ID: 1118742078

View in Genome Browser
Species Human (GRCh38)
Location 14:68746992-68747014
Sequence GTTTATGTAAAGTTACCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118742078_1118742086 22 Left 1118742078 14:68746992-68747014 CCGTGAGGTAACTTTACATAAAC No data
Right 1118742086 14:68747037-68747059 CATTTTGTGTGTCAAGTGGGTGG No data
1118742078_1118742081 -10 Left 1118742078 14:68746992-68747014 CCGTGAGGTAACTTTACATAAAC No data
Right 1118742081 14:68747005-68747027 TTACATAAACTTGCTGGAATGGG No data
1118742078_1118742082 -9 Left 1118742078 14:68746992-68747014 CCGTGAGGTAACTTTACATAAAC No data
Right 1118742082 14:68747006-68747028 TACATAAACTTGCTGGAATGGGG No data
1118742078_1118742084 19 Left 1118742078 14:68746992-68747014 CCGTGAGGTAACTTTACATAAAC No data
Right 1118742084 14:68747034-68747056 AGCCATTTTGTGTGTCAAGTGGG No data
1118742078_1118742083 18 Left 1118742078 14:68746992-68747014 CCGTGAGGTAACTTTACATAAAC No data
Right 1118742083 14:68747033-68747055 TAGCCATTTTGTGTGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118742078 Original CRISPR GTTTATGTAAAGTTACCTCA CGG (reversed) Intergenic
No off target data available for this crispr