTTGG - Intergenic
1112574020 13:100619173-100619195 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1112935673 13:104795051-104795073 CAAGCAAGAGGGAGGAAGGTGGG - Intergenic
1113194097 13:107783048-107783070 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1113598893 13:111554480-111554502 CAGACAGGAGGGAGGAGAGGAGG - Intergenic
1113598900 13:111554504-111554526 CAGACAGGAGGGAGGAGAGGAGG - Intergenic
1113650052 13:112028291-112028313 CAGCCAGAAGGGAGGGAGGGTGG + Intergenic
1113949585 13:114064629-114064651 CGAACAGGATGGGGGATGGGAGG - Intronic
1114069057 14:19094037-19094059 AGACCAGGAGTGTGGATGGGGGG + Intergenic
1114165191 14:20212749-20212771 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165216 14:20212800-20212822 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165266 14:20212901-20212923 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165289 14:20212951-20212973 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114165314 14:20213002-20213024 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114427743 14:22637393-22637415 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1114427846 14:22637618-22637640 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1114532182 14:23403026-23403048 CAAGGAGGAGGGAGGGTGGCAGG + Intronic
1115146905 14:30236924-30236946 CATCTTGGAGGGAGGATGGATGG - Intergenic
1115240667 14:31249262-31249284 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1115259339 14:31437091-31437113 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1115392172 14:32866161-32866183 CTACCAGCAGAGAGGGTGGGTGG + Intergenic
1115703550 14:35977417-35977439 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1115703727 14:35977817-35977839 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1115847576 14:37555520-37555542 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1116191488 14:41673450-41673472 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116191586 14:41673676-41673698 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1116191742 14:41674079-41674101 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116191963 14:41674607-41674629 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1116480423 14:45389352-45389374 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1116809006 14:49521471-49521493 AATCCAGGAAGGAGGATGGTGGG + Intergenic
1117277143 14:54203607-54203629 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1117277321 14:54204009-54204031 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1117597017 14:57334108-57334130 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1117617284 14:57546436-57546458 GGACCAGAAGGGAGGAGGGGAGG + Intergenic
1117687389 14:58268491-58268513 AAACTAGGAGGGCGGAGGGGAGG - Intronic
1118184209 14:63522843-63522865 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1118341023 14:64895354-64895376 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1118341048 14:64895403-64895425 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1118341123 14:64895578-64895600 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1118517482 14:66545388-66545410 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1118517687 14:66545867-66545889 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1118584711 14:67341447-67341469 CGTCCAGGAGGGAGGTTGGGGGG + Intronic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1119165477 14:72488926-72488948 GAAGCAAGAGGGAGGAGGGGAGG + Intronic
1119254529 14:73184698-73184720 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1119594833 14:75924917-75924939 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1119594905 14:75925093-75925115 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1119710810 14:76821632-76821654 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1120309773 14:82814254-82814276 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1120893048 14:89506436-89506458 CGACCGGGAGGGAGGTTGGGGGG + Intronic
1121001367 14:90454148-90454170 TACCCAGGAGGGAGGAGGGTGGG - Intergenic
1121112357 14:91321048-91321070 CAATCACTGGGGAGGATGGGAGG + Intronic
1121199568 14:92106297-92106319 GAGCCGGGAGGGAGTATGGGCGG - Intronic
1121335497 14:93075517-93075539 CTACCAGGAGGGAGGTCAGGAGG + Intronic
1121800150 14:96768497-96768519 AAAGAAGGAGGGAGGAAGGGAGG - Intergenic
1121810695 14:96886475-96886497 AAACCAGGGTGGAGGAAGGGTGG - Intronic
1122122736 14:99563229-99563251 GAAGCAGGAGGGAGGATGCCTGG - Intronic
1122924324 14:104892739-104892761 CCACAAGGAGGGATGGTGGGGGG - Intronic
1122963846 14:105112121-105112143 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1123040546 14:105488532-105488554 GAACCAGGAGGCAGGATAGGGGG - Intronic
1123068114 14:105628270-105628292 CAAACAGGAGAGGGGAGGGGGGG - Intergenic
1125016860 15:34946465-34946487 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1125079249 15:35656222-35656244 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1125079526 15:35656878-35656900 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1125459383 15:39893785-39893807 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1125459437 15:39893914-39893936 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1125459461 15:39893963-39893985 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1125459535 15:39894138-39894160 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1125535201 15:40438385-40438407 CAAGCAATAGGGAGGAAGGGGGG + Intergenic
1125651513 15:41321185-41321207 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1125659212 15:41382589-41382611 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1125768989 15:42152859-42152881 CATCCAGGATGGAGGGAGGGAGG + Intronic
1126048890 15:44669266-44669288 CAACCTGGAGTGAGTGTGGGAGG - Exonic
1126125693 15:45293093-45293115 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1126516948 15:49549917-49549939 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1126547193 15:49886399-49886421 AAGAAAGGAGGGAGGATGGGGGG + Intronic
1127072986 15:55303067-55303089 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1127117003 15:55738826-55738848 AAACAAGGAGGGAGAATGGTAGG + Intronic
1127488110 15:59437959-59437981 GAACGAGGAGGGAGGAGGGGCGG + Intronic
1127584478 15:60367103-60367125 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1127824195 15:62689887-62689909 CGTCCGGGAGGGAGGAAGGGGGG - Intronic
1127824218 15:62689937-62689959 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1128586876 15:68859659-68859681 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1128587010 15:68859963-68859985 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1128597317 15:68964358-68964380 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1128970513 15:72101625-72101647 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1129246407 15:74281651-74281673 CACCCAGGAGGGTGGGAGGGAGG - Intronic
1129428467 15:75481422-75481444 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1129431358 15:75503754-75503776 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1129669058 15:77597083-77597105 TAAACTGGAGGGAGGAAGGGAGG - Intergenic
1129771965 15:78208310-78208332 GAGCCTGGAGGGAGGCTGGGTGG - Intronic
1129782540 15:78282534-78282556 CAAGCAGGAGGGAGAAGTGGGGG + Intronic
1129812304 15:78520872-78520894 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1130340774 15:82998222-82998244 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1130883405 15:88073948-88073970 CAACCAGGCAGGAAGATGTGTGG + Intronic
1130903732 15:88225796-88225818 CAGGCAGGAGGAGGGATGGGAGG + Intronic
1130924160 15:88372708-88372730 CAGCCTGGAGGGAGAATGAGAGG + Intergenic
1130946495 15:88553163-88553185 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1131001255 15:88941563-88941585 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1131001380 15:88941841-88941863 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1131001404 15:88941891-88941913 CATCCGGGAGGGAGTGTGGGGGG - Intergenic
1131125291 15:89854103-89854125 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1131127236 15:89867972-89867994 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1131238321 15:90716682-90716704 CAAAGAGGAGGGAGGGCGGGAGG + Intergenic
1131293860 15:91130243-91130265 CAACTGGGAGAGAGGATGGGAGG + Intronic
1131318687 15:91366009-91366031 CAAAGAGGAGGAAGGATGAGGGG - Intergenic
1131338557 15:91573441-91573463 AAAGAAGGAGGGAGGAAGGGAGG + Intergenic
1131479258 15:92768155-92768177 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1132021249 15:98364355-98364377 CAATGAGGAGGGAGAATGGTAGG + Intergenic
1132592899 16:734079-734101 GAACCAGGAGGGAACAAGGGTGG + Intronic
1132681453 16:1144141-1144163 CAGCCAGGCGGGGAGATGGGAGG + Intergenic
1132770967 16:1563109-1563131 CAGGCAGTTGGGAGGATGGGCGG - Intronic
1132776792 16:1599356-1599378 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1132776997 16:1599812-1599834 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1132805349 16:1772726-1772748 AAACCTGCAGGGAGGAGGGGAGG + Intronic
1132882401 16:2168209-2168231 CCCCCAGGAGGGAGGATGGGGGG - Intronic
1132894152 16:2219969-2219991 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1132953905 16:2580940-2580962 CAGGCAGGGGGCAGGATGGGAGG - Intronic
1132960440 16:2619223-2619245 CAGGCAGGGGGCAGGATGGGAGG + Intergenic
1133077860 16:3293673-3293695 AAACCAGCAGGGAGGCTGGTGGG + Intronic
1133324545 16:4935293-4935315 CACGAAGGAGGGAGGCTGGGAGG + Intronic
1133752071 16:8733079-8733101 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1134082771 16:11335964-11335986 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1134104745 16:11477530-11477552 CACCCAGAAGGGAGGAGAGGAGG - Intronic
1134471818 16:14532763-14532785 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1135561611 16:23480883-23480905 CAACCTGGAGGCAGGAGGTGTGG - Intronic
1135639679 16:24109289-24109311 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1135681756 16:24463259-24463281 AAACAAGGAGGGAGGATAAGAGG + Intergenic
1136117049 16:28101136-28101158 CACCCAGGAGGGAGAACGGCAGG + Intronic
1136165271 16:28448927-28448949 CACCCGGGAGGGAGGTGGGGGGG + Intergenic
1136197703 16:28666093-28666115 CACCCGGGAGGGAGGTGGGGGGG - Intergenic
1136202210 16:28697874-28697896 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1136202447 16:28698436-28698458 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1136214041 16:28780230-28780252 CACCCGGGAGGGAGGTGGGGGGG - Intergenic
1136258777 16:29060154-29060176 CACCCGGGAGGGAGGTGGGGGGG - Intergenic
1136425810 16:30169035-30169057 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1136426274 16:30170086-30170108 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1136426374 16:30170311-30170333 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1136572207 16:31104613-31104635 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1136611492 16:31369241-31369263 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1137493531 16:48951959-48951981 CATCCGGGAGGGAGGTAGGGGGG + Intergenic
1137493578 16:48952056-48952078 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1137586835 16:49668762-49668784 CCCCCAGGAGGAAGGAGGGGTGG + Intronic
1138043528 16:53698477-53698499 CGTCCAGGAGGGAGGTTGGGGGG + Intronic
1138170553 16:54845227-54845249 CAAGGAGGAGGGAGGATGGGTGG + Intergenic
1138351368 16:56347843-56347865 AGACCAGGAGGCAGGAGGGGAGG - Exonic
1138400204 16:56739400-56739422 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1138400285 16:56739579-56739601 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1138467019 16:57200539-57200561 CATCCGGGAGGGAGGCAGGGAGG - Intronic
1138467220 16:57201014-57201036 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1138605676 16:58086674-58086696 GAGCCTGGAGGGAGGATGAGGGG + Intergenic
1139345465 16:66300284-66300306 CAACAAGGGTGGAGGATGGAGGG + Intergenic
1139374945 16:66491115-66491137 CTACCAGGAGAGAGCAGGGGAGG + Intronic
1139494732 16:67308134-67308156 AAGGAAGGAGGGAGGATGGGAGG - Intronic
1139521312 16:67484091-67484113 AAACCTGGAGGGAGAAAGGGAGG - Intergenic
1139771430 16:69280495-69280517 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1139846457 16:69924864-69924886 CACCCAGATGGGAGGTTGGGGGG + Intronic
1139864256 16:70051265-70051287 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1139864563 16:70051967-70051989 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1139885689 16:70205311-70205333 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1139943121 16:70620423-70620445 CCACCAGGTGTGAGGAGGGGAGG + Intronic
1139960561 16:70715122-70715144 CAACCTGGAGTGTGGCTGGGAGG - Intronic
1140009301 16:71114890-71114912 CAACCAGGAGGGTGCACAGGTGG - Intronic
1140056707 16:71531674-71531696 CAAGCAGGATGGAGGGAGGGAGG + Intronic
1140089615 16:71826964-71826986 AAACAAGGAGGAAGGTTGGGGGG + Intergenic
1140480677 16:75261375-75261397 CAGCCAGGAGGGTGAGTGGGGGG - Intronic
1140540465 16:75752066-75752088 GAACCAGTAGGGTGGATGGATGG - Intronic
1140994120 16:80243388-80243410 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1140994142 16:80243436-80243458 CATCCGGGAGGGAGGTAGGGGGG + Intergenic
1141167012 16:81667737-81667759 AACCCAGGAGGGAGGGAGGGAGG + Intronic
1141428269 16:83957399-83957421 CAACCAGGCCCGAGGAGGGGAGG + Intronic
1141624391 16:85253663-85253685 CTTCCAGGAAGGAGGCTGGGCGG - Intergenic
1141775821 16:86121952-86121974 CAAGGAGGAGGGAGGAAGGGAGG - Intergenic
1141951252 16:87341116-87341138 CACCCAGGAGTGAGGGTGAGAGG - Intronic
1142289717 16:89187992-89188014 GAGGCAGGAGGGAGGGTGGGAGG + Intronic
1142332420 16:89463033-89463055 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1142343763 16:89540780-89540802 CACCCAGGAGGGTGGATGCGGGG - Intronic
1142493388 17:292999-293021 CAGCCAGGATGGAGGACGTGGGG - Intronic
1142705095 17:1689516-1689538 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1142705146 17:1689643-1689665 CATCCAGGAGGGAGGTGGGGGGG - Intergenic
1142705191 17:1689741-1689763 CATCCGGGAGGGAGGTAGGGGGG - Intergenic
1142705213 17:1689789-1689811 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1142705238 17:1689838-1689860 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1142818637 17:2447561-2447583 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1142825441 17:2507311-2507333 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1142913111 17:3112519-3112541 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1142958191 17:3535278-3535300 CAGGAAGGAGGGAGGAAGGGAGG - Intronic
1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG + Exonic
1143206390 17:5143066-5143088 CATCCGGGAGGGAGGTCGGGGGG + Intronic
1143513498 17:7408146-7408168 GCCCCAGGAGGGAGGAGGGGCGG - Intronic
1143537406 17:7549397-7549419 CAAGGGGAAGGGAGGATGGGTGG + Intronic
1144481983 17:15637154-15637176 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1144510070 17:15867654-15867676 CATCCGGGAGGGAGGTGGGGAGG + Intergenic
1144536466 17:16095522-16095544 CATCCGGGAGGGAGGTTGGGGGG + Intronic
1144860472 17:18298365-18298387 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1145034596 17:19532431-19532453 GAACCAGAAGAGAGGAGGGGAGG + Intronic
1145174179 17:20685274-20685296 CATCCGGGAGGGAGGTGGGGAGG + Intergenic
1145205870 17:20984672-20984694 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1145205893 17:20984722-20984744 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1145206222 17:20985459-20985481 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1145206246 17:20985508-20985530 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1145253849 17:21312065-21312087 CACCCAGGAGCGAGGGTTGGGGG - Intronic
1145322741 17:21775895-21775917 CACCCAGGAGCGAGGGTTGGGGG + Intergenic
1145418185 17:22741453-22741475 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1145717225 17:27034006-27034028 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1145862982 17:28224264-28224286 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1145863055 17:28224411-28224433 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1145895667 17:28456146-28456168 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1146216108 17:30979813-30979835 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1146444239 17:32922435-32922457 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1146444363 17:32922708-32922730 CATCCAGGAGGGAGGTGGGGGGG - Intergenic
1146745377 17:35324105-35324127 CAACCAGGAGGGAGAAGAAGTGG - Intergenic
1146831158 17:36070583-36070605 CCCTCGGGAGGGAGGATGGGAGG + Intronic
1147172844 17:38631503-38631525 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1147480085 17:40752480-40752502 CAACCAGGAGGAAAGAAGGCTGG - Intronic
1147536457 17:41325574-41325596 TCACCAGGTGGGAGGGTGGGAGG + Intergenic
1147785089 17:42973175-42973197 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1147963327 17:44180535-44180557 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1147963378 17:44180636-44180658 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1148327255 17:46790448-46790470 CAACCTTGAGGGAGGGAGGGAGG - Intronic
1148404368 17:47398047-47398069 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1148853440 17:50565818-50565840 CTCCCAGGAGGGAGGAAAGGAGG + Intronic
1149625008 17:58074217-58074239 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
1149908909 17:60551457-60551479 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1149909100 17:60551908-60551930 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1150213988 17:63456765-63456787 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1150502057 17:65660410-65660432 AAAGAAGGAGGGAGGGTGGGAGG - Intronic
1151189373 17:72387047-72387069 GGCCCAGGAAGGAGGATGGGGGG + Intergenic
1151448476 17:74182399-74182421 CAAGCAGGGAGGAGGAAGGGTGG - Intergenic
1151460202 17:74249802-74249824 CAGCCAGGTGGGGGGGTGGGAGG + Intronic
1152020177 17:77776603-77776625 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1152206616 17:78977707-78977729 CAGCCTGGAGAGTGGATGGGAGG + Intronic
1152239019 17:79152029-79152051 GAAGCAGGAGGGGTGATGGGAGG + Intronic
1152295461 17:79464573-79464595 CAAGGAGAAGGGAGGAAGGGAGG + Intronic
1152696137 17:81797877-81797899 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1152818187 17:82421230-82421252 CATCCAGGAGGGTGCAGGGGAGG + Intronic
1152926731 17:83090828-83090850 CAACAAGGAGGGAGCACTGGGGG - Intronic
1153304552 18:3619995-3620017 TAAGCAGGTGGTAGGATGGGTGG + Intronic
1153605474 18:6827645-6827667 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1153634094 18:7098702-7098724 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1154122155 18:11660759-11660781 AAACCAGGAGGGAGGGAAGGGGG + Intergenic
1154123680 18:11671603-11671625 CACCCAGGAGGCAGGCAGGGAGG - Intergenic
1154265205 18:12874187-12874209 CATCTGGGAGGGAGGTTGGGGGG + Intronic
1154278250 18:12980037-12980059 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1154278345 18:12980248-12980270 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1154278422 18:12980424-12980446 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1154398235 18:14010816-14010838 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1154990144 18:21592432-21592454 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1155518085 18:26642869-26642891 CAACCTGCGGGGAGGGTGGGAGG + Intronic
1155882090 18:31162434-31162456 AGACTAGGAGTGAGGATGGGAGG - Intronic
1157098792 18:44711262-44711284 CAATCAGGAGGGAGGGAGAGAGG - Intronic
1157588407 18:48819960-48819982 CAACGAGGCCGGAGGATGGAAGG + Intronic
1157629426 18:49080594-49080616 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1157639867 18:49202886-49202908 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157639914 18:49202986-49203008 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1157639936 18:49203035-49203057 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157639986 18:49203162-49203184 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1157677207 18:49577700-49577722 CATCCGGGAGGGAGGTTGGGGGG - Intronic
1157677230 18:49577750-49577772 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1157677352 18:49578025-49578047 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1157863561 18:51162094-51162116 CATCCAGGTGGGAGGGTGGGAGG + Intergenic
1158148617 18:54343402-54343424 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1158436990 18:57440796-57440818 AAACGAGGTGGGAGGTTGGGGGG - Intronic
1158459311 18:57633014-57633036 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1158515493 18:58127113-58127135 CCGCCAGGAGGGAGGATGACAGG - Intronic
1158617987 18:59005441-59005463 GAATGAGGAGGGAGGAAGGGAGG + Intergenic
1159039255 18:63307814-63307836 GAAACAAGAGGGAGGAAGGGAGG + Intronic
1159164395 18:64683385-64683407 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1159915930 18:74187682-74187704 CAAGGAGGAGAGAGGAAGGGAGG - Intergenic
1160341033 18:78088854-78088876 CCTCCAGGAGGCAGGGTGGGTGG + Intergenic
1160395368 18:78566950-78566972 ACACCAGGAAGGTGGATGGGAGG - Intergenic
1160550987 18:79693808-79693830 CATCCTGCAGGGAGAATGGGAGG - Intronic
1160916527 19:1499374-1499396 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1161158806 19:2750036-2750058 AAAGCAGGAGGAAGGAAGGGAGG + Intergenic
1161238470 19:3209216-3209238 CAACCTGGAGGAAAGAGGGGTGG - Exonic
1161790293 19:6355733-6355755 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1161790340 19:6355831-6355853 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1162163910 19:8739600-8739622 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1162163963 19:8739727-8739749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1162556702 19:11391156-11391178 CCAGCAGGAGGGAGGAAAGGGGG + Intronic
1162583351 19:11544163-11544185 CAAGCGGAAGGGAAGATGGGAGG + Intronic
1162886895 19:13703433-13703455 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163458616 19:17423473-17423495 GGACCAGGAGGGAAGGTGGGAGG - Intronic
1163558435 19:18005674-18005696 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1163905625 19:20149458-20149480 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1163905861 19:20149998-20150020 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1163905883 19:20150047-20150069 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1164034732 19:21443576-21443598 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1164065044 19:21708052-21708074 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1164066568 19:21721448-21721470 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1164066641 19:21721623-21721645 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1164066666 19:21721672-21721694 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1164066692 19:21721721-21721743 CGTCCAGGAGGGGGGAGGGGGGG + Intergenic
1164105622 19:22106793-22106815 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1164106024 19:22107727-22107749 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1164186125 19:22871488-22871510 CATCCGGGAGGGAGGTGGGGAGG - Intergenic
1164192090 19:22926132-22926154 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1164192262 19:22926533-22926555 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1164192568 19:22927216-22927238 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
1164622834 19:29707517-29707539 AAACCAGGGAGGAGGCTGGGAGG - Intronic
1164652231 19:29899025-29899047 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1164652439 19:29899506-29899528 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1164669589 19:30064952-30064974 CCCCCAGGAGGGGGGATGGCAGG + Intergenic
1164809003 19:31141411-31141433 CAACCTGGGCGGAGGCTGGGAGG - Intergenic
1164913696 19:32032611-32032633 CAACCTTGAGGGCGGATGGAAGG - Intergenic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1165192937 19:34079448-34079470 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1165192983 19:34079547-34079569 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1165193005 19:34079596-34079618 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1165193027 19:34079645-34079667 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1165335572 19:35167400-35167422 AAACCAGGAGGGAGCAGGGGTGG + Intronic
1165832688 19:38737102-38737124 GAACCCGGAGGGTGGAGGGGCGG - Intronic
1165857553 19:38889049-38889071 CATCCTGGGAGGAGGATGGGCGG - Intronic
1166028154 19:40107816-40107838 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1166028297 19:40108141-40108163 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1166028549 19:40108719-40108741 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1166029852 19:40118172-40118194 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1166163014 19:40966396-40966418 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1166180183 19:41103140-41103162 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1166180233 19:41103238-41103260 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1166191704 19:41180496-41180518 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1166258408 19:41621385-41621407 CTGCCTGGAGGGAGGAAGGGAGG - Intronic
1166261676 19:41644988-41645010 CGTCCGGGAGGGAGGATGAGGGG + Intronic
1166417974 19:42610398-42610420 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1166425700 19:42676426-42676448 CATCCGGGAGGGAGGCGGGGGGG - Intronic
1166531956 19:43548093-43548115 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1166883936 19:45947314-45947336 CAAGCAGGAAGGCGAATGGGTGG + Intronic
1166991518 19:46695652-46695674 GAACCAGGAAGGAGGCTGAGGGG + Intronic
1167240371 19:48339683-48339705 CAGCCAGGAGGGAGTCTGGGAGG + Intronic
1167823718 19:51952959-51952981 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1167903251 19:52637844-52637866 CCACGAGGAGGGAGGTGGGGGGG + Intronic
1167937498 19:52920050-52920072 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1167970900 19:53187429-53187451 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1167970974 19:53187597-53187619 CATCCGGGAGGGAGGCGGGGGGG - Intronic
1168528400 19:57106551-57106573 CAGGCAGGAGGGAGGATGCAGGG - Intergenic
1168695957 19:58404871-58404893 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
925344833 2:3163818-3163840 CAGGGAGGTGGGAGGATGGGTGG + Intergenic
925403552 2:3591261-3591283 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
925421622 2:3717464-3717486 CGATCAGGAGGTGGGATGGGTGG - Intronic
925442914 2:3903796-3903818 CACACAGGAGGGAGGGCGGGTGG + Intergenic
925905214 2:8536130-8536152 GAACCAGGAGGGAAGTTTGGGGG - Intergenic
926106483 2:10155426-10155448 CAGCCCGGAGGGAGGAGTGGAGG + Intronic
926215303 2:10902583-10902605 CATCCGGGAGGGAGGTTGGGGGG - Intergenic
926215329 2:10902632-10902654 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
926283234 2:11466880-11466902 CAAACAGGAAGGAGGAAGGAAGG - Intergenic
926639545 2:15220085-15220107 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
926675018 2:15612143-15612165 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
926683301 2:15680171-15680193 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
926941024 2:18137049-18137071 AAACCAGGAAAGAGGATGTGGGG + Intronic
927715234 2:25347594-25347616 AAGTCAGGAGGGAGGATGGAAGG - Intergenic
927747268 2:25634056-25634078 CAGCCAGGAGGGAGGTGGGGGGG + Intronic
927757795 2:25723258-25723280 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
927833238 2:26370933-26370955 CATCCGGGAGGGAGGTGGGGGGG - Intronic
928002915 2:27539873-27539895 CATCCGGGAGGGAGGTGGGGGGG - Intronic
928003148 2:27540401-27540423 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
928003203 2:27540531-27540553 CGACCGGGAGGGAGGTGGGGGGG - Intronic
928005363 2:27557918-27557940 CATCCGGGAGGGAGGTGGGGGGG - Intronic
928070433 2:28209532-28209554 CAACTGAGAGGGAGGAGGGGAGG + Intronic
928278824 2:29926087-29926109 CAAGCAGGAGGGAGGTGAGGAGG + Intergenic
928542072 2:32293947-32293969 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
928558046 2:32447708-32447730 CGACCAGGAGGGAGGTGGGGGGG - Intronic
928596980 2:32868779-32868801 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
929151876 2:38755888-38755910 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
929416079 2:41747069-41747091 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
929445976 2:42001768-42001790 AAACCCGGAGGACGGATGGGCGG - Intergenic
929447705 2:42014413-42014435 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
929447801 2:42014638-42014660 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
929447825 2:42014687-42014709 CGTCCCGGAGGGAGGTTGGGGGG - Intergenic
929515959 2:42605571-42605593 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
929516005 2:42605669-42605691 CATCCGGGAGGGAGGTGGGGGGG - Intronic
929516031 2:42605718-42605740 CATCCAGGAGGGAGGTGGGGGGG - Intronic
929516080 2:42605845-42605867 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
929543986 2:42843817-42843839 AAATCAGGCTGGAGGATGGGTGG + Intergenic
929614758 2:43297934-43297956 CATCCGGGAGGGAGGTGGGGGGG + Intronic
930079121 2:47433102-47433124 CATCCGGGAGGGAGGCGGGGAGG - Intronic
930079320 2:47433611-47433633 CAGCCAGGAGAGAGGTGGGGGGG - Intronic
930079340 2:47433659-47433681 CATCCAGGAGGGAGATGGGGGGG - Intronic
930201479 2:48555326-48555348 CATCCGGGAGGGAGGTGGGGGGG - Intronic
930201598 2:48555602-48555624 CATCCGGGAGGGAGGTGGGGGGG - Intronic
930201866 2:48556173-48556195 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930201963 2:48556398-48556420 CATCCGGGAGGGAGGTGGGGGGG - Intronic
930202116 2:48556751-48556773 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930202217 2:48556977-48556999 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930306101 2:49676530-49676552 CAAGCAGGAGGGAGGAGGGATGG + Intergenic
930571069 2:53088089-53088111 CAACCAGGAAAGGGGAGGGGAGG + Intergenic
930665397 2:54095665-54095687 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
930755523 2:54968445-54968467 AAGCCAGAAGGGAGGATGGAGGG + Intronic
930821516 2:55651056-55651078 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
930833921 2:55773844-55773866 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
931576431 2:63722543-63722565 CATCCGGGAGGGAGGTGGGGGGG + Intronic
931639496 2:64369611-64369633 CCACCAGCAGGGAGGATAAGTGG + Intergenic
931656136 2:64512001-64512023 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
931656248 2:64512272-64512294 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
931752109 2:65339081-65339103 CGTCCGGGAGGGAGGTTGGGCGG + Intronic
931850353 2:66245683-66245705 CAACCAGGTGTGAGGAGGGGAGG - Intergenic
932215139 2:69961569-69961591 CAAGCAGGAGGGAGCAGGCGCGG + Exonic
932295783 2:70622374-70622396 CGACCAGGTGTGAGGAGGGGTGG - Intronic
932367279 2:71161267-71161289 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
932489076 2:72107119-72107141 CTACCAGGAGCGAGGTAGGGAGG + Intergenic
932719014 2:74124200-74124222 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
932807339 2:74795770-74795792 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
932807486 2:74796126-74796148 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
932863186 2:75315843-75315865 CAACAAGGAGAGAGGAGGGCTGG + Intergenic
933734995 2:85487886-85487908 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
933735133 2:85488237-85488259 CATCCGGGAGGGAGGCAGGGAGG + Intergenic
933735209 2:85488412-85488434 CATCCGGGAGGGAGGCAGGGGGG + Intergenic
933767098 2:85717409-85717431 GAACCATGAGGGAGGCTGCGGGG - Intergenic
934211607 2:89984533-89984555 AAAGCAGGGGTGAGGATGGGGGG + Intergenic
934309818 2:91852247-91852269 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
934514545 2:94977921-94977943 CTCCCAGGAGGGAAGATGAGAGG + Intergenic
934753004 2:96806084-96806106 CCTCCGGGAGGGAGGTTGGGGGG - Intronic
935414945 2:102805452-102805474 CAACAAGGTTGGAGGTTGGGTGG - Intronic
935858801 2:107304742-107304764 CAACCAGCAGGAAGGAAGGAAGG + Intergenic
936095500 2:109527975-109527997 CAGCCAGGCGGGAGGACGGGTGG + Intergenic
936416719 2:112322151-112322173 CAAGCAAGAGGGAGGGAGGGAGG - Intronic
936492752 2:112987018-112987040 TAGCCAGGAGGAGGGATGGGGGG - Intergenic
936500025 2:113059542-113059564 TGAGCAGGAGGGAGGAAGGGAGG + Intronic
936546177 2:113394433-113394455 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
936718279 2:115216147-115216169 CAGAAAGGTGGGAGGATGGGAGG + Intronic
937000803 2:118465654-118465676 AAAGCAGGAGGGAGGGAGGGAGG - Intergenic
937291564 2:120785158-120785180 CTGCCAGGAGGGAGGGAGGGTGG + Intronic
937919488 2:127119839-127119861 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
938006088 2:127788703-127788725 CATCCGGGAGGGAGGTGGGGGGG - Intronic
938088807 2:128418605-128418627 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
938089108 2:128419306-128419328 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
938533865 2:132221304-132221326 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
938665817 2:133535284-133535306 CCAAAGGGAGGGAGGATGGGAGG - Intronic
938891191 2:135707011-135707033 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
939578417 2:143921991-143922013 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
939578442 2:143922040-143922062 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
940635610 2:156293675-156293697 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
940643465 2:156368816-156368838 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
941023900 2:160439021-160439043 CGTCCAGGAGGGAGATTGGGGGG - Intronic
941197636 2:162470606-162470628 CATCCGGGAGGGAGGTGGGGGGG + Intronic
941602955 2:167563541-167563563 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
941768784 2:169327118-169327140 CATCCGGGAGGGAGGTGGGGGGG + Intronic
941768808 2:169327167-169327189 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
941768832 2:169327216-169327238 CATCCGGGAGGGAGGTGGGGGGG + Intronic
941786778 2:169506113-169506135 CGTCCAGGAGGGAGGTGGGGGGG + Exonic
941814725 2:169786375-169786397 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
942073663 2:172337397-172337419 CCACCAAGAGGGAGGGTGTGAGG + Intergenic
942096246 2:172538119-172538141 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
942602821 2:177658535-177658557 AAAGAAGGAGGGAGGAAGGGAGG - Intronic
942630226 2:177945811-177945833 CATCCGGGAGGGAGGTGGGGGGG + Intronic
942754076 2:179319588-179319610 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
942790082 2:179751257-179751279 CACCAAGGAGTGAGGATGTGTGG - Intronic
943323475 2:186473102-186473124 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
943323649 2:186473506-186473528 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
943997486 2:194788726-194788748 CTACCAGCAAGAAGGATGGGAGG + Intergenic
944262959 2:197696191-197696213 CATCCGGGAGGGAGGTGGGGGGG - Intronic
944532934 2:200683687-200683709 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
944598551 2:201283098-201283120 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
944598697 2:201283447-201283469 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
944601485 2:201308075-201308097 CAAACAAGAGGAAGGAGGGGTGG + Intronic
944732999 2:202535137-202535159 CATCCGGGAGGGAGGTGGGGGGG - Intronic
944797978 2:203207272-203207294 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
945114860 2:206400744-206400766 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
945115059 2:206401222-206401244 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
945233104 2:207610952-207610974 CATCCGGGAGGGAGGTGGGGGGG + Exonic
945835718 2:214835324-214835346 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
945970288 2:216226402-216226424 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
945970313 2:216226451-216226473 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
945974938 2:216263104-216263126 CATCCAGAAGGGAAAATGGGTGG + Intronic
946135113 2:217639608-217639630 AAAGAAGGAGGGAGGAAGGGGGG + Intronic
946316738 2:218920829-218920851 AAAGAAGGAGGGAGGATGGGAGG - Intergenic
946318175 2:218931661-218931683 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
946318296 2:218931960-218931982 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
946742823 2:222816901-222816923 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
946751396 2:222896978-222897000 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
948456279 2:238106038-238106060 AAAGCAGGAGTGAGGATGGTCGG - Intronic
948593115 2:239063796-239063818 CAGACAGGAGGGAGGTTCGGTGG - Intronic
948689705 2:239694168-239694190 CACCCGGGAGGGAGGAAGTGGGG + Intergenic
948878977 2:240846185-240846207 CAGCCAGGTGGGGGGAGGGGAGG + Intergenic
1168965436 20:1895337-1895359 CAGCCGGGAGGGGGGAAGGGGGG + Intronic
1169085792 20:2824174-2824196 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1169085867 20:2824349-2824371 CGCCCAGGAGGGAGGTGGGGGGG + Intergenic
1169085892 20:2824398-2824420 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1169247077 20:4033083-4033105 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1169527291 20:6443128-6443150 AAACCAGAAGGAAGGAAGGGAGG - Intergenic
1169546548 20:6656442-6656464 CAGCCATGAGGCTGGATGGGGGG + Intergenic
1169732468 20:8801342-8801364 TAAACAGGAGAGAGGATGGCAGG - Intronic
1169758725 20:9068737-9068759 GAACGAGGAGGGAGGCTCGGGGG + Intergenic
1170424946 20:16227703-16227725 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1170424968 20:16227752-16227774 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1170619983 20:17987848-17987870 CGACCAGGATAGGGGATGGGGGG + Intronic
1170811540 20:19678517-19678539 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1171861333 20:30405244-30405266 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1171861374 20:30405342-30405364 CATCCGGGAGGGAGGTGGGGTGG + Intergenic
1171861398 20:30405391-30405413 CCTCCAGGAGGGAGGTGGGGGGG + Intergenic
1172059088 20:32176225-32176247 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172141262 20:32724126-32724148 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1172240998 20:33412438-33412460 AAAACAGCAGTGAGGATGGGTGG + Intronic
1172279480 20:33699670-33699692 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172279554 20:33699845-33699867 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172279628 20:33700020-33700042 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172337960 20:34132727-34132749 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1172338012 20:34132854-34132876 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172348597 20:34223530-34223552 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1172349359 20:34229492-34229514 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1172349682 20:34230245-34230267 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1172349885 20:34230725-34230747 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1172402118 20:34659187-34659209 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1172465677 20:35153942-35153964 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1172720299 20:36994874-36994896 CAGCCGGGAGGGAAGCTGGGAGG + Intergenic
1172721031 20:37000401-37000423 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1172721177 20:37000754-37000776 CGTCCAGGAGGGAGGCGGGGGGG + Intronic
1172721229 20:37000881-37000903 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1172721282 20:37001008-37001030 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1172721306 20:37001058-37001080 CATCCGGGAGGGAGGCGGGGAGG + Intronic
1172728950 20:37069781-37069803 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1172778604 20:37422760-37422782 GAAGGAGGAGGGAGGAAGGGCGG - Intergenic
1172907251 20:38378943-38378965 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1173273064 20:41555239-41555261 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1173646959 20:44639340-44639362 CCTCCAGGAGGGAGGATGCGGGG + Intronic
1173648449 20:44648254-44648276 AAACCAGGTGGGGGTATGGGAGG + Intronic
1173769576 20:45645957-45645979 CACCCGGGAGGGAGGTGGGGGGG - Intergenic
1174020458 20:47525568-47525590 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1174020611 20:47525894-47525916 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1174218611 20:48935825-48935847 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1174469347 20:50744640-50744662 AAAGCAGGAGGGAGGGAGGGAGG - Intronic
1174878407 20:54250744-54250766 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1175361345 20:58414228-58414250 CGTCCAGGAGGGAGGTTGGGGGG - Intronic
1175361366 20:58414277-58414299 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1175374713 20:58516054-58516076 GAACCAGGAAGGAGGAGGGAGGG + Intergenic
1175695450 20:61099812-61099834 CAACGAGGTGGGATGAGGGGAGG - Intergenic
1176087266 20:63303844-63303866 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087309 20:63304004-63304026 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087355 20:63304164-63304186 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087367 20:63304204-63304226 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087379 20:63304244-63304266 GCACCTGGAGGGAGGAAGGGAGG - Intronic
1176087392 20:63304284-63304306 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087415 20:63304364-63304386 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087428 20:63304404-63304426 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087441 20:63304444-63304466 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087464 20:63304524-63304546 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087476 20:63304564-63304586 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087499 20:63304644-63304666 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176123875 20:63466485-63466507 AGGCCAGGAGGGAGGATGGCTGG - Intronic
1177175860 21:17700141-17700163 CAACCAGCAGAGTGGGTGGGAGG + Intergenic
1177178326 21:17720192-17720214 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1177178494 21:17720592-17720614 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1177788271 21:25695605-25695627 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1178034444 21:28564149-28564171 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1178075703 21:29011876-29011898 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1178075727 21:29011925-29011947 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1178075801 21:29012101-29012123 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1178690662 21:34746991-34747013 CAGGCAGGAGGGCAGATGGGAGG - Intergenic
1178812639 21:35897842-35897864 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1178903008 21:36612843-36612865 AAAGCAGGAAGGAGGATGAGTGG - Intergenic
1178966650 21:37126450-37126472 CTAGCAGGTGGGAGGAAGGGAGG - Intronic
1179021825 21:37647751-37647773 CAGCCAGGAGGGAACAAGGGAGG - Intronic
1179055931 21:37934096-37934118 CACCTATGAGGGAGGCTGGGAGG - Intergenic
1179655139 21:42839972-42839994 CCCCCAGGGGGGTGGATGGGAGG + Intergenic
1179720909 21:43315603-43315625 CAGCCAGGAGGGAGGCTGGCAGG + Intergenic
1179969309 21:44825198-44825220 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1179969334 21:44825247-44825269 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1180244645 21:46538989-46539011 AAACCAGGAGGGAGAATGGTTGG - Intronic
1180840504 22:18956863-18956885 CAAACAGGCGGGGGGCTGGGGGG - Intergenic
1181119726 22:20657806-20657828 CAAGCAGGAGGGGGGAAGGAGGG + Intergenic
1181301457 22:21883796-21883818 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1181586190 22:23854794-23854816 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1181586314 22:23855067-23855089 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1181657745 22:24317090-24317112 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1181982171 22:26773386-26773408 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1182001891 22:26926571-26926593 CAGCCAGGAGTAAGGAGGGGTGG + Intergenic
1182126084 22:27816823-27816845 AAAAAAGGAGGGAGGAAGGGAGG - Intergenic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1182282131 22:29224022-29224044 CACCCAGGATGGAGGAAGGTGGG - Intronic
1182343538 22:29643924-29643946 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1182459461 22:30473390-30473412 GAGCCAGGAGGGAGGGTTGGGGG + Intergenic
1182616413 22:31592233-31592255 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1182616613 22:31592685-31592707 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1182745945 22:32605668-32605690 CATGCAGGAGGGAGCAGGGGCGG - Intronic
1182796590 22:32995523-32995545 CCACGTGGAGGAAGGATGGGGGG - Intronic
1182976219 22:34626007-34626029 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1183120022 22:35723057-35723079 CCTCCAGGAGGGAGGAGGGAGGG + Intronic
1183185829 22:36291040-36291062 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1183341864 22:37285971-37285993 CAACCAGAAGGGAGTATGAAAGG + Intronic
1183432433 22:37773822-37773844 CATCCAGGAGGGAAGGAGGGCGG - Exonic
1183595280 22:38807238-38807260 CATCCGGGAGGGAGGTCGGGGGG + Intergenic
1183665122 22:39242529-39242551 CACCCGGGAGGGAGGACGCGGGG - Intronic
1183797453 22:40131530-40131552 TAATCAGGAGAGAGGAGGGGAGG - Intronic
1183841004 22:40501027-40501049 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1183841355 22:40501859-40501881 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1183871549 22:40745188-40745210 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1183871574 22:40745237-40745259 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1183871649 22:40745412-40745434 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1183941031 22:41295010-41295032 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1183995630 22:41631096-41631118 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1184241201 22:43212130-43212152 CATCTAGAAGGGAGGTTGGGAGG - Intronic
1184250367 22:43256773-43256795 GAGACAGGAGGGAGGCTGGGTGG + Intronic
1184455037 22:44605272-44605294 CACCCAGCAGGGAGCATGCGGGG - Intergenic
1184606177 22:45576029-45576051 CAACCATGCGGGGGGGTGGGGGG + Intronic
1184627127 22:45744016-45744038 CAACCAGGAGGGAGTCTAAGGGG - Intronic
1184669402 22:46004886-46004908 CCATCAGAATGGAGGATGGGAGG - Intergenic
1185010440 22:48309689-48309711 CACCCAGCAGGGTGGGTGGGTGG + Intergenic
949569956 3:5283860-5283882 CGTCCAGGAGGGAGGCGGGGGGG - Intergenic
950005375 3:9687980-9688002 CAACAAGCAGGGAGGCAGGGCGG - Intronic
950247844 3:11438262-11438284 GACCCTGGATGGAGGATGGGTGG - Intronic
950253665 3:11487644-11487666 CATCCGGGAGGGAGGTGGGGGGG - Intronic
950327172 3:12121699-12121721 CAGGGAGGAGGGAGGAAGGGAGG + Intronic
950398739 3:12753966-12753988 CAACCAGGAGGGAGGCAGACTGG + Intronic
950439646 3:13001978-13002000 GAACCCGGAGGCAGGGTGGGGGG + Intronic
950577290 3:13839891-13839913 CAGCCAGGAGGGAGCAGGGCTGG + Intronic
950742591 3:15062428-15062450 CATCCGGGAGGGAGGTGGGGGGG + Intronic
950754705 3:15162844-15162866 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
950949015 3:16979972-16979994 CATCCAGGAGGGAGGTTGGGGGG - Intronic
951013374 3:17704879-17704901 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
951013558 3:17705299-17705321 CATCCGGGAGGGAGGTGGGGGGG - Intronic
952154688 3:30629993-30630015 AAACCATGGGGGAGGAGGGGAGG - Intronic
952582173 3:34847329-34847351 CTACCAGAAGTGAGGATGGATGG - Intergenic
952590153 3:34942660-34942682 CAAGGAGGAGAGAGGTTGGGAGG - Intergenic
952826555 3:37529755-37529777 GAGACAAGAGGGAGGATGGGAGG + Intronic
952896331 3:38081449-38081471 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
952896502 3:38081847-38081869 CATCCGGGAGGGAGGTGGGGGGG - Intronic
953201105 3:40779535-40779557 CAACAAGGAGATAGGATGGGAGG - Intergenic
953257650 3:41306167-41306189 CATCCGGGAGGGAGGTGGGGGGG + Intronic
953257723 3:41306331-41306353 CATCCGGGAGGGAGGTGGGGGGG + Intronic
953257799 3:41306507-41306529 CATCCGGGAGGGAGGTGGGGGGG + Intronic
953426091 3:42797940-42797962 CATCCGGGAGGGAGGTGGGGGGG + Intronic
953652626 3:44821034-44821056 CATCCGGGAGGGAGGTGGGGGGG - Intronic
953652725 3:44821260-44821282 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
953864669 3:46573893-46573915 CAAGGGGGAGGGAGGAGGGGCGG + Intronic
954059562 3:48056600-48056622 CATCCGGGAGGGAGGTGGGGGGG + Intronic
954080674 3:48211421-48211443 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
954080724 3:48211521-48211543 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
954080746 3:48211570-48211592 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
954081109 3:48212390-48212412 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
954081133 3:48212439-48212461 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
954162901 3:48734671-48734693 CATCCTGGAGGGAGGTGGGGGGG + Intronic
954399364 3:50311625-50311647 CATCCGGGAGGGAGGTGGGGGGG - Intronic
954399389 3:50311674-50311696 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
954523547 3:51249486-51249508 CATCCGGGAGGGAGGTGGGGGGG + Intronic
954599881 3:51859012-51859034 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
955297421 3:57747615-57747637 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
955674465 3:61434729-61434751 CATCCGGGAGGGAGGTAGGGGGG - Intergenic
955674511 3:61434826-61434848 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
955699736 3:61671773-61671795 CATCCGGGAGGGAGGTGGGGGGG - Intronic
956178324 3:66495279-66495301 GAGACAGGAGGGAGGACGGGTGG - Intronic
956270389 3:67443995-67444017 CATCCGGGAGGGAGGTGGGGGGG + Intronic
956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG + Intergenic
956726876 3:72163646-72163668 CATAAAGCAGGGAGGATGGGGGG - Intergenic
957316590 3:78583038-78583060 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
957316743 3:78583390-78583412 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
957463318 3:80552113-80552135 CTACCAGGTGGGAAGATGGCTGG + Intergenic
957620315 3:82585055-82585077 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
958560936 3:95745371-95745393 CACCCCGGAGGGAGGTGGGGTGG + Intergenic
958808612 3:98837521-98837543 CATCCGGGAGGGAGGTGGGGGGG - Intronic
958808761 3:98837873-98837895 CATCCGGGAGGGAGGTGGGGGGG - Intronic
958957241 3:100477591-100477613 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
958957288 3:100477689-100477711 CATCCGGGAGGGAGGTCGGGGGG - Intergenic
958957362 3:100477865-100477887 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
959042687 3:101439482-101439504 CATCCGGGAGGGAGGTGGGGGGG + Intronic
959415674 3:106074803-106074825 CATCCAGGAGGGAGGTGGGGGGG - Intergenic
959419152 3:106111390-106111412 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
959683886 3:109124442-109124464 CATCCAGGAGGGAGGTAGGGGGG + Intergenic
959984314 3:112556386-112556408 CATCCGGGAGGGAGGTGGGGGGG + Intronic
960029975 3:113046450-113046472 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
960030070 3:113046676-113046698 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
960316682 3:116186959-116186981 CAACCAGGTGGTGGGAGGGGTGG + Intronic
960426407 3:117513228-117513250 CAAGCAGGAGGGAGGACAAGAGG - Intergenic
960780481 3:121313444-121313466 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
960862092 3:122164688-122164710 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
960862241 3:122165041-122165063 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
960862331 3:122165263-122165285 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
960924138 3:122780141-122780163 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
960960349 3:123066633-123066655 TAAGCAGGAGGGAGTCTGGGAGG + Intergenic
961120145 3:124366887-124366909 CATCCGGGAGGGAGGTGGGGGGG - Intronic
961120222 3:124367065-124367087 CATCCGGGAGGGAGGTGGGGGGG - Intronic
961120502 3:124367694-124367716 CATCCGGGAGGGAGGTGGGGGGG - Intronic
961163733 3:124750215-124750237 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
961163887 3:124750569-124750591 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
961337130 3:126187315-126187337 TAACCAGAAGGAAGGAAGGGAGG + Intronic
961347716 3:126274846-126274868 GAAGCAGAAGGGAGGATGGAAGG - Intergenic
961604832 3:128085861-128085883 CTAGCAGGAGGGAAGCTGGGTGG + Intronic
961614308 3:128166773-128166795 CAAGCAGGAGGGAGAAGGCGTGG - Intronic
961729293 3:128954597-128954619 CATCCGGGAGGGAGGTGGGGGGG + Intronic
961729706 3:128955535-128955557 CATCCGGGAGGGAGGTGGGGGGG + Intronic
961788997 3:129363237-129363259 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
961789022 3:129363286-129363308 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
961962482 3:130868231-130868253 CATCCGGGAGGGAGGTGGGGGGG + Intronic
961962531 3:130868358-130868380 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
961965117 3:130894173-130894195 CGAGCGGGAGGGAGGAAGGGAGG - Intronic
962063273 3:131952554-131952576 CATCCGGGAGGGAGGTGGGGGGG + Intronic
962112983 3:132471248-132471270 CATCCGGGAGGGAGGTGGGGGGG - Intronic
962245157 3:133785332-133785354 CATCCGGGAGGGAGGTGGGGGGG + Intronic
962527093 3:136246638-136246660 CCACAAGGAGTGAGGATGGATGG - Intergenic
962572385 3:136723963-136723985 CGACCAGGAGGGAGGTGGGGGGG + Intronic
962847660 3:139286013-139286035 CAAAGAGGAGAGAGGATGGGTGG - Intronic
963244413 3:143047002-143047024 CATCCAGGAGGGAGGTGGGGGGG - Intronic
963244613 3:143047452-143047474 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
963244793 3:143047885-143047907 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
965119157 3:164529005-164529027 CAAATAGGAGGGAAGAAGGGAGG - Intergenic
966253416 3:177891712-177891734 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
966359628 3:179120101-179120123 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
966359750 3:179120376-179120398 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
966360072 3:179121102-179121124 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
966360097 3:179121151-179121173 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
966783920 3:183608279-183608301 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
966784122 3:183608727-183608749 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
967177649 3:186874374-186874396 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
967177670 3:186874423-186874445 CATCCAGGAGGGAGGCGGGGAGG + Intergenic
967419776 3:189260146-189260168 TAAACTGGAGGGAGGAGGGGAGG + Intronic
968316758 3:197731754-197731776 CATCCGGGAGGGAGGTGGGGGGG - Intronic
968429819 4:550475-550497 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
968591241 4:1460631-1460653 AAACAAGGAGGGAGGAGGGAAGG - Intergenic
968666985 4:1827924-1827946 CATCCGGGAGGGAGGTTGGGGGG - Intronic
968667277 4:1828561-1828583 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
968667330 4:1828688-1828710 CATCCGGGAGGGAGGTTGGGGGG - Intronic
968667489 4:1829044-1829066 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
968667621 4:1829351-1829373 CATCCGGGAGGGAGGTGGGGGGG - Intronic
968747654 4:2369160-2369182 TCACCAGGAGGAAGGATGGCAGG - Intronic
968817178 4:2828199-2828221 CAATAGGGAGGGAGGAAGGGAGG - Intronic
968924126 4:3538531-3538553 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
968924148 4:3538580-3538602 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
968924246 4:3538834-3538856 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
968938127 4:3624284-3624306 TGACCAGCAGGCAGGATGGGTGG + Intergenic
969293113 4:6253107-6253129 CACCCAGCAGGGAGGAAGGAAGG + Intergenic
969374816 4:6756019-6756041 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
969404232 4:6978101-6978123 CATCCGGGAGGGAGGTGGGGGGG + Intronic
969695415 4:8731513-8731535 CCACCAGGAGGCAGCATGGCTGG + Intergenic
970110814 4:12636035-12636057 CAACAGGAAGGGAGGAAGGGAGG - Intergenic
970472567 4:16393165-16393187 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
970472592 4:16393215-16393237 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
970472662 4:16393383-16393405 CGACCGGGAGGGAGGTGGGGGGG - Intergenic
970472712 4:16393483-16393505 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
971257551 4:25029119-25029141 CAACCAGGAGGCAAGATGCTTGG + Intronic
972288288 4:37668990-37669012 CATCCAGGAGAGAGGTGGGGGGG + Intronic
972412486 4:38807815-38807837 CATCCGGGAGGGAGGTGGGGGGG + Intronic
972551739 4:40141223-40141245 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
972925211 4:43996666-43996688 CAAAAAAGTGGGAGGATGGGAGG + Intergenic
973109277 4:46377969-46377991 CATCCAGGAGGGAGGTGGGGGGG + Intronic
973263449 4:48186797-48186819 CATCTGGGAGGGAGGTTGGGGGG + Intronic
973274440 4:48292662-48292684 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
973593716 4:52465588-52465610 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
973593872 4:52465945-52465967 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
973672947 4:53238057-53238079 CATCCGGGAGGGAGGTGGGGGGG - Intronic
973673050 4:53238310-53238332 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
973673094 4:53238407-53238429 CATCCGGGAGGGAGGTAGGGGGG - Intronic
973673116 4:53238455-53238477 CATCCGGGAGGGAGGTGGGGGGG - Intronic
973673140 4:53238503-53238525 CATCCGGGAGGGAGGTGGGGGGG - Intronic
973785000 4:54325575-54325597 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
974021173 4:56693491-56693513 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
974588859 4:63918579-63918601 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
975042528 4:69762299-69762321 CATCCAGGAGGGAGGTGGGGGGG + Intronic
975633514 4:76423639-76423661 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
975685660 4:76917032-76917054 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
975686013 4:76917830-76917852 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
975816507 4:78222607-78222629 CAAACAGTAGGTGGGATGGGTGG + Intronic
976265136 4:83182415-83182437 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
976265161 4:83182464-83182486 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
976265763 4:83185679-83185701 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
976598659 4:86917593-86917615 AAAGAAGGAGGGAGGAAGGGAGG + Intronic
978061408 4:104344776-104344798 CATGCAGGAGGGAGGCTGGGAGG + Intergenic
978123570 4:105110298-105110320 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
978409160 4:108409676-108409698 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
979622479 4:122812252-122812274 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
979622578 4:122812506-122812528 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
979641406 4:123015815-123015837 CATCCGGGAGGGAGGTGGGGGGG - Intronic
979641485 4:123015991-123016013 CATCCAGGAGGAAGGTAGGGGGG - Intronic
979740234 4:124140917-124140939 CAACCAAAAGGGAGGACAGGTGG + Intergenic
980894954 4:138853232-138853254 GAAGCAGGAGGGAGGAAGAGAGG + Intergenic
980895192 4:138854323-138854345 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
981524271 4:145694532-145694554 CATCCGGGAGGGAGGTGGGGGGG + Intronic
981970508 4:150659708-150659730 CATCCGGGAGGGAGGTGGGGGGG + Intronic
982040490 4:151391153-151391175 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
982053498 4:151526441-151526463 CATCCGGGAGGGAGGTGGGGGGG - Intronic
982053596 4:151526666-151526688 CGTCCGGGAGGGAGGAGGGGGGG - Intronic
982227284 4:153177758-153177780 AAGGAAGGAGGGAGGATGGGAGG - Intronic
982615622 4:157636458-157636480 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
982615933 4:157637185-157637207 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
982784384 4:159523691-159523713 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
982784555 4:159524091-159524113 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
982784750 4:159524538-159524560 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
982820650 4:159939220-159939242 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
983190320 4:164747433-164747455 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
983507285 4:168567793-168567815 CCAAAAGGTGGGAGGATGGGAGG + Intronic
983628806 4:169828588-169828610 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
983664709 4:170167926-170167948 CCTCCTGGAGGGAGGATGTGAGG - Intergenic
984004854 4:174294985-174295007 CATCCGGGAGGGAGGTGGGGGGG - Intronic
984533641 4:180945246-180945268 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
984595120 4:181657982-181658004 CTAAAAGGAGGGAGGAAGGGAGG + Intergenic
984803587 4:183735499-183735521 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
984804009 4:183736463-183736485 CATCCGGGAGGGGGGAGGGGGGG - Intergenic
984935182 4:184883478-184883500 GGAACAGGAGGGAGGAGGGGAGG + Intergenic
984977071 4:185240400-185240422 CATCCGGGAGGGAGGTGGGGGGG - Intronic
985011281 4:185584723-185584745 CATCCAGGTGGGTGGAAGGGCGG - Intergenic
985170067 4:187139237-187139259 CAACCATGAATGAGGATGCGTGG + Intergenic
985701867 5:1378305-1378327 CTACCAGTAAGGAGCATGGGAGG - Intergenic
985736486 5:1586312-1586334 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
986058792 5:4167463-4167485 CAAGCAGAAGGCAGAATGGGAGG + Intergenic
986388807 5:7265337-7265359 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
986905704 5:12491588-12491610 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
987267960 5:16276989-16277011 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
987280445 5:16408283-16408305 CTACCAGCAGCCAGGATGGGAGG - Intergenic
988197061 5:28017336-28017358 CAAGCAGCAGGGAGGAAGGAAGG + Intergenic
988544508 5:32142810-32142832 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
988552045 5:32208183-32208205 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
988760589 5:34306713-34306735 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
989021364 5:37013047-37013069 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989048468 5:37295860-37295882 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
989048521 5:37295987-37296009 CATCCGGGAGGGAGGAGGGGGGG + Intronic
989075744 5:37563131-37563153 CATCCGGGAGGGAGGCCGGGAGG - Intronic
989075767 5:37563180-37563202 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989076419 5:37568147-37568169 GAGCCAGGTGGGTGGATGGGTGG - Intronic
989211271 5:38861751-38861773 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989232694 5:39104073-39104095 AAGGCAGGAGGGAGGATGGTTGG + Intergenic
989379702 5:40800532-40800554 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
989523050 5:42423663-42423685 AAACGGGAAGGGAGGATGGGAGG - Intergenic
989587936 5:43088176-43088198 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
989587987 5:43088303-43088325 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
990320716 5:54627654-54627676 CAAGCAGGAGGGAGCACGTGGGG + Intergenic
990368496 5:55093770-55093792 CAGCCAGGAGGAAGGGAGGGAGG + Intergenic
990458995 5:56014939-56014961 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
990498648 5:56372836-56372858 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
991298667 5:65106361-65106383 CAAGCAGGAGTGAGGATGTGAGG - Intergenic
991376961 5:65977201-65977223 CATCCGGGAGGGAGGTGGGGGGG - Intronic
991376986 5:65977250-65977272 CATCCGGGAGGGAGGTGGGGGGG - Intronic
991723636 5:69515639-69515661 CATCCGGGAGGGAGGTGGGGGGG - Intronic
991907233 5:71525544-71525566 CATCCGGGAGGGAGGTGGGGAGG - Intronic
992290097 5:75271468-75271490 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
992574578 5:78097045-78097067 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
992964020 5:81983240-81983262 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
992964140 5:81983516-81983538 CATCCGGGAGGGAGGTGGGGGGG - Intronic
992978143 5:82139923-82139945 CATCCGGGAGGGAGGTGGGGGGG + Intronic
993657701 5:90595568-90595590 CATCTGGGAGGGAGGTTGGGGGG - Intronic
993657844 5:90595892-90595914 CATCCGGGAGGGAGGTGGGGGGG - Intronic
994353754 5:98773543-98773565 CAACCAATGGGGAGGAAGGGAGG + Intronic
994927448 5:106135857-106135879 GAACAAGGAGGGAGGAAGGGAGG - Intergenic
995023632 5:107394620-107394642 CAAACAGTGGGTAGGATGGGTGG - Intronic
995123474 5:108559009-108559031 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
995163144 5:109005302-109005324 CAAGCAGGAGAGAGGATAGAAGG + Intronic
995193914 5:109342814-109342836 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
995544735 5:113218453-113218475 CAACCAGGAGGGCAGAAGGTGGG + Intronic
995561606 5:113388000-113388022 CTGCCAGCAGGGAGGAAGGGTGG - Intronic
995942193 5:117599611-117599633 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
995942318 5:117599886-117599908 CATCCGGGAGGGAGGTCGGGGGG - Intergenic
996069860 5:119122043-119122065 CGACCGGGAGGGAGGTTGGGGGG - Intronic
996306521 5:122053671-122053693 CTACCAGTGGTGAGGATGGGTGG + Intronic
997622370 5:135307200-135307222 CACCAAGGAGGCAGGATGTGAGG + Intronic
997813730 5:136996516-136996538 AAACCAGGATGGAGGGCGGGAGG - Intronic
997860520 5:137411327-137411349 CAAGCAGGAGGCAAGATGGAGGG + Intronic
997874685 5:137537629-137537651 CATCCAGGAGGGAGGTGGGGGGG - Intronic
997892237 5:137687005-137687027 CATCCGGGAGGGAGGTGGGGGGG + Intronic
997930855 5:138070579-138070601 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
998053727 5:139056629-139056651 CATCAAGGAGGGAGGTGGGGGGG + Intronic
998066442 5:139163080-139163102 CAAGCAGAAGGGAGTAGGGGAGG + Intronic
998133776 5:139664179-139664201 CAGGGAGGAGGGTGGATGGGTGG + Intronic
998504981 5:142665306-142665328 CACCCAGAACGGAGGATGGAAGG - Intronic
998693779 5:144615339-144615361 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
999142413 5:149371302-149371324 CATCCAGGACTGAGGATGTGTGG - Intronic
999180931 5:149670153-149670175 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
999180997 5:149670316-149670338 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
999214009 5:149916389-149916411 CACCCTGCAGGGAGGATGGCTGG - Intronic
999603873 5:153296257-153296279 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
999604059 5:153296705-153296727 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1000159361 5:158583068-158583090 CGACCGGGAGGGAGGTCGGGGGG + Intergenic
1000341305 5:160279204-160279226 CAAGCAGGATGAAGGATGGAGGG + Intronic
1000786657 5:165553092-165553114 CAAGAAGGATGGAGGATGGATGG - Intergenic
1000985827 5:167860351-167860373 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1001394167 5:171404138-171404160 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1001568389 5:172714929-172714951 CACCCAGGAGTGGGGATTGGAGG - Intergenic
1001895342 5:175374593-175374615 TCAGAAGGAGGGAGGATGGGAGG - Intergenic
1002014062 5:176305967-176305989 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1002014086 5:176306016-176306038 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1002115845 5:176961623-176961645 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1002205526 5:177560227-177560249 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1002658304 5:180771340-180771362 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1002804965 6:564597-564619 CAAGCAGTACGGAGGCTGGGAGG - Exonic
1003430240 6:6031741-6031763 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1003506126 6:6741849-6741871 CAGCCAGGAGGGATTATGGCTGG - Intergenic
1003664948 6:8102246-8102268 CCTCCAGGAGGTAGGATGGCAGG + Intronic
1004160228 6:13206147-13206169 GCACCAGGAGGGAGGACGGGAGG + Intronic
1004388142 6:15189120-15189142 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1004388244 6:15189346-15189368 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1004664183 6:17735525-17735547 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1004664206 6:17735574-17735596 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1005069606 6:21851580-21851602 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1005069795 6:21851998-21852020 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1005158801 6:22836636-22836658 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1005158852 6:22836763-22836785 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1005644399 6:27826950-27826972 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1005837333 6:29718997-29719019 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1005865402 6:29932924-29932946 CATCCGGGAGGGAGGTTGGGGGG + Intergenic
1005865479 6:29933101-29933123 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1005982648 6:30848221-30848243 CAACCTCGACGGAGGGTGGGAGG - Intergenic
1006064536 6:31454413-31454435 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006064713 6:31454815-31454837 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006064765 6:31454942-31454964 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006064990 6:31455470-31455492 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006065041 6:31455597-31455619 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006128441 6:31854370-31854392 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006149026 6:31976266-31976288 CCTCCAGGAGGGAGGTGGGGGGG - Intronic
1006187616 6:32189950-32189972 TAACCAGGCGGGGGGAGGGGCGG - Exonic
1006209759 6:32384994-32385016 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1006281801 6:33059759-33059781 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1006492306 6:34397603-34397625 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006492436 6:34397906-34397928 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006492509 6:34398082-34398104 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1006492686 6:34398487-34398509 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1006518665 6:34558853-34558875 CCACCAAGAGGGAGCAAGGGAGG + Intergenic
1006594025 6:35179537-35179559 CATCCAGGAGGGTGTCTGGGAGG + Intergenic
1006623622 6:35383973-35383995 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006623881 6:35384596-35384618 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006623957 6:35384771-35384793 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006624031 6:35384946-35384968 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1006922264 6:37634754-37634776 CAAGGTGGAGGGGGGATGGGGGG - Exonic
1007305056 6:40897349-40897371 CAATGAGAAGGGTGGATGGGGGG - Intergenic
1007429470 6:41768384-41768406 CAAACAGGAGGGTGGATATGTGG - Intergenic
1007674080 6:43580543-43580565 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1007674254 6:43580945-43580967 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1007713424 6:43839006-43839028 GAACCAAAAGGGAGGGTGGGAGG + Intergenic
1008112122 6:47505805-47505827 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1008502087 6:52193455-52193477 TAACAGGGAGGGAGGATGGTGGG - Intergenic
1008926319 6:56894536-56894558 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1008926443 6:56894810-56894832 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1008926468 6:56894859-56894881 CGCCCAGGAGGGAGGTGGGGGGG - Intronic
1009214459 6:60903815-60903837 CAAAGAGGAGGGAGGAAGAGAGG - Intergenic
1010030271 6:71266092-71266114 CATCCGGGAGGGAGGCGGGGAGG - Intergenic
1010030293 6:71266141-71266163 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1010239407 6:73601672-73601694 CGTCCAGGAGGGAGGTGGGGTGG + Intronic
1010586771 6:77664512-77664534 CCACCAGGTGTGAGGAGGGGAGG + Intergenic
1010826986 6:80486397-80486419 CCACCAGGTGTGAGGAGGGGAGG + Intergenic
1011405223 6:87010191-87010213 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1011476009 6:87751054-87751076 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1012585477 6:100916324-100916346 CAGCAAGGAGGCAGGATGGTTGG - Intergenic
1013190905 6:107803410-107803432 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1013204622 6:107934654-107934676 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1013204740 6:107934927-107934949 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1013243912 6:108269992-108270014 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1013326238 6:109047455-109047477 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1013419917 6:109958108-109958130 AAACAGGGAGGGAGGAAGGGGGG + Intergenic
1013426841 6:110019657-110019679 AACTCAGGAGGGAGGATGGGAGG + Intergenic
1014557055 6:122849310-122849332 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1014764037 6:125388848-125388870 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1014764112 6:125389023-125389045 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1015162062 6:130164444-130164466 AAACCACAAGGGAGGATGGTAGG + Intronic
1015643598 6:135363898-135363920 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1016625160 6:146158283-146158305 GAAACAAGAGGGAGGATGGAAGG + Intronic
1016802124 6:148178830-148178852 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1017062006 6:150492847-150492869 CCACAAGGAGGGAGGATGGAAGG - Intergenic
1017843962 6:158240751-158240773 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018608485 6:165623717-165623739 CACTCATGAGGGAGGAGGGGAGG - Intronic
1018923396 6:168190864-168190886 CATCCAGGAGGGAGACTGAGGGG + Intergenic
1019177208 6:170166038-170166060 CAACCAGCAGGCAGGAGGAGAGG + Intergenic
1019439181 7:1038239-1038261 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1019458981 7:1146811-1146833 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1019459055 7:1146979-1147001 CATCCGGGAGGGAGGCGGGGGGG - Intergenic
1019669138 7:2268434-2268456 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1019669187 7:2268533-2268555 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1019674488 7:2303041-2303063 CGTCCAGGAGGGAGGTGGGGAGG + Intronic
1019863649 7:3684339-3684361 CCACCAGGAAGGGGGAGGGGAGG - Intronic
1020111583 7:5450948-5450970 CACCCAGGCTGGAGGGTGGGGGG + Intronic
1020111873 7:5452078-5452100 CCACCTGGAGGGAGGCTGTGTGG + Intronic
1020255849 7:6502912-6502934 CAGACAGCAGGGTGGATGGGTGG - Intronic
1020284797 7:6671356-6671378 CGCCCAGGAGGGAGGTGGGGGGG - Intergenic
1020308107 7:6850238-6850260 AAACCAGGAGGGGGGAAGAGGGG + Intergenic
1020325877 7:6975042-6975064 CATCCAGGAGGGAGGTGGGGGGG - Intergenic
1020445296 7:8261878-8261900 CAGGCCGGAGGGAGGAGGGGAGG + Intronic
1020616437 7:10465837-10465859 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1020616459 7:10465886-10465908 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1020831737 7:13102807-13102829 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1020831790 7:13102934-13102956 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1020831815 7:13102983-13103005 CGACCGGGAGGGAGGTGGGGGGG + Intergenic
1021440310 7:20668706-20668728 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021672322 7:23046234-23046256 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1021672371 7:23046334-23046356 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1021735404 7:23636884-23636906 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021735662 7:23637464-23637486 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1021735760 7:23637689-23637711 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1021840397 7:24717511-24717533 CAGCCAGCATGGGGGATGGGGGG + Intronic
1021872595 7:25019217-25019239 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1021872650 7:25019347-25019369 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1022083334 7:27044979-27045001 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1022106711 7:27201994-27202016 CCACTTGGAGGGAGGAAGGGGGG - Intergenic
1022274096 7:28838886-28838908 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1022502631 7:30892279-30892301 CACCCAGCAGGGAGCAAGGGAGG - Exonic
1024301787 7:47892546-47892568 CCAAAAGGAGGGAGGTTGGGAGG + Intronic
1024538784 7:50459914-50459936 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1024989116 7:55220193-55220215 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1025000635 7:55312114-55312136 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1025011588 7:55402605-55402627 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1025103078 7:56151038-56151060 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
1025103325 7:56151613-56151635 CTTCCGGGAGGGAGGTTGGGGGG + Intergenic
1025103425 7:56151840-56151862 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1025103449 7:56151889-56151911 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1025803465 7:64809218-64809240 CACCCGGGAGGGAGGTGGGGGGG - Intronic
1025821344 7:64967617-64967639 CATCCAGGAGGGAGGCGGGGAGG - Intergenic
1025821613 7:64968245-64968267 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1025853047 7:65258678-65258700 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1025853231 7:65259079-65259101 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1025853361 7:65259347-65259369 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1025979318 7:66393833-66393855 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1026738620 7:72964670-72964692 AAAGCTGGAGGGAGCATGGGTGG - Intronic
1026783363 7:73284326-73284348 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1026868248 7:73836066-73836088 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1026868273 7:73836115-73836137 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1026868295 7:73836163-73836185 CATCCGGGAGGGAGGTAGGGGGG + Intronic
1026868341 7:73836261-73836283 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1026868445 7:73836515-73836537 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1026895941 7:74010173-74010195 CACCCTGGAGGGAGAATAGGGGG + Intergenic
1027105114 7:75400399-75400421 AAAGCTGGAGGGAGCATGGGTGG + Intronic
1027182849 7:75952291-75952313 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1027371146 7:77509362-77509384 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1028659552 7:93253697-93253719 AACCTAGGAGGGAGGTTGGGAGG + Intronic
1028685480 7:93585966-93585988 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1028685559 7:93586142-93586164 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1029279581 7:99427289-99427311 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1029429727 7:100522879-100522901 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1029429991 7:100523480-100523502 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1029430089 7:100523706-100523728 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1029468471 7:100740935-100740957 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1029468883 7:100741870-100741892 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1029569217 7:101359275-101359297 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1030602825 7:111610211-111610233 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1030973244 7:116088224-116088246 TAACGAGGAGTGGGGATGGGTGG - Intronic
1032042725 7:128576644-128576666 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1032042749 7:128576694-128576716 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1032061210 7:128726936-128726958 CAACCAGGATGGGGGCTGGAGGG - Intronic
1032569574 7:132984883-132984905 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1032569724 7:132985233-132985255 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1032569828 7:132985487-132985509 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1032569852 7:132985536-132985558 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1032569906 7:132985663-132985685 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1032569932 7:132985715-132985737 CATCCGGGAGGGAGGAGGGGAGG + Intronic
1033376084 7:140763241-140763263 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1034234018 7:149554403-149554425 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1034234137 7:149554679-149554701 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1034234256 7:149554954-149554976 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1034252866 7:149706379-149706401 CAGCCAGGCGGGAGGATGAGGGG - Intergenic
1034638699 7:152586083-152586105 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1034961802 7:155367718-155367740 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1035277870 7:157758700-157758722 GAGCCAGTAGGGTGGATGGGCGG - Intronic
1035507709 8:149482-149504 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1035507733 8:149531-149553 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1035507885 8:149883-149905 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1035507907 8:149932-149954 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1035739293 8:1914091-1914113 CACCAAGGAGGGAGGAAGGCGGG + Intronic
1036285634 8:7442349-7442371 CAACTGGGAGGCAGGAAGGGAGG + Intergenic
1036335839 8:7869180-7869202 CAACTGGGAGGCAGGAAGGGAGG - Intergenic
1036536656 8:9657606-9657628 CGTCCAGGAGGGAGGTAGGGGGG - Intronic
1036536732 8:9657783-9657805 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1036571151 8:9980601-9980623 AAACCAGGAGGGAGGCAGAGAGG - Intergenic
1036675956 8:10833449-10833471 GAAAAAGGAGGGAGGAAGGGAGG + Intronic
1036722426 8:11189002-11189024 CAGCCAGGAGAGGGGATGAGGGG - Intronic
1037905669 8:22714731-22714753 CAGGCAGGTGGGAGGGTGGGTGG - Intronic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038595189 8:28881236-28881258 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1039153221 8:34528969-34528991 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1039263994 8:35804854-35804876 CAACCAGGAGAGATAGTGGGTGG + Intergenic
1039488273 8:37928060-37928082 CCTCCGGGAGGGAGGTTGGGGGG + Intergenic
1039791985 8:40883451-40883473 CATCCAGGAGGGAGAAGGGGAGG - Intronic
1039832104 8:41223620-41223642 GAGCCAAGAGGGAGGAAGGGAGG + Intergenic
1039881147 8:41626395-41626417 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1039881175 8:41626448-41626470 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1040043381 8:42939400-42939422 CATCCGGGAGGGAGGTAGGGGGG - Intronic
1040069857 8:43179939-43179961 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1040093243 8:43419431-43419453 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1040121231 8:43687635-43687657 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1040785590 8:51159447-51159469 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1040785611 8:51159496-51159518 CATCCAGGAGGGAGGCGGGGAGG + Intergenic
1040785636 8:51159545-51159567 CATCCGGGAGGGAGGCGGGGGGG + Intergenic
1040818774 8:51534560-51534582 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1040937847 8:52799706-52799728 AAATCAGGAGGCAGGAAGGGGGG + Intergenic
1041070794 8:54125427-54125449 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1041070866 8:54125603-54125625 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1041270347 8:56104424-56104446 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1041286891 8:56272012-56272034 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1041350807 8:56946319-56946341 CAACCACCAGGGAGGGTGAGAGG + Intergenic
1041676876 8:60547835-60547857 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1041796495 8:61752910-61752932 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1041796596 8:61753133-61753155 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1041796622 8:61753185-61753207 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1042048968 8:64685758-64685780 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1042049015 8:64685859-64685881 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1042049271 8:64686438-64686460 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1042054931 8:64754581-64754603 CAAGCAGTAGGGAGGGAGGGAGG + Intronic
1042319737 8:67461822-67461844 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1042475860 8:69246221-69246243 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1042516998 8:69670075-69670097 CTCCCAGGAGGTAAGATGGGTGG - Exonic
1043350549 8:79355338-79355360 ACACCAGGAGGGAGGAGGGATGG + Intergenic
1043985857 8:86694130-86694152 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1043985907 8:86694229-86694251 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1044056700 8:87579514-87579536 CAGAAAGGAGGGAGGGTGGGAGG + Intronic
1044660668 8:94590888-94590910 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1044818988 8:96143439-96143461 CCATCAGGAGGGAAGATGGTGGG - Exonic
1045120168 8:99028346-99028368 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1045120349 8:99028723-99028745 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1045298436 8:100892105-100892127 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1045298489 8:100892232-100892254 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1045298539 8:100892359-100892381 CATCCGGGAGGGAGGTGGGGAGG - Intergenic
1045298562 8:100892408-100892430 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1045327034 8:101124997-101125019 CAATCAGGAGAGAGGAGGCGTGG + Intergenic
1045489292 8:102656481-102656503 TGCCCAGGAGGAAGGATGGGCGG - Intergenic
1045524051 8:102928269-102928291 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1045524155 8:102928496-102928518 CGCCCGGGAGGGAGGTTGGGGGG + Intronic
1045524201 8:102928594-102928616 CGCCCGGGAGGGAGGTTGGGGGG + Intronic
1045524226 8:102928643-102928665 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1045716693 8:105055430-105055452 CTATCAGAATGGAGGATGGGAGG - Intronic
1046521717 8:115333658-115333680 TTACCAGGAGTGAGGGTGGGAGG + Intergenic
1046636297 8:116678846-116678868 CGACCGGGAGGGAGGTGGGGGGG + Intronic
1046636351 8:116678975-116678997 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1046636716 8:116679794-116679816 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1047177460 8:122555062-122555084 AAAACAGGAGGGATAATGGGGGG - Intergenic
1047251280 8:123183368-123183390 CAAGTAGCAGGGAGGATCGGGGG + Intronic
1047266678 8:123315013-123315035 CATCCGGGAGGGAGGTAGGGGGG + Intergenic
1047266724 8:123315111-123315133 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047266828 8:123315364-123315386 CATCCGGGAGGGAGGTAGGGGGG + Intergenic
1047492610 8:125387073-125387095 GAACCAGGATGGAGGGTGGTGGG + Intergenic
1047521320 8:125597331-125597353 GCACCAGGAGTGAGGATGGGAGG - Intergenic
1047687401 8:127316737-127316759 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047687551 8:127317062-127317084 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1047687629 8:127317243-127317265 CGTCCGGGAGGGAGGTTGGGGGG + Intergenic
1047847710 8:128825666-128825688 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1047847814 8:128825892-128825914 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1047848080 8:128826509-128826531 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1047848130 8:128826609-128826631 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1047863574 8:128995811-128995833 CACACAACAGGGAGGATGGGGGG + Intergenic
1048368658 8:133758329-133758351 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1048368682 8:133758378-133758400 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1048552800 8:135449280-135449302 CAACCAGGAGGGAGACTAGATGG - Intergenic
1049025263 8:139984093-139984115 CTACTAGGAGGGAGGAGAGGCGG + Intronic
1049361462 8:142214190-142214212 AACCCAGAAAGGAGGATGGGCGG + Intronic
1049569137 8:143360153-143360175 CACCCAGGAGGTGGGGTGGGAGG + Intergenic
1049661144 8:143820225-143820247 GACCCTGGAGGGAGGATGGTTGG - Intronic
1050586678 9:7119806-7119828 GAACCAGGAGGGAGGCTGCCAGG - Intergenic
1051258165 9:15234390-15234412 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1051276928 9:15406769-15406791 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1051280900 9:15442066-15442088 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1051849362 9:21489661-21489683 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1052492790 9:29189149-29189171 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1052941947 9:34137698-34137720 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1053255828 9:36615349-36615371 CGACCGGGAGGGAGGTGGGGGGG - Intronic
1053255873 9:36615447-36615469 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1054453044 9:65413422-65413444 TGACCAGCAGGCAGGATGGGTGG - Intergenic
1054799738 9:69335416-69335438 CAGCTAGGAGGGAAGCTGGGAGG + Intronic
1055133836 9:72806227-72806249 CATCCGGGAGGGAGGTGGGGTGG - Intronic
1055137242 9:72840887-72840909 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1055137322 9:72841064-72841086 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1055137491 9:72841464-72841486 CATCCGGGAGGGAGGTTGGGGGG - Intergenic
1055262487 9:74454073-74454095 AAACCAGAAGTGAGCATGGGTGG - Intergenic
1055414269 9:76064413-76064435 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1055414318 9:76064513-76064535 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1055469539 9:76597627-76597649 CAACCAGGAACTAGGGTGGGTGG - Intergenic
1055586229 9:77761433-77761455 CTTCCGGGAGGGAGGTTGGGGGG + Intronic
1055586576 9:77762233-77762255 CTTCCGGGAGGGAGGTTGGGGGG + Intronic
1055586653 9:77762409-77762431 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1055586677 9:77762458-77762480 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1055948349 9:81710496-81710518 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1055948606 9:81711075-81711097 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1056145857 9:83728740-83728762 CTACCGGGAGGGAGGTGGGGGGG + Intergenic
1056152624 9:83804331-83804353 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1056152749 9:83804606-83804628 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1056409624 9:86312473-86312495 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1056731066 9:89167112-89167134 CCAGCAGGAGGGAGGGAGGGAGG + Intronic
1057014791 9:91642227-91642249 CAACCAGGAGAGGGGATGCTGGG + Intronic
1057154683 9:92830699-92830721 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1057154774 9:92830915-92830937 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1057186863 9:93061982-93062004 ATCCCAGGAGGGAGGATGGAGGG + Intronic
1057203558 9:93156952-93156974 CCAGCAGGAAGGAGGAAGGGAGG + Intergenic
1057519800 9:95751825-95751847 GCCACAGGAGGGAGGATGGGAGG + Intergenic
1057683895 9:97216379-97216401 GGACCAGGTGTGAGGATGGGAGG - Intergenic
1057751622 9:97796906-97796928 CATCCAGGAGGGAGGTGGGGGGG + Intergenic
1057920312 9:99091757-99091779 CATACAGGAAAGAGGATGGGTGG + Intergenic
1057954502 9:99396762-99396784 CCTCAAGGAGGGAGAATGGGGGG + Intergenic
1058215734 9:102231425-102231447 CAAACAGGAGGGAGGGAGGGAGG - Intergenic
1058659487 9:107256654-107256676 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1058659687 9:107257108-107257130 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1058659869 9:107257510-107257532 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1058659919 9:107257610-107257632 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1058661557 9:107272193-107272215 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1058661659 9:107272447-107272469 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1058703796 9:107622438-107622460 AAACCAGGAGAGAGTGTGGGAGG + Intergenic
1058722600 9:107776348-107776370 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1059120970 9:111641161-111641183 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1059121047 9:111641337-111641359 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1059121145 9:111641561-111641583 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1059211064 9:112514384-112514406 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1059211238 9:112514788-112514810 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1059707748 9:116840511-116840533 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1060064983 9:120495737-120495759 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1060065005 9:120495786-120495808 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1060065438 9:120496769-120496791 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060248991 9:121971003-121971025 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1060351876 9:122867392-122867414 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1060351898 9:122867441-122867463 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060352097 9:122868053-122868075 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1060555332 9:124504883-124504905 GAACAGGGAGGCAGGATGGGGGG - Intronic
1060682439 9:125577547-125577569 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1060682550 9:125577792-125577814 CGTCCAGGAGGGAGGATGGGGGG + Intronic
1060687386 9:125624368-125624390 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1060703817 9:125780646-125780668 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1060793747 9:126501702-126501724 CAACCATGAAGGAGCATGGGAGG - Intronic
1061030495 9:128079291-128079313 CAACAGGGAGGGAGGACAGGAGG - Intronic
1061086878 9:128404757-128404779 CAACCCCGAGGGGGGTTGGGTGG + Intergenic
1061143181 9:128780510-128780532 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1061427131 9:130506577-130506599 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1061471763 9:130832496-130832518 CAGCCAGGAGGTAGGAAGGTAGG - Intronic
1061973901 9:134058821-134058843 TCACCAAGAGGGAGGGTGGGCGG + Intronic
1061982738 9:134115690-134115712 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983062 9:134116444-134116466 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983363 9:134117149-134117171 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983687 9:134117903-134117925 CGTCCGGGAGGGAGGTTGGGGGG - Intergenic
1061983913 9:134118432-134118454 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1061996331 9:134188110-134188132 CACCCAGGGGGGTGGTTGGGAGG - Intergenic
1062514840 9:136927597-136927619 CAACCTGGAAGGAGGGTTGGTGG + Intronic
1062702247 9:137913399-137913421 GAACCAGGCAGGAGGAAGGGAGG + Intronic
1062730026 9:138103526-138103548 CACCCAGGAGGGAGGCCTGGAGG - Intronic
1185556869 X:1028551-1028573 CATCCAGGAGAGAGGATTGGGGG + Intergenic
1185643590 X:1601332-1601354 CCAGCAGCAGGGAGGACGGGAGG + Exonic
1185700486 X:2227705-2227727 CAAAGAGAAGGAAGGATGGGAGG + Intronic
1186244811 X:7608684-7608706 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1186244861 X:7608811-7608833 CATCCAGGAGGGAGGTGGGAGGG - Intergenic
1186244961 X:7609065-7609087 CGTCCAGGAGGGAGGTGGGGGGG - Intergenic
1186428384 X:9483573-9483595 CAACCAGGCGAGAAGATGGGAGG - Intronic
1186685128 X:11917729-11917751 CCAAAAGGAGGGAGGAAGGGAGG + Intergenic
1186787016 X:12963683-12963705 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1187125909 X:16454230-16454252 CCTCCAGGAGGCAGCATGGGTGG - Intergenic
1187183410 X:16964664-16964686 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1187976451 X:24709296-24709318 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1187976518 X:24709443-24709465 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1188060995 X:25601953-25601975 CAGGGAGGAGGGAGGAAGGGAGG - Intergenic
1188367908 X:29334330-29334352 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1188415474 X:29927883-29927905 AAAGCAGGAGGGAGGGAGGGAGG + Intronic
1188451383 X:30310721-30310743 AAAGAAAGAGGGAGGATGGGAGG - Intergenic
1188477504 X:30603240-30603262 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1189210292 X:39277874-39277896 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1189210316 X:39277923-39277945 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1189271615 X:39755883-39755905 CAGCCAGCTGGGAGGCTGGGAGG + Intergenic
1189569961 X:42285667-42285689 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1189755525 X:44267540-44267562 CAACCAAAAGGGAGCAGGGGAGG + Intronic
1189837619 X:45040452-45040474 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1189837740 X:45040727-45040749 CATCCAGGAGGGAGGTGGGGGGG - Intronic
1189837765 X:45040777-45040799 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1189837999 X:45041306-45041328 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1189940597 X:46117196-46117218 CAACTGGGAGGGGGAATGGGGGG + Intergenic
1190171530 X:48115455-48115477 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1190174754 X:48139305-48139327 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1190245762 X:48689074-48689096 CAGGCAGGATGGAGGATTGGGGG + Intronic
1190521166 X:51280231-51280253 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1190769714 X:53504430-53504452 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1190779040 X:53578467-53578489 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1190820498 X:53967475-53967497 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1190827040 X:54027238-54027260 CAGAAGGGAGGGAGGATGGGAGG - Intronic
1190891464 X:54572639-54572661 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1191009984 X:55748895-55748917 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1191010033 X:55748994-55749016 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1191010178 X:55749347-55749369 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1191618146 X:63189749-63189771 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1191637436 X:63393386-63393408 CCTCCAGGAGGGAGGTTGGGGGG + Intergenic
1192169532 X:68845762-68845784 CGACCACTAGGGAGGCTGGGAGG - Intergenic
1192352797 X:70371609-70371631 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1192379649 X:70602170-70602192 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1192476967 X:71452163-71452185 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1192530182 X:71876874-71876896 CATCCGGGAGGGAGGTAGGGGGG - Intergenic
1192621248 X:72681429-72681451 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1192621272 X:72681479-72681501 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1192621294 X:72681528-72681550 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1192621597 X:72682222-72682244 CGTCCGGGAGGGAGGTTGGGGGG + Intronic
1192969623 X:76217790-76217812 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1192969833 X:76218272-76218294 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1193114818 X:77766323-77766345 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193132264 X:77931775-77931797 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193132364 X:77932001-77932023 CGTCCAGGAGGGAGGTGGGGGGG - Intronic
1193362237 X:80591282-80591304 CATCCCGGAGGGAGGTGGGGGGG + Intergenic
1193362360 X:80591557-80591579 CGTCCAGGAGGGAGGTGGGGGGG + Intergenic
1193782822 X:85723918-85723940 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1193797051 X:85890041-85890063 CTAAAAGGAGGGAGGAAGGGAGG + Intronic
1194611494 X:96050970-96050992 CATCCGGGAGAGAGGTTGGGGGG - Intergenic
1194714574 X:97275275-97275297 CTCCCGGGAGGGAGGTTGGGGGG - Intronic
1194714601 X:97275326-97275348 CACCCAGGAGGGAGGTGGGCGGG - Intronic
1194714623 X:97275374-97275396 CACCCAGGAGGGAGGTGGGGGGG - Intronic
1194991854 X:100555461-100555483 CATCCGGGAGGGAGGTGGGGGGG + Intergenic
1194992037 X:100555894-100555916 CATCCGGGAGGGAGGTGGGGAGG + Intergenic
1195009978 X:100724230-100724252 CGTCCAGGAGGGAGGTGGGGGGG + Intronic
1195035979 X:100972363-100972385 CGTCCGGGAGGGAGGTTGGGGGG - Intronic
1195291234 X:103433523-103433545 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1195618223 X:106929527-106929549 AAAGCAGGATGCAGGATGGGAGG + Exonic
1195908751 X:109869173-109869195 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1196404437 X:115347642-115347664 CATCCGGGAGGGAGGTGGGGGGG - Intergenic
1196769589 X:119280706-119280728 CTACTGAGAGGGAGGATGGGAGG - Intergenic
1196793217 X:119482626-119482648 CAACTAGGAGAGAGGAGGGCAGG + Intergenic
1197897119 X:131327540-131327562 CATCCGGGAGGGAGGTGGGGGGG + Intronic
1198246940 X:134839672-134839694 CATCCAGGAGGGAGGTGGGGGGG + Intronic
1198321434 X:135521694-135521716 AAACCCGGAGGGAGGCTGCGAGG + Intronic
1199547192 X:149018735-149018757 CCACAAGCAGGGAGGATGAGTGG + Intergenic
1199982633 X:152929241-152929263 CAACCAGCAGGGAGCACGAGGGG + Intronic
1200122236 X:153796570-153796592 CAGACAGGAGGGCGGGTGGGGGG + Intronic
1200212091 X:154351248-154351270 CACCCAGGTGGCAGGAAGGGAGG + Intronic
1200280581 X:154773938-154773960 CATCCGGGAGGGAGGTGGGGGGG - Intronic
1201502599 Y:14661336-14661358 CAAACAGGGGAAAGGATGGGAGG + Intronic