ID: 1118747374

View in Genome Browser
Species Human (GRCh38)
Location 14:68784168-68784190
Sequence AAACCAGACTCTGAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118747374_1118747378 10 Left 1118747374 14:68784168-68784190 CCTGGCTCCTCAGAGTCTGGTTT No data
Right 1118747378 14:68784201-68784223 TAACTCAGCTGTAACCATCTGGG No data
1118747374_1118747377 9 Left 1118747374 14:68784168-68784190 CCTGGCTCCTCAGAGTCTGGTTT No data
Right 1118747377 14:68784200-68784222 GTAACTCAGCTGTAACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118747374 Original CRISPR AAACCAGACTCTGAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr