ID: 1118748092

View in Genome Browser
Species Human (GRCh38)
Location 14:68788793-68788815
Sequence GTGTAGGTCTGCAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 341}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118748092_1118748103 16 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748103 14:68788832-68788854 AGTCAACAGGGGTTCAGATCGGG 0: 1
1: 0
2: 0
3: 8
4: 113
1118748092_1118748100 4 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748100 14:68788820-68788842 CCAGGCAAGATTAGTCAACAGGG 0: 1
1: 0
2: 0
3: 18
4: 219
1118748092_1118748104 26 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748104 14:68788842-68788864 GGTTCAGATCGGGAAGAAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 313
1118748092_1118748102 15 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748102 14:68788831-68788853 TAGTCAACAGGGGTTCAGATCGG 0: 1
1: 0
2: 0
3: 12
4: 102
1118748092_1118748098 3 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748098 14:68788819-68788841 CCCAGGCAAGATTAGTCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 68
1118748092_1118748101 5 Left 1118748092 14:68788793-68788815 CCTTCCTTCCTGCAGACCTACAC 0: 1
1: 0
2: 1
3: 25
4: 341
Right 1118748101 14:68788821-68788843 CAGGCAAGATTAGTCAACAGGGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118748092 Original CRISPR GTGTAGGTCTGCAGGAAGGA AGG (reversed) Exonic
901443705 1:9293813-9293835 GTGCGGGTCTGCAGGAAGAGCGG + Intronic
902531477 1:17093566-17093588 GAGAAGGTCTACAGCAAGGAAGG - Exonic
903450647 1:23451734-23451756 GAGAAGGTCTGCTGGGAGGAGGG - Intronic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904260552 1:29285209-29285231 CTGAAGGTCTGCAGGAGGGTAGG - Intronic
905801317 1:40844991-40845013 GAGTTGGTCTGCAGGCAAGACGG + Intergenic
906379808 1:45325632-45325654 GTTCAGGCCTGCAGGCAGGAGGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907334137 1:53689403-53689425 GTGGAGGGCTGCAGCCAGGAGGG - Intronic
908803496 1:67905669-67905691 GTCTAGGTCTCTAGCAAGGATGG + Intergenic
910919434 1:92328193-92328215 GTGTAGGTCTCTAGCAAGGCTGG + Intronic
911262395 1:95701841-95701863 CTCTAGGTCTGCTGGAGGGAGGG - Intergenic
912557149 1:110524585-110524607 GTGAAGGACTGAAGGAAGGTGGG + Intergenic
913412054 1:118563069-118563091 GTGTAGGTGTACAGCAAGCATGG - Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914455387 1:147832035-147832057 GTCTAGGTCTGTAGCAAGGCAGG + Intergenic
914901284 1:151712474-151712496 CTGTCGGTCTGCAGTCAGGAAGG - Intronic
916962391 1:169902439-169902461 GTGTTTGTTTGCAGGGAGGAGGG - Intergenic
917615799 1:176742933-176742955 GTGTAGTGTTGCAGGAGGGATGG - Intronic
917967366 1:180187071-180187093 GTGTGGGTCTGCAGGAAGCTGGG + Intronic
920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG + Intergenic
920773765 1:208915307-208915329 ATGAAGGTCTGCAGGGAAGAAGG + Intergenic
920850783 1:209626773-209626795 GTGTAGGTCTGCAGCAGGGCAGG - Intronic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921586693 1:216955185-216955207 GGGTAGGTGTGAGGGAAGGATGG - Intronic
922333046 1:224594562-224594584 GTGTAGGTCAGGAGGCAGAAAGG + Intronic
922965996 1:229691299-229691321 GTGTAGGTTTGAATGAAGAATGG + Intergenic
924304092 1:242669324-242669346 TTGTAGGTCTCCAGGACAGATGG - Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063646463 10:7888518-7888540 GTGGAGGTCTGCAGTGTGGAGGG + Intronic
1064256819 10:13749396-13749418 GTATAACTCTGAAGGAAGGAAGG + Intronic
1064779846 10:18822948-18822970 GGGTGGTTCTGGAGGAAGGAAGG + Intergenic
1065137971 10:22691332-22691354 GTATAGGTCTGAAGAAAAGAGGG - Intronic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1066438173 10:35413207-35413229 GTGAAGGTCTGAAGGAAGGTAGG + Intronic
1069959078 10:72069038-72069060 GTGGAGGTCAGCAGGAAGTCTGG - Intronic
1070088260 10:73257625-73257647 GTGTAGATTTGGAGGAAGTAAGG - Intronic
1070495145 10:77014889-77014911 GTGCAGGTGTGCAGTAAGGGAGG - Intronic
1073251224 10:102121202-102121224 GCGTCAGTCTGCAAGAAGGAAGG - Intergenic
1073328875 10:102658127-102658149 GTTGAGGTCAGCAGGGAGGAGGG + Exonic
1073366012 10:102941652-102941674 GTACAGATCTGAAGGAAGGAGGG - Intronic
1074300854 10:112232292-112232314 GTGAAGGGCTGGAGGTAGGAAGG + Intergenic
1076253188 10:128999111-128999133 GTGAAGGGCTGGAGGAGGGAAGG + Intergenic
1077434623 11:2532854-2532876 GTGCAGGGTTGCAGGAAGGACGG + Intronic
1077559668 11:3251497-3251519 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1077565560 11:3297300-3297322 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1078300277 11:10122793-10122815 GTGTAAGTGTGCAGGTATGAAGG - Intronic
1079116275 11:17642324-17642346 GTGCAGGAGTGCAGGAAGAAGGG + Intronic
1079437127 11:20467931-20467953 GGATAGGTCTGTAGGAGGGAGGG - Intronic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1081692079 11:45085541-45085563 GTGTGTGACTGCAGGAGGGAGGG + Intergenic
1081716158 11:45252019-45252041 GTGTAGGTGAGCATGAAGGGTGG - Intronic
1081781425 11:45715818-45715840 GAGCATGTCTGCAGGAAGCAGGG - Intergenic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1083110501 11:60401489-60401511 ATGGAGGTGTGCAGGAATGATGG + Intronic
1083178864 11:60971630-60971652 GTTTTGGTCTGCAGGAAGCTGGG - Intergenic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083861651 11:65423224-65423246 GTGCAGGGCTGCAGGAGGGCCGG + Intergenic
1084291965 11:68177921-68177943 GTGTAGGATTGCAGCAAGAATGG - Intronic
1085958170 11:81426883-81426905 CTGCAGGTTTGCAGGAAGCATGG + Intergenic
1086677770 11:89630333-89630355 TTGTAGGTTTACAGGAATGATGG + Intergenic
1088239663 11:107760141-107760163 GTCTAGGTCTCTAGGAAGGCTGG - Intergenic
1088527556 11:110773173-110773195 GAGTAGGCCTGCTGGAAGGAGGG - Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1090761928 11:129845291-129845313 GTGTGTGTATGCATGAAGGAAGG + Intronic
1090761933 11:129845361-129845383 GTGTGTGTATGCATGAAGGAAGG + Intronic
1092372722 12:7930559-7930581 TTGTAGGATAGCAGGAAGGATGG + Exonic
1092464689 12:8720006-8720028 GTGTAGGTGTGCACCAAGGATGG + Intronic
1092520725 12:9269944-9269966 GTATAAGGCTGAAGGAAGGAAGG - Intergenic
1093286086 12:17265749-17265771 CTGTAGGTCTGCAGGAGCCAGGG + Intergenic
1093688636 12:22084657-22084679 GTGTATGTCTGGAGGCAGGTGGG - Intronic
1094042231 12:26130170-26130192 GTGGAAGTCTGCAGGAAGAGGGG + Intronic
1096265690 12:50120753-50120775 GTGCAGCTCTGCATCAAGGAGGG + Intergenic
1096642706 12:53006835-53006857 GTGAAGGCGTGGAGGAAGGAAGG + Intronic
1096810663 12:54167649-54167671 GTGTGGTTCTGCATTAAGGAGGG - Intronic
1097168514 12:57098951-57098973 GTGCTTATCTGCAGGAAGGAGGG - Intronic
1097519730 12:60652100-60652122 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1097756663 12:63415154-63415176 GAGTAGTTTGGCAGGAAGGATGG - Intergenic
1097844937 12:64356589-64356611 GAGTAGTTTGGCAGGAAGGATGG + Intronic
1101223181 12:102661645-102661667 TTGTAGGTTTACAGGAATGAGGG - Intergenic
1101778925 12:107818128-107818150 GAGTAGTTTGGCAGGAAGGATGG + Intergenic
1101855912 12:108442648-108442670 GTGTATGTCTGTTGGAAAGATGG - Intergenic
1101992236 12:109495857-109495879 TTGTAGGTCTACTGGAATGAGGG - Intronic
1102857151 12:116304083-116304105 ATCTGAGTCTGCAGGAAGGAGGG + Intergenic
1102872891 12:116427666-116427688 GTCTACGTGTGCAGGCAGGATGG + Intergenic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103232155 12:119340508-119340530 GGGTGGGGCGGCAGGAAGGATGG - Intronic
1104364711 12:128166425-128166447 GCTGAGGGCTGCAGGAAGGAAGG - Intergenic
1104870889 12:131994577-131994599 GTGGGGCTCTGCAGGAAGGTAGG + Intronic
1104991303 12:132625253-132625275 GTTCAGGCCTGCAGGATGGAGGG - Intronic
1104992323 12:132632759-132632781 GTGTACCACTGCATGAAGGACGG - Exonic
1106476450 13:30102423-30102445 GTGTATGTTGGCAGGCAGGAGGG - Intergenic
1109256849 13:60093858-60093880 GTGTAGTTCTGCCTGAAGGAAGG + Intronic
1109910115 13:68898544-68898566 GAGTAGTTTGGCAGGAAGGACGG - Intergenic
1110433895 13:75458190-75458212 GTGGATCTCTGCAGGATGGATGG + Intronic
1112083724 13:96005608-96005630 GTCTTAGTCTGAAGGAAGGACGG + Intronic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1112945468 13:104921433-104921455 GTCTAGGTCTTCAGCAAGGCTGG - Intergenic
1115411905 14:33084677-33084699 GAGGAGGTCGGCAGGAAAGAGGG + Intronic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1118772153 14:68949311-68949333 GAGGAGGTCAGGAGGAAGGAAGG + Intronic
1119479648 14:74951582-74951604 GTGTCTGTTTGCAGGATGGAGGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120280456 14:82431728-82431750 GTGTATCTCAGCAGGATGGATGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1122809742 14:104282017-104282039 GTGTAGGTCAGCAGACAGCATGG - Intergenic
1125491089 15:40148948-40148970 GTGAATGTCTGCAGGTAGGCAGG - Intergenic
1126350092 15:47736626-47736648 GTGTATGACAGCAGGAAGTAAGG - Intronic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1127757897 15:62111145-62111167 GCGTTTGTCTGCAGGAAGGAGGG - Intergenic
1128575336 15:68770436-68770458 GTGTGGGGCTGCAGGAAGTTGGG + Intergenic
1128577095 15:68783731-68783753 GTCGAGGCCTACAGGAAGGAAGG - Intronic
1128980042 15:72179378-72179400 GTGGAGGTATGCAGCCAGGAGGG + Intronic
1129882666 15:79017451-79017473 CTGTAGGTCTGCAGGATAGTGGG + Intronic
1130725163 15:86431891-86431913 GTTCAGGTCTGCTGGAGGGAGGG - Intronic
1132023462 15:98384527-98384549 GAGAAGGTCAGCAGGAAGCAGGG + Intergenic
1132893725 16:2217536-2217558 CTGTATGTGTGCAGGTAGGAGGG + Intergenic
1133022551 16:2973208-2973230 GTGAAGGCCTGCAGGAGGGCAGG + Exonic
1133287706 16:4698260-4698282 GGGTCTGCCTGCAGGAAGGAAGG + Intronic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1136155973 16:28382402-28382424 GGCTAGCTCTGCAGGAAGGCAGG + Intronic
1136207112 16:28732886-28732908 GGCTAGCTCTGCAGGAAGGCAGG - Intronic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1138196099 16:55053296-55053318 CTGTAGGCCTGCAGCAACGAGGG + Intergenic
1138266606 16:55664278-55664300 CTGTAGTGCTGCATGAAGGATGG - Intronic
1138504277 16:57469785-57469807 GTGTGGGCCAGCGGGAAGGAGGG + Intronic
1139647864 16:68344915-68344937 GTGTAGAGATGCAGGAAGGGAGG - Intronic
1139827295 16:69767192-69767214 GTTTAGGCCTCCAGGATGGATGG + Intronic
1140533202 16:75684464-75684486 GTGTAAGTCTGCAGGGATGGCGG + Intronic
1141304144 16:82845235-82845257 GTGTCTGTCTGCAAGAAGGCAGG + Intronic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1142028470 16:87826910-87826932 GCGCAGGTCTGCGGGAAGGTGGG - Intergenic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1203142835 16_KI270728v1_random:1779963-1779985 GTTTAGCTCTGCAGTAAGAAGGG - Intergenic
1144135211 17:12288885-12288907 GTGAAGGGATGCAGGAAGAAGGG - Intergenic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1144312275 17:14024342-14024364 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1144332484 17:14236983-14237005 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1144413256 17:15021670-15021692 ATGCAAGTCTGCAGGAAGCAGGG - Intergenic
1144498343 17:15764530-15764552 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1146979525 17:37146849-37146871 GTGCTGGTTTGCAGGAAGGGGGG - Intronic
1147519912 17:41160714-41160736 GGGTGGGTTTCCAGGAAGGAGGG + Exonic
1148052921 17:44777946-44777968 CTCTAGGTCTGCAGCAATGAAGG + Exonic
1149420733 17:56508706-56508728 GTGTAGGTATATAGGAAAGAGGG - Intronic
1149513041 17:57258107-57258129 GTGGAGGGCTGTAGGCAGGAGGG + Intronic
1149644414 17:58229362-58229384 GGGTAGGACTGCAGAGAGGAAGG - Intronic
1150437879 17:65168116-65168138 GTCTAGGTCATCAGGAATGAGGG + Intronic
1150582322 17:66485664-66485686 ATGTAGGTCTGCCGGCAGTATGG - Intronic
1151156220 17:72124316-72124338 CTGTGGGTCTGCGGGATGGAAGG - Exonic
1153417941 18:4870401-4870423 GAGTAGATTGGCAGGAAGGATGG - Intergenic
1155076688 18:22363498-22363520 GTGTAGGGATGCAAGTAGGAAGG - Intergenic
1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG + Intronic
1157947189 18:51993331-51993353 TTATAGGTTTACAGGAAGGATGG + Intergenic
1158060146 18:53330647-53330669 GTGCAGGTAGGCAGGCAGGATGG - Intronic
1158069589 18:53455134-53455156 GGGGAAGTCTTCAGGAAGGAAGG - Intronic
1158999038 18:62953849-62953871 GGGATAGTCTGCAGGAAGGAAGG + Intronic
1159578482 18:70207603-70207625 CTGTAGTTATCCAGGAAGGAAGG + Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160242571 18:77133610-77133632 GTGTAGGTCAGGAGGAACGCGGG - Intronic
1160766543 19:811168-811190 GTGTGTGGCTGCAGGAAGGCAGG - Exonic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1161172143 19:2817624-2817646 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1162058625 19:8081112-8081134 GTCCAGGTCTGCAGCACGGATGG + Exonic
1162198103 19:9001160-9001182 GTGTGGGTGTGCATGAATGAGGG - Intergenic
1162326303 19:10001874-10001896 GTGGAGGTCTGGAGCAGGGATGG + Exonic
1162437172 19:10668235-10668257 GGGTAGGGATGCAGGAGGGAAGG - Intronic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1163180362 19:15595288-15595310 GGGTAGGTGTGCAGGACGGCTGG + Intergenic
1163700670 19:18785183-18785205 GTGCAGGTCTGCAGGCAGATCGG - Intronic
1164051599 19:21588687-21588709 TTGTAGGTTTACAGGAATGAGGG + Intergenic
1166924965 19:46260992-46261014 GCGTGTGTCTGCAGGAAGGCAGG - Intergenic
1167281909 19:48574271-48574293 GTGTAGGAAGGAAGGAAGGAAGG - Intronic
1168061552 19:53895662-53895684 GAGTAGGTCTGCAGAAAGGCTGG - Intronic
1168472524 19:56651031-56651053 GTGGTTGTCTGCAGGAAGGAGGG - Intronic
925363470 2:3295486-3295508 GTGTATGTGTGCAGAGAGGATGG - Intronic
925613794 2:5726010-5726032 GCAGAGCTCTGCAGGAAGGAGGG - Intergenic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926061968 2:9810009-9810031 GTAAAGGTCTGCAGCAAGGATGG + Intergenic
928927896 2:36597627-36597649 GGTTTGGTTTGCAGGAAGGAGGG + Intronic
930174222 2:48285191-48285213 GGGTAGTTTTGCAGGAAGGACGG - Intergenic
930528900 2:52566968-52566990 GTGAAGGTTTGGAGGAGGGAAGG - Intergenic
931214342 2:60227308-60227330 GTGTGGGTCTGCAGTTAGCATGG - Intergenic
932605487 2:73162985-73163007 GAGGAGGTGTGGAGGAAGGAAGG + Intergenic
932714843 2:74093560-74093582 GTCTGGGGCTGAAGGAAGGACGG + Exonic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933731337 2:85458503-85458525 GTATAGGGCTGCAGGCAGAAGGG + Intergenic
934784463 2:96995045-96995067 GTGTGGTTCTACAGGAAAGAGGG + Intronic
935172401 2:100620661-100620683 GTGCAGGTCAGCAGGAGGCACGG - Intergenic
936716083 2:115189307-115189329 GAGTAGTTTGGCAGGAAGGATGG + Intronic
937076585 2:119111779-119111801 GAGTAGTTCGGCAGGAAGGGCGG + Intergenic
937114094 2:119391890-119391912 GCCCAGGTCTGGAGGAAGGAAGG + Intergenic
938577224 2:132616035-132616057 GGGAAGGTTTGCAGGAGGGAGGG - Intronic
938601999 2:132851711-132851733 CTGTCGGGCTGCAGGAAGGAAGG - Intronic
939752944 2:146071031-146071053 GTGTAGGTCTGTTGCAAAGATGG - Intergenic
939909478 2:147962799-147962821 GGGTATGTCTGCGGGAGGGAGGG - Intronic
940357496 2:152761343-152761365 GTTTAAGCGTGCAGGAAGGAAGG - Intergenic
940486737 2:154305298-154305320 GTGTGTGTGTTCAGGAAGGAGGG + Intronic
941659358 2:168179793-168179815 GTGGAGGTCAGCAGGGAGGCTGG - Intronic
943346852 2:186748686-186748708 GCGTAATTCAGCAGGAAGGAAGG - Intronic
944311327 2:198236984-198237006 TTGGAGGGCTGCAGCAAGGAAGG + Intronic
946149647 2:217755599-217755621 GTGTAGGTGTTCAGGAAGCTTGG - Intronic
946165760 2:217862944-217862966 CTGTAGGTCTGCTGGCTGGAAGG - Intronic
946306004 2:218857464-218857486 GTGTATGTTTGCAGGAAAGGTGG + Intergenic
947003376 2:225484249-225484271 CTGTAGGACTGTAAGAAGGATGG + Intronic
948614077 2:239187153-239187175 GTGTTGGCCTGCAGGAAGGCAGG + Intronic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1170615415 20:17945213-17945235 GTGTAGGTCTAGAGGAAGGCAGG - Intronic
1171143802 20:22764751-22764773 GTGAAAGGCTGCAGGAAGCAGGG + Intergenic
1172103194 20:32498058-32498080 GTGGAGGTCTGCAGCCCGGAAGG + Intronic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1173717292 20:45219768-45219790 GGGTAGTTCTGGAGAAAGGACGG - Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174395964 20:50247065-50247087 GAGCAGGTCCGCAGGAGGGACGG + Intergenic
1174408077 20:50315868-50315890 GGGAAGGTCTGGATGAAGGAAGG - Intergenic
1175572322 20:60033363-60033385 GTGCATGTATGCATGAAGGAAGG - Intronic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1175934763 20:62509621-62509643 GTGGAGGTGTGGAGGATGGAGGG - Intergenic
1175934783 20:62509675-62509697 GTGGAGGTGTGGAGGATGGAGGG - Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1180037213 21:45256141-45256163 GTCCAGGGCTGCAGGACGGAAGG + Intergenic
1180736444 22:18021376-18021398 GACTAGTTCTGCATGAAGGATGG - Intronic
1181412177 22:22731635-22731657 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183112452 22:35660294-35660316 GTGTAGGTGTGCAGCAGGGGTGG - Exonic
1183557678 22:38543824-38543846 GAGTAGTTTGGCAGGAAGGATGG - Intronic
1183678136 22:39311130-39311152 GGGAGGGGCTGCAGGAAGGAGGG + Intergenic
1184226479 22:43131667-43131689 TTGCAGCGCTGCAGGAAGGATGG - Intergenic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
949610605 3:5699504-5699526 GAGTAGTTTGGCAGGAAGGATGG + Intergenic
951349362 3:21586624-21586646 ATGTAGGCTTGCAAGAAGGATGG + Intronic
951821919 3:26823395-26823417 TTGTAGGTCTACCGGAATGAGGG - Intergenic
952254779 3:31685686-31685708 GTGAGGGACTGCAGAAAGGAAGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953207052 3:40840416-40840438 GTGAAGATTTGAAGGAAGGAGGG + Intergenic
953719544 3:45343446-45343468 GTGCAGGTGTGCAGAAAGGCAGG + Intergenic
954706413 3:52483151-52483173 GGGTAGGCAGGCAGGAAGGATGG - Intronic
954960452 3:54559730-54559752 GTGAAGGTTTGGAGGACGGAGGG - Intronic
955341844 3:58130921-58130943 ATGAATGTCTGCAGGAAGGCAGG - Intronic
955347493 3:58171924-58171946 GCTCAGGTCTGCAGGAAGGCAGG - Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
959822607 3:110754460-110754482 GTGGAGGTCTGAAGGAGAGAGGG + Intergenic
960258531 3:115537472-115537494 GTATAGGTCTACAGCCAGGATGG - Intergenic
960812509 3:121637949-121637971 GTGAAGCTCAGCAGAAAGGAAGG + Intronic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
965321740 3:167260371-167260393 GTCTAGGTCTCTAGGAAGGCCGG + Intronic
966870165 3:184285139-184285161 GTGGAGGTCTCCAGCAAGGCTGG + Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
969128893 4:4975908-4975930 TCGTAGTTCTGCAGGAAGAATGG - Intergenic
969263438 4:6048213-6048235 GTGTAAGGCTGCAGGTAGGAGGG + Intronic
973533987 4:51862275-51862297 GAGTAGGTCTGCAGGGCAGAGGG - Intronic
974862962 4:67545682-67545704 GGGTGGGTCTGCAGGCTGGAGGG - Intergenic
975042201 4:69760133-69760155 GAGTAGGACTGGATGAAGGATGG + Intronic
975459146 4:74630187-74630209 GTGGTGGTCTGTAGGAAGCATGG - Intergenic
977857324 4:101909606-101909628 TTGTAGGTTTACAGGAATGAGGG - Intronic
978616662 4:110603791-110603813 GTGCAGATTTGGAGGAAGGAAGG - Intergenic
981376856 4:144025801-144025823 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
981759343 4:148176316-148176338 GAGGTGGTCTGCAGGTAGGAAGG + Intronic
981824986 4:148929713-148929735 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
983209058 4:164940032-164940054 GTGTGATTCTCCAGGAAGGAGGG + Intergenic
983209920 4:164948015-164948037 GTGTGATTCTCCAGGAAGGAGGG - Intergenic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
989148237 5:38270005-38270027 GTCTAGCTCTGCAGCCAGGAGGG + Intronic
990908385 5:60827872-60827894 TTCTGGGTGTGCAGGAAGGATGG - Intronic
992815562 5:80434129-80434151 GAATAAGTCTGCAGGTAGGATGG + Exonic
993883744 5:93393647-93393669 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
994731600 5:103498385-103498407 TTTTAGGTCTGCAGGGAGGTAGG + Intergenic
997792128 5:136770594-136770616 GGGAAGGACTCCAGGAAGGAGGG + Intergenic
999376050 5:151087157-151087179 CTGTGCTTCTGCAGGAAGGAGGG + Exonic
1001820186 5:174704260-174704282 TTGAAGGTCTGAAGGAAGAAAGG + Intergenic
1003184918 6:3822231-3822253 GTATAGGTCTGGGGGAAGAAAGG - Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004169152 6:13282441-13282463 ATGAAGGACTGCAGGAATGAGGG - Intronic
1005344720 6:24877895-24877917 GGGTAGTTTGGCAGGAAGGACGG + Intronic
1005498774 6:26412133-26412155 TTGAAGGTTTGCAGAAAGGAGGG + Intronic
1006079370 6:31556426-31556448 AAGTAGGTCCACAGGAAGGAAGG + Intronic
1006960493 6:37925381-37925403 CTGTAAGACTACAGGAAGGACGG + Intronic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007344057 6:41214971-41214993 GAGTAGTTTAGCAGGAAGGACGG + Intergenic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1008115659 6:47546452-47546474 GTCTAGGTCTGTAGCAAGGCTGG - Intronic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1011132992 6:84071619-84071641 GTCTAGGTCTCTAGGAAGGCTGG + Intronic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1012847958 6:104413422-104413444 GTTTAGCTCTGCAGGAGGGAAGG - Intergenic
1014078521 6:117264453-117264475 GGGTAGGGTCGCAGGAAGGAGGG + Intergenic
1014304690 6:119726347-119726369 GTGTAGGTCTCTAGCAAGGCCGG + Intergenic
1014856808 6:126412031-126412053 GTGGAGGGATGGAGGAAGGAAGG - Intergenic
1015565727 6:134568501-134568523 GTCTAGGTCTCCAGCAAGGCTGG - Intergenic
1016343534 6:143086808-143086830 GTATAGGTCAGAAGGAAAGATGG + Intronic
1017190340 6:151647230-151647252 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1019966154 7:4500283-4500305 GAGTAGTTTGGCAGGAAGGACGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021473951 7:21039248-21039270 GTCTAGGTCTCCAGCAAGGCTGG + Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022959485 7:35412955-35412977 GTGTAGGTCCACAGGCAAGATGG - Intergenic
1024745219 7:52398830-52398852 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic
1025022037 7:55487877-55487899 CTGTAGGCCTGGGGGAAGGAAGG - Intronic
1026539836 7:71270038-71270060 GTGTAGGGCAGCAGGGAGGTAGG - Intronic
1028629124 7:92914542-92914564 GGGTAAATCTGCAGGAAGAAAGG - Intergenic
1028698311 7:93744214-93744236 GTGAAGATCAGGAGGAAGGAAGG + Intronic
1028930387 7:96406691-96406713 GTTAGGGTCTGCATGAAGGAAGG + Intergenic
1028993312 7:97074032-97074054 GTCTAGGTCTCCAGCAAGGCTGG + Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1030635415 7:111942680-111942702 GAGTAGTTTGGCAGGAAGGATGG - Intronic
1032511619 7:132477236-132477258 GTGTATGTATGCAGGGAGGTGGG - Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033550582 7:142443742-142443764 GTGTAGTTGTGCAGGAAATACGG + Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1037997008 8:23359982-23360004 GTGTGTGTGAGCAGGAAGGAGGG - Intronic
1038224746 8:25645468-25645490 GCTTAGGTTTGCAGGGAGGAGGG - Intergenic
1038426646 8:27468276-27468298 GTGTATGTGTGCAGGGAGGCAGG - Intronic
1039954189 8:42194859-42194881 GTGCATATTTGCAGGAAGGAGGG + Intronic
1040548460 8:48420303-48420325 GAGTAGGGCTGAAGGCAGGAGGG - Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042091791 8:65166563-65166585 GTGTGGGTCAGTGGGAAGGAGGG - Intergenic
1042709975 8:71706704-71706726 GCGTTGCTCTGCTGGAAGGAGGG + Intergenic
1042809041 8:72803921-72803943 GTGTATCTGTGCAGGCAGGAAGG + Intronic
1042871972 8:73407794-73407816 GTGAAGGCCTGCAGGAAAGTCGG - Intergenic
1043564606 8:81534239-81534261 GAAAGGGTCTGCAGGAAGGAAGG - Intergenic
1043968319 8:86504155-86504177 TTGTAGGATAGCAGGAAGGATGG - Intronic
1046739270 8:117811375-117811397 GTGTAGGTTGGCAGGAGGAAGGG - Intronic
1048800306 8:138188683-138188705 GGGCAGGGCTGCAGGAAGGCAGG - Intronic
1049174999 8:141186816-141186838 ATGATGGTCTGCAGGCAGGAGGG - Intronic
1049240072 8:141533198-141533220 GTGAATGCCTGGAGGAAGGAGGG - Intergenic
1049602627 8:143514993-143515015 GTGTGTGTCTGCAGGATGGTGGG - Intronic
1051164585 9:14248257-14248279 GTTTAGGTGGGAAGGAAGGAAGG - Intronic
1052836350 9:33252861-33252883 GGGTAGGGTTGGAGGAAGGAAGG + Exonic
1052857890 9:33418332-33418354 GTGTCGGCCCGCAGGATGGAAGG - Intergenic
1052998504 9:34564545-34564567 GTCTGGGTCTCAAGGAAGGAGGG + Intronic
1056005048 9:82260731-82260753 GTGTTGGTGAGCAGGGAGGAGGG + Intergenic
1056380461 9:86052880-86052902 GTGTCGGGCAGGAGGAAGGAGGG - Intronic
1056606474 9:88089858-88089880 GTGGGAGTCTGCACGAAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057329221 9:94097012-94097034 GAGTAAGTGTGCAGGAGGGAAGG - Intronic
1057495299 9:95555610-95555632 GCAGAGGTCTGCAGGAAGTAAGG - Intergenic
1057528910 9:95826931-95826953 GGGCAGGTGTGCAGGAAGAAGGG - Intergenic
1059028972 9:110668659-110668681 GTGTAGGGCTGGAGGAACAAGGG - Intergenic
1059155466 9:111985018-111985040 GTGGAGGGGTGGAGGAAGGAAGG + Intergenic
1059627028 9:116078431-116078453 GTGTAGGTGGGAAGGAAGGTGGG + Intergenic
1059961722 9:119571752-119571774 GTTATGGTCTGCTGGAAGGATGG + Intergenic
1060082600 9:120665158-120665180 GGGTAGGTGAGAAGGAAGGATGG - Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061298806 9:129692561-129692583 TTGCAGGGCTGCAGGAGGGACGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1185549776 X:973777-973799 GTTTAGCTCTGCAGTAAGAAGGG + Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1193694179 X:84686670-84686692 GTGGAGGTCTGCAGTGAGGCTGG + Intergenic
1193860788 X:86664375-86664397 GTGTTGGTCGGGAGGAGGGAGGG + Intronic
1196225029 X:113156764-113156786 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
1196590348 X:117480384-117480406 GTCTAGGTCTTCAGCAAGGCTGG + Intergenic
1198287865 X:135210322-135210344 GTGTAGGACTGAGAGAAGGATGG + Intergenic
1198541823 X:137648188-137648210 GTGACTGTTTGCAGGAAGGAGGG + Intergenic
1198800548 X:140443887-140443909 TTCTAGGACTGGAGGAAGGAAGG + Intergenic
1200079091 X:153566711-153566733 GTGCAGGTGTGCAGGAAGGTTGG - Intronic
1200414996 Y:2900274-2900296 GTGTAGGTCTCTAGCAAGGCTGG - Intronic
1201307876 Y:12566617-12566639 GTCTAGGTCTGTAGCAAGGCTGG + Intergenic