ID: 1118746361

View in Genome Browser
Species Human (GRCh38)
Location 14:68776302-68776324
Sequence TTTCCTCTGAGTACTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118746361_1118746363 9 Left 1118746361 14:68776302-68776324 CCCTCTGTAGTACTCAGAGGAAA No data
Right 1118746363 14:68776334-68776356 AAATATAGCCCCAGCCTCCCAGG No data
1118746361_1118746364 10 Left 1118746361 14:68776302-68776324 CCCTCTGTAGTACTCAGAGGAAA No data
Right 1118746364 14:68776335-68776357 AATATAGCCCCAGCCTCCCAGGG No data
1118746361_1118746367 17 Left 1118746361 14:68776302-68776324 CCCTCTGTAGTACTCAGAGGAAA No data
Right 1118746367 14:68776342-68776364 CCCCAGCCTCCCAGGGATCAGGG No data
1118746361_1118746365 16 Left 1118746361 14:68776302-68776324 CCCTCTGTAGTACTCAGAGGAAA No data
Right 1118746365 14:68776341-68776363 GCCCCAGCCTCCCAGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118746361 Original CRISPR TTTCCTCTGAGTACTACAGA GGG (reversed) Intergenic
No off target data available for this crispr